ID: 1036964512

View in Genome Browser
Species Human (GRCh38)
Location 8:13280975-13280997
Sequence TGTGGAGTTACAGCATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036964512_1036964517 22 Left 1036964512 8:13280975-13280997 CCCTAAAATGCTGTAACTCCACA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1036964517 8:13281020-13281042 GTATCCAATAGTCCATGACAAGG No data
1036964512_1036964515 0 Left 1036964512 8:13280975-13280997 CCCTAAAATGCTGTAACTCCACA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1036964515 8:13280998-13281020 GAAGATCTTCTCCACTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036964512 Original CRISPR TGTGGAGTTACAGCATTTTA GGG (reversed) Intronic
901365984 1:8748752-8748774 TGTGGACTTTAAGCATTTCAAGG + Intronic
901759467 1:11461266-11461288 TGCTGAGTTAGAGCATTTTTAGG - Intergenic
903397466 1:23012811-23012833 TGTGCAGTGAAAGTATTTTAAGG - Intronic
903559206 1:24215406-24215428 TGTGGAGGAAGAGCATTCTAGGG + Intergenic
905411674 1:37774357-37774379 AATGGAGTTAAAGTATTTTAAGG + Intergenic
906928080 1:50140460-50140482 TATGAAACTACAGCATTTTAAGG - Intronic
906977090 1:50587574-50587596 TCTGGATTTAAAGAATTTTAGGG - Intronic
908921668 1:69201656-69201678 TGTGGAATTACAGAATAATATGG + Intergenic
909960460 1:81834368-81834390 TTTGCAGTTACAGAATTTGAAGG + Intronic
915092163 1:153434243-153434265 TGTGAAGTTACACCTTTTTGGGG - Intergenic
916216051 1:162396071-162396093 TTTGGGGTCACAGCAATTTATGG - Exonic
916380605 1:164206687-164206709 TCTGGAGGGACAGAATTTTAAGG + Intergenic
916635062 1:166659409-166659431 TCTGGAGGAACAGAATTTTAAGG + Intergenic
916752903 1:167739831-167739853 TGTGGAGTTGCTACATTTTCTGG - Intronic
918360273 1:183750648-183750670 TTTGGAATTTCAGCATTTTTGGG + Intronic
918678379 1:187319620-187319642 TGTGGAGAAACAGCATTTCCAGG + Intergenic
919085247 1:192913173-192913195 TGTGTAGTTTCAACATTATATGG + Intergenic
919219660 1:194610144-194610166 TGTGGAGTTGCAAAAGTTTAGGG + Intergenic
919417456 1:197329146-197329168 AGTGGATTTTCAGCAGTTTAGGG - Intronic
923932350 1:238716346-238716368 TGTGGACCCACATCATTTTAAGG - Intergenic
1064142265 10:12800240-12800262 TTTGGATTTATAGCATTTAATGG - Intronic
1066526660 10:36287311-36287333 AGTGGAAGTACAGCATTTTTTGG - Intergenic
1066645248 10:37600799-37600821 TGTGGAGATAAATCATATTATGG + Intergenic
1067346058 10:45439982-45440004 TGGGGAGCTCCAGCATTTCAGGG + Intronic
1067854129 10:49777091-49777113 TCTGGATTTACAGCATCTCAGGG + Intergenic
1069319352 10:67148804-67148826 TGTGGATTTACTGCATTTCTTGG - Intronic
1070938625 10:80322455-80322477 TAGGGAGTTAGAGCATTTGAGGG + Intergenic
1071225943 10:83527423-83527445 TGTGGAGTTACTGGAGTTAATGG - Intergenic
1073385134 10:103120569-103120591 TGTGAAGTTACGGTATCTTATGG - Intronic
1073762734 10:106648402-106648424 AGTGGAGTTAAAGTAGTTTAAGG - Intronic
1075146039 10:119883994-119884016 TGTGGAGTTACAGCTCTTAAAGG - Intronic
1075441653 10:122484679-122484701 GGTGGTGTTACCACATTTTATGG + Intronic
1075623540 10:123945584-123945606 TGTGTATTTATAGCTTTTTATGG + Intergenic
1077495112 11:2883211-2883233 ACTGGAGTTGCAGCATTTTTCGG + Exonic
1078312012 11:10253511-10253533 TGTGGAGAAACAGAATATTATGG + Intronic
1078381496 11:10846136-10846158 TGAGGAGATCCAGCAGTTTAAGG - Intronic
1078613309 11:12841073-12841095 TGGGAAGTTACATTATTTTATGG + Intronic
1085968651 11:81559953-81559975 TGGGAAGATACTGCATTTTAAGG + Intergenic
1086596122 11:88573310-88573332 TGAGGAGTCACATCATTTTTAGG - Intronic
1087529937 11:99367494-99367516 TGTGTAGGGAGAGCATTTTATGG + Intronic
1090194308 11:124801293-124801315 TGTTAAGTTCCAGCACTTTAAGG - Intergenic
1090843074 11:130509329-130509351 AGTGGAGTTACAGTTTTTTCTGG + Intergenic
1092521960 12:9284587-9284609 TGTGAAGTTAAAACATTTTAGGG + Intergenic
1092545322 12:9447269-9447291 TGTGAAGTTAAAACATTTTAGGG - Intergenic
1093645368 12:21579986-21580008 TGTGGAATGTCAGCATGTTAGGG - Intronic
1094219872 12:27980583-27980605 TGTAGAGTTAAAGCATCCTATGG - Intergenic
1094395754 12:30003550-30003572 TCTTAAGTTACAGCATATTATGG - Intergenic
1094507629 12:31074781-31074803 TGTGAAGTTAAAACATTTTAGGG + Intronic
1100513310 12:95299179-95299201 AGTGGAGTTACTGCAGCTTAGGG + Intronic
1100649747 12:96572407-96572429 CGTGAAATAACAGCATTTTAGGG + Intronic
1102586709 12:113928564-113928586 TCTGAAGGAACAGCATTTTAGGG + Intronic
1104750301 12:131234177-131234199 TTTGAAGTGACAGCATTTTTTGG + Intergenic
1104782415 12:131430284-131430306 TTTGAAGTGACAGCATTTTTGGG - Intergenic
1105238436 13:18584985-18585007 TGTGGACATACACCATTTTTAGG + Intergenic
1105541117 13:21318318-21318340 TGTGGATTTACCCCATTTTGTGG - Intergenic
1107427549 13:40308910-40308932 TGTGGATTTACTTCATTTTATGG - Intergenic
1107660850 13:42637806-42637828 TCTGGAGATACAGCCTTTTGGGG + Intergenic
1107663673 13:42665978-42666000 TGTGGAGGAAAAGCATTCTAAGG - Intergenic
1108507465 13:51125486-51125508 TTTTGAGTTACAGCATTGAAAGG - Intergenic
1111583738 13:90257825-90257847 TGTGAGATTTCAGCATTTTAGGG - Intergenic
1111638185 13:90932380-90932402 TGAGGAGTAACAACATTTAAAGG - Intergenic
1113014408 13:105811609-105811631 TGTGAGGTTTTAGCATTTTATGG - Intergenic
1115434867 14:33360931-33360953 TTTGGAGTGACAGCACTTGAGGG - Intronic
1115658472 14:35466720-35466742 TCTGGAGGTATAGCATTTTCAGG - Intergenic
1118497849 14:66326502-66326524 TTTGAAGTTACAGTTTTTTAGGG + Intergenic
1120231815 14:81848499-81848521 TCTGGAGGAACAGAATTTTAAGG - Intergenic
1121464665 14:94107407-94107429 TGTTGAGTTGTAGCATTTTTTGG + Intronic
1122306709 14:100771065-100771087 TGTGGAGTTGCCGCGTTTGAAGG + Intergenic
1126803601 15:52322774-52322796 TTTAGAGTTAAAGGATTTTAAGG + Intronic
1130054450 15:80510288-80510310 AGGGGAATTCCAGCATTTTAAGG + Intronic
1130708042 15:86251943-86251965 TTTGGAGCTACAACAGTTTAAGG + Intronic
1133086750 16:3370339-3370361 TGTGGAGATAAATCATATTATGG + Intronic
1140910328 16:79445514-79445536 TCTGGACTTACAGCCTTCTAAGG - Intergenic
1146186473 17:30727648-30727670 TCTGGAGTCTCAGCATTCTAGGG + Intergenic
1149525538 17:57352686-57352708 TGTCTAGGTACAGCCTTTTAAGG - Intronic
1149677604 17:58479930-58479952 TGTGTAGTTACTGTATTTTTGGG + Exonic
1150296441 17:64010860-64010882 ATTGGAGTTAAAGCATTCTAAGG + Intronic
1152846330 17:82601905-82601927 TGTGGAATTAGAGTATTTTGAGG + Exonic
1154511832 18:15112846-15112868 TGTGGACATACACCATTTTTAGG + Intergenic
1158177981 18:54679037-54679059 TTTGGGGTTAAAGTATTTTATGG + Intergenic
1158672334 18:59487816-59487838 AGTGGAGTTACTGGATTATATGG - Intronic
1159233625 18:65642110-65642132 TTTTGAGTTTCAGAATTTTAAGG - Intergenic
927280384 2:21299710-21299732 TGTTGAGTAACTGAATTTTATGG - Intergenic
928202248 2:29255530-29255552 GGTGGAGAAACAGCATTTTAGGG + Intronic
928377277 2:30785923-30785945 TGGGGTGTTTCAGCATTCTAGGG - Intronic
929704270 2:44194291-44194313 TGTGGAGACCAAGCATTTTATGG + Intronic
931089972 2:58875339-58875361 TGAGGAATTAAAGCAGTTTAGGG + Intergenic
931347710 2:61461979-61462001 CCTGTAGTCACAGCATTTTAGGG + Intronic
931461642 2:62455080-62455102 TTTGGAGTGATAGCATTTTAAGG - Intergenic
931932912 2:67160975-67160997 TGAGGAATTACAGAATTTTCTGG + Intergenic
933682643 2:85116079-85116101 TATGGAATTAAATCATTTTATGG - Intergenic
936575144 2:113647117-113647139 TGTGGATATACCACATTTTATGG - Intergenic
938511399 2:131949595-131949617 TGTGGACATACACCATTTTTAGG + Intergenic
940989863 2:160086163-160086185 TGTGCAGTGACAGCAGTTTGAGG + Intergenic
941127335 2:161600404-161600426 TCTGGAGATGAAGCATTTTAAGG + Intronic
944832437 2:203546327-203546349 TTTGGAGATACAGCCTTTAAAGG - Intergenic
945076447 2:206044265-206044287 TGTGGAGTTACAGGAATAGATGG + Intronic
945297888 2:208189070-208189092 TATAGAGTTACAGAATGTTAGGG - Intronic
946549980 2:220790805-220790827 TGTACAGTTATAGGATTTTAGGG - Intergenic
947258682 2:228195729-228195751 TCTGGATTTACAATATTTTATGG - Intergenic
948758450 2:240173590-240173612 TGTGTAGAGACAGCATTTTAGGG + Intergenic
1169037447 20:2465204-2465226 TTCGGAGTTACAACTTTTTAAGG + Intronic
1169638293 20:7719976-7719998 GGTGGATTTAAAGCATTTCAAGG - Intergenic
1170908460 20:20538907-20538929 TGTGGTGTTACAGCAGAATACGG - Intronic
1173537299 20:43825384-43825406 TCTAGGGCTACAGCATTTTAAGG - Intergenic
1174468217 20:50733507-50733529 CGTGTAGTTACAGCAATTTAAGG + Intronic
1176782422 21:13213267-13213289 TGTGGACATACACCATTTTTAGG + Intergenic
1176961420 21:15163294-15163316 TGTGAAGATACAGCATTCCAGGG + Intergenic
1182190112 22:28451121-28451143 TGTGGAGTTTCACCATATTTTGG - Intronic
1182923071 22:34097904-34097926 TTTGGACTTACTGCATTTGAGGG + Intergenic
1183210395 22:36447786-36447808 TTAGGAGTTACAGCATCTGAAGG + Intergenic
1184459551 22:44629176-44629198 TGTGAAGTGACAGCCTTGTATGG + Intergenic
1185425035 22:50763782-50763804 TGTGGATATACCACATTTTATGG + Intergenic
951389989 3:22090918-22090940 TGTGAAGTTACAGCATGCTCAGG + Intronic
951844866 3:27074463-27074485 TGTGGATTTACAACTTTTTTAGG + Intergenic
952161463 3:30697764-30697786 TGTGTTGTTGCAGTATTTTAAGG + Intergenic
955704760 3:61716601-61716623 CCTGAAGTCACAGCATTTTAGGG + Intronic
957218968 3:77357682-77357704 TTTGGAGTTACAAGCTTTTAAGG - Intronic
957719198 3:83971905-83971927 AGTTGAGTTACAGAATTTTCTGG - Intergenic
959987258 3:112588238-112588260 TGTGGAATTACTGTATTATATGG + Intergenic
961071990 3:123940594-123940616 TGGGGAGTAACAACTTTTTAAGG - Intronic
963090024 3:141475424-141475446 GGTGGAATTACTGCATTTTGTGG - Intergenic
963951053 3:151201438-151201460 TTTGGAGTCATAGGATTTTAAGG + Intronic
965061513 3:163789869-163789891 TGTGGATTTTCAGCAGTTCAGGG - Intergenic
965062153 3:163797597-163797619 CCTGTAGTTACAGCATTTTGGGG - Intergenic
965379641 3:167972437-167972459 TGTAGCTTTACAGCATTTGAAGG - Intergenic
965880039 3:173378140-173378162 GGTGGAATAACAGCATTTTAGGG - Intergenic
967506708 3:190260702-190260724 TGTATACTTAAAGCATTTTATGG + Intergenic
968834923 4:2956184-2956206 TGTGGAATTATAGCAGTTTGAGG - Intronic
969923953 4:10568042-10568064 TGTGGAGTTGCTGGATTATATGG - Intronic
970927892 4:21474068-21474090 TGTGGAGTAACAGAACTTGATGG + Intronic
973143048 4:46792773-46792795 TGTAGAGTAAAAGAATTTTAAGG + Intronic
973858156 4:55034042-55034064 TGTCCAGTGACTGCATTTTAAGG - Intergenic
977081737 4:92538626-92538648 TGTAGAGTAACAGCTGTTTATGG - Intronic
977570843 4:98627749-98627771 TTTTGAGTTACAGCAATTCATGG - Intronic
980669222 4:135982144-135982166 TGAGCTGTTTCAGCATTTTAAGG - Intergenic
980787581 4:137574357-137574379 TGTGGAGAGAGATCATTTTATGG + Intergenic
983736370 4:171067566-171067588 TGTGGAGATACACCATCTTGTGG - Intergenic
984294804 4:177840845-177840867 TTTGGAGTTTCAGATTTTTATGG + Intronic
985914693 5:2907979-2908001 TGTGGAGTAGCTGCATTTCAAGG - Intergenic
986633185 5:9794834-9794856 TGTGGAGATACAGCCTTTCTTGG + Intergenic
987313443 5:16702003-16702025 TTTGGAGATACAGCTTTTAAAGG + Intronic
990617562 5:57522895-57522917 TGTGGAGTTAAATCAGTTGAAGG + Intergenic
990786385 5:59425072-59425094 TGTGGCTTTACTGCATTTTCAGG - Intronic
990902032 5:60761973-60761995 TGTGGAGATAAATCATATTATGG + Intronic
991132020 5:63133324-63133346 TGAGGAGTCTCAGTATTTTAGGG - Intergenic
992662399 5:78974621-78974643 AGTGGAGTTAGAGGATTTTCTGG - Intronic
993003863 5:82410432-82410454 TTTGGAGATACAGTCTTTTAAGG + Intergenic
993600354 5:89915476-89915498 TCTGGGGTCACAGCTTTTTAAGG - Intergenic
996443360 5:123515597-123515619 TGTGGGGTTACATTATTTTAGGG - Intronic
998705988 5:144761372-144761394 TTTGGAGTTACTTTATTTTAGGG + Intergenic
999841254 5:155430020-155430042 TGTGCAATTTCAGCATTTAATGG - Intergenic
1000049897 5:157553607-157553629 TGTAGAGTTACAGGATCCTATGG - Intronic
1000179031 5:158789718-158789740 TGTAGAGTCACCACATTTTAAGG - Intronic
1002157250 5:177292803-177292825 TTTGGGGTTAGAGAATTTTAGGG + Intronic
1003086835 6:3067270-3067292 TGTGGAGTTGCTTCATCTTATGG + Intronic
1003410484 6:5857814-5857836 TGTGGATTTACCCCATTTTGTGG + Intergenic
1003626542 6:7746461-7746483 TCTGTATTTACAGCATTTGAGGG + Intronic
1004652346 6:17622538-17622560 TGGGGAAAGACAGCATTTTAGGG - Intronic
1006974083 6:38080731-38080753 GCAGAAGTTACAGCATTTTATGG + Intronic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1009821622 6:68809974-68809996 TTTGGAGTAAGAGCATTTTGTGG + Intronic
1010969221 6:82246781-82246803 TGTGAATTTACACCACTTTATGG + Intronic
1010994930 6:82522589-82522611 TGTGGACTTACATCATAGTAGGG + Intergenic
1015437394 6:133204835-133204857 TGTAGAGTTACAGTATCTTTGGG - Intergenic
1016165870 6:140942425-140942447 TATGGAGTTATATCATTATAAGG - Intergenic
1016595760 6:145798084-145798106 TGTGGATTTTCTGCATGTTATGG - Exonic
1017854804 6:158340908-158340930 TGAGGAGTTAAAGAATTTTAAGG + Intronic
1018007328 6:159634571-159634593 AGGGAAGTTACAGCATTCTAAGG + Intergenic
1019387227 7:764125-764147 TGGGGAGAAGCAGCATTTTAAGG + Intronic
1020655830 7:10927118-10927140 TGTGGATTTCCAGGATTCTACGG + Intergenic
1023130402 7:36997416-36997438 AGTGGAGTCACAGCATTAAAAGG + Intronic
1023785037 7:43697679-43697701 TGTGGAATTCCAGAATTTTCAGG - Intronic
1024810085 7:53199862-53199884 TATGGAAATACTGCATTTTAAGG - Intergenic
1025731437 7:64112138-64112160 TGTGGAGATAAATCATATTATGG + Intronic
1030161093 7:106509192-106509214 GTTGGTGTTACAGCATTCTAGGG + Intergenic
1030864190 7:114678637-114678659 TGTGTTCTTATAGCATTTTAAGG - Intronic
1031337321 7:120551890-120551912 TCTGGAGTTATAGCACTTTCTGG + Intronic
1032104627 7:129016424-129016446 TGTGTCATTAAAGCATTTTACGG - Intronic
1032534068 7:132646045-132646067 TGTGGAGGTACAGTATATTATGG + Intronic
1036220824 8:6920662-6920684 TGTGGAATTACAGCAACTCAGGG - Intergenic
1036964512 8:13280975-13280997 TGTGGAGTTACAGCATTTTAGGG - Intronic
1037136166 8:15463833-15463855 TGTGATGTTACAGCATATTCTGG - Intronic
1037411468 8:18602948-18602970 TGTGAAGTTACAACTCTTTACGG - Intronic
1039261133 8:35773171-35773193 GGTGGACTAACAGAATTTTAAGG - Intronic
1040458927 8:47628058-47628080 TAGGGAGTTCCTGCATTTTAAGG - Intronic
1042189455 8:66170769-66170791 AGTGGAATTGCAGGATTTTATGG - Intronic
1042913098 8:73846759-73846781 TGGGGAGTTAAAGCATTTTAAGG + Intronic
1043195276 8:77285384-77285406 TGTGGAGTCAAAGTATTTTCTGG - Intergenic
1043242663 8:77955656-77955678 TGTGTATTTACAACATGTTATGG - Intergenic
1044721292 8:95150839-95150861 TGTGATGTTACAGTATGTTATGG - Intronic
1045327710 8:101128911-101128933 TGCGGGGTTACAGCATTCCAAGG - Intergenic
1046342857 8:112881260-112881282 TGGGGACTTACAACATTTTGAGG + Intronic
1046485286 8:114879659-114879681 AGTGGAGATAGAGCATTTTAGGG - Intergenic
1050621405 9:7455981-7456003 GGTGGAGTGACAGCATGCTAGGG - Intergenic
1050692734 9:8246528-8246550 TTTGAAGTTAAAACATTTTAAGG + Intergenic
1050837659 9:10103834-10103856 AGTGGAGTTAAAGAATTTAATGG + Intronic
1050893404 9:10853637-10853659 TGTGGGCTTCTAGCATTTTAGGG - Intergenic
1052354597 9:27491416-27491438 TGTACTGTTACAGCATTTTGGGG + Intronic
1053334500 9:37253424-37253446 ATTGAAGTTATAGCATTTTATGG + Intronic
1055689144 9:78810910-78810932 TGTGGAGATAAATCATATTATGG + Intergenic
1056494212 9:87140170-87140192 TCTGGAGTTACGGAATTGTATGG + Intergenic
1057932761 9:99210467-99210489 TGTGGAGTTACATCTATTTGAGG + Intergenic
1058324299 9:103676479-103676501 TTTGTAGTTACATCACTTTATGG + Intergenic
1059685611 9:116632822-116632844 AGTGGACTTACCACATTTTATGG + Intronic
1059870757 9:118571603-118571625 CGTGGAGTTACTGGGTTTTAGGG + Intergenic
1061562614 9:131415798-131415820 TGTGAAATTTCAGCATGTTAGGG - Intronic
1061641901 9:131965014-131965036 TCTGGATTTACAGCATTTGCAGG + Intronic
1061700742 9:132413572-132413594 TGTGGAGTCACAGAATTCTGGGG - Intronic
1061823180 9:133239806-133239828 AGTGGAGTTACAGAACTTTCAGG - Intergenic
1202629362 M:3851-3873 TGTGGAGATAAATCATATTATGG - Intergenic
1185498207 X:575149-575171 TGCAGAGGTAAAGCATTTTAAGG + Intergenic
1191139796 X:57104972-57104994 TGGGGGGTAACTGCATTTTAAGG - Intergenic
1192409230 X:70918095-70918117 TGTGGAATTACTGGATTATATGG + Intergenic
1195931427 X:110081125-110081147 TGTAAAGTTAAAGTATTTTAAGG - Intronic
1197295795 X:124717463-124717485 GCTGGAGTTACAACATTATAGGG + Intronic
1198030488 X:132749388-132749410 TGTACAGTTACAGAATTTTATGG - Intronic
1201422347 Y:13813323-13813345 TGTGCAATTACCACATTTTAGGG - Intergenic
1201997885 Y:20114818-20114840 TTGAGTGTTACAGCATTTTAAGG + Intergenic
1202003821 Y:20194204-20194226 TTGAGTGTTACAGCATTTTAAGG + Intergenic