ID: 1036971767

View in Genome Browser
Species Human (GRCh38)
Location 8:13363073-13363095
Sequence ACAGAGCCTACACTTTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036971758_1036971767 27 Left 1036971758 8:13363023-13363045 CCCTTCTACTGTGTGCTAGATAT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1036971767 8:13363073-13363095 ACAGAGCCTACACTTTGTGGGGG No data
1036971759_1036971767 26 Left 1036971759 8:13363024-13363046 CCTTCTACTGTGTGCTAGATATG 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1036971767 8:13363073-13363095 ACAGAGCCTACACTTTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036971767 Original CRISPR ACAGAGCCTACACTTTGTGG GGG Intronic
No off target data available for this crispr