ID: 1036975389

View in Genome Browser
Species Human (GRCh38)
Location 8:13405291-13405313
Sequence CACAGAGGGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1537
Summary {0: 1, 1: 0, 2: 8, 3: 127, 4: 1401}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036975389 Original CRISPR CACAGAGGGGAGAAGGAGGG AGG (reversed) Intronic
900146818 1:1162201-1162223 CACAGCTGGGGGAATGAGGGAGG - Intergenic
900149098 1:1170537-1170559 CGGAGAGAGGAGGAGGAGGGAGG - Intergenic
900354414 1:2253339-2253361 CACAGCGGGCAAAAGGTGGGAGG + Intronic
900365270 1:2309668-2309690 CACAGGGAGGAGGAGGTGGGGGG - Exonic
900378929 1:2374067-2374089 CACCATGGGGAGAGGGAGGGTGG + Intronic
900569567 1:3351658-3351680 GAGGGAGGGGAGAAAGAGGGAGG - Intronic
900701224 1:4049741-4049763 GAGAGGGGGGAGAAGGAGAGAGG + Intergenic
900707442 1:4089514-4089536 CACAGATGGGAGCTGCAGGGCGG - Intergenic
900752276 1:4406127-4406149 ACCAGAGAGGAGGAGGAGGGAGG + Intergenic
900803485 1:4752144-4752166 GAGGGAGGGGAGGAGGAGGGAGG + Intronic
900822199 1:4898419-4898441 CACACAGGGGGCAAGGTGGGAGG - Intergenic
900852706 1:5156679-5156701 GAGTGAGGAGAGAAGGAGGGAGG + Intergenic
900892676 1:5460921-5460943 CACATAGGGAAGATGGAGGCCGG + Intergenic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901373134 1:8817523-8817545 GAGAGAGGGGAAAAGGACGGGGG + Intronic
901473557 1:9473879-9473901 CACAGAGGGGAGACGGCTGTGGG - Intergenic
901685406 1:10940903-10940925 CCCCGTGGGGAGAAGGTGGGTGG - Intergenic
901751693 1:11413915-11413937 GAGAAGGGGGAGAAGGAGGGAGG - Intergenic
901865512 1:12104335-12104357 CACAGAGGGGAACAGAAGGAAGG - Intronic
902203766 1:14852521-14852543 GACAGTGGGAAGAAGCAGGGAGG - Intronic
902373598 1:16019747-16019769 CACTGAGGTGAGATGGAGAGAGG + Intronic
902483361 1:16724485-16724507 GAGAGAGGGGGGAAGGGGGGGGG + Intergenic
902664161 1:17925865-17925887 CACAGAGGGGGGAGGGGGGCAGG + Intergenic
902833112 1:19030207-19030229 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903093406 1:20944534-20944556 AAAAGTGGGGAGAAGGAGAGAGG + Intronic
903151837 1:21415235-21415257 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
903365710 1:22804569-22804591 CCTAGAGGGGCTAAGGAGGGTGG - Intronic
903406770 1:23103896-23103918 GAGGGAGGGGGGAAGGAGGGAGG + Intronic
903550755 1:24156208-24156230 CAGTGAGGGTAGAAGGAAGGAGG + Exonic
903772149 1:25770717-25770739 CAGAGAGGGGAGAAGGAAAGTGG - Intronic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904026969 1:27510097-27510119 CCCAGAGGGGAGAAGGGGAAAGG - Intergenic
904480734 1:30791720-30791742 AAGAGAGGGAAGAAGGAAGGAGG + Intergenic
904482862 1:30805178-30805200 CACAGAGCTGGGAAGGTGGGTGG + Intergenic
904489162 1:30847638-30847660 TACAGAGGGGAGCTGCAGGGAGG - Intergenic
904594979 1:31638263-31638285 TACAGATGGGGGAGGGAGGGAGG + Intronic
904939513 1:34155641-34155663 CTCAGGGGTGAGAAGGAGGGTGG - Intronic
905009398 1:34736976-34736998 CACCGAGGGGCCAAGGAGAGAGG - Intronic
905187032 1:36204135-36204157 GATAGAGGAGAGAAGCAGGGCGG + Intergenic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
905282156 1:36856163-36856185 AACAGAGGAGAGAAGGCGGAGGG - Intronic
905289379 1:36911113-36911135 CACTGGGGAGAGAGGGAGGGAGG + Intronic
905636706 1:39558800-39558822 CACAGGGAGGAGAGGAAGGGAGG + Intergenic
905879832 1:41456180-41456202 GACAGAGGGGAGGAGGAGAGAGG - Intergenic
906240380 1:44239002-44239024 AGCAGTGGGGAGAGGGAGGGTGG - Intronic
906553800 1:46690521-46690543 AAAGGAGGAGAGAAGGAGGGGGG + Intronic
906642983 1:47452588-47452610 CAGAGGCGGGAGAAGAAGGGAGG + Intergenic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907278553 1:53330017-53330039 CACAGAGTGGAGGAGGAGGAGGG - Intergenic
907526536 1:55057133-55057155 GACAGAGGGGAGCACCAGGGCGG + Intronic
907581402 1:55575731-55575753 CACAGTGGGGAGGAAGTGGGTGG - Intergenic
907706257 1:56835069-56835091 CACAGATGGTAGAAGGAGCAAGG - Intergenic
907963918 1:59310709-59310731 CACTGAGGAGAGAAGGACGATGG - Intronic
907973086 1:59403821-59403843 CACAGAGGTGTGAAGCAGAGAGG - Intronic
908089096 1:60667859-60667881 CAGAGTGGGGAGAGGCAGGGGGG + Intergenic
908150227 1:61293164-61293186 CTCAGAGAAGAGAGGGAGGGAGG - Intronic
908152146 1:61313083-61313105 CCCAGAGGGAAGAAGTAGAGGGG + Intronic
908204552 1:61832177-61832199 GGTAGAGGGTAGAAGGAGGGTGG + Intronic
910135676 1:83966343-83966365 GACAGAGGGAAGGAGGAGGGAGG - Intronic
910353273 1:86324331-86324353 CACAAGGCGGAGAAGGAGGTGGG + Intergenic
910482117 1:87670093-87670115 CAAAGAGGAGAGGAGAAGGGAGG + Intergenic
911175162 1:94811175-94811197 AATAAGGGGGAGAAGGAGGGAGG - Intergenic
911371742 1:97002493-97002515 TACAGAGGCCAGAGGGAGGGAGG - Intergenic
911550689 1:99275893-99275915 CACAGTAGGGAGAGGGAGAGGGG + Intronic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
911968271 1:104395428-104395450 AAGAGAGGGGAGAAGGCGAGAGG + Intergenic
911973797 1:104466666-104466688 CACGGATGAGAGAAGGAGAGTGG - Intergenic
912208877 1:107536846-107536868 CACTGAGGCAAGAATGAGGGAGG + Intergenic
912391372 1:109305486-109305508 GCCAGAGGGGAGAAGCATGGGGG + Intronic
912708311 1:111931221-111931243 GAAAGAGGTGAGAAGGAAGGAGG + Intronic
912815429 1:112824662-112824684 GACTGAGGGGACAAGGCGGGAGG + Intergenic
912860765 1:113211775-113211797 CAGGGAGGGGAGATGGGGGGAGG + Intergenic
912980574 1:114368067-114368089 CAGAGAGGAGAGAAAGAGAGGGG - Intergenic
913049766 1:115106974-115106996 CACAGAGGGGTGGAGGAAGTGGG + Intergenic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913286679 1:117233051-117233073 CGCAGAGGGAAGGAGGAGGAAGG - Intergenic
913298268 1:117343509-117343531 CACAGGTGGGAGATGGAGAGAGG + Intergenic
913569999 1:120110372-120110394 TGCTGAGGGGAGAGGGAGGGAGG - Intergenic
913606999 1:120475891-120475913 GAGGGAGGAGAGAAGGAGGGAGG - Intergenic
913697011 1:121336448-121336470 GGCAGAGGGGAGAAGGAAGGGGG - Intronic
913988343 1:143585716-143585738 AAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914140548 1:144943596-144943618 GGCAGAGGGGAGAAGGAAGGGGG + Intronic
914209434 1:145564253-145564275 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914268354 1:146056621-146056643 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914290807 1:146271338-146271360 TGCTGAGGGGAGAGGGAGGGAGG - Intergenic
914368741 1:147004240-147004262 GAGGGAGGAGAGAAGGAGGGAGG - Intergenic
914551851 1:148722121-148722143 TGCTGAGGGGAGAGGGAGGGAGG - Intergenic
914584193 1:149045947-149045969 GAGGGAGGAGAGAAGGAGGGAGG + Intronic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915058311 1:153157914-153157936 CAGAGAGGGGGGTGGGAGGGGGG + Intergenic
915580831 1:156812344-156812366 ATCAGAGGGGTGAGGGAGGGGGG - Intronic
915650784 1:157308933-157308955 GAGAGAGGGAAGAGGGAGGGAGG - Intergenic
915736517 1:158088823-158088845 CACAGATGGGAGTAGATGGGGGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916276079 1:162994749-162994771 TTCAGAGGGTAGAAGGTGGGAGG + Intergenic
916366185 1:164030492-164030514 TCCAAAGGGGAGAAGGTGGGAGG - Intergenic
916741538 1:167650806-167650828 TAAGGAGGGGATAAGGAGGGGGG + Intronic
916749948 1:167714561-167714583 CACAGCGTGGAGGAGCAGGGAGG - Intergenic
916976558 1:170086665-170086687 GAGAGAGGGAGGAAGGAGGGAGG - Intergenic
917105006 1:171483326-171483348 AGGGGAGGGGAGAAGGAGGGAGG + Intergenic
917534568 1:175864823-175864845 CAGAAAGGGGAGCAGGAGAGTGG + Intergenic
917690310 1:177461825-177461847 CACAGATGGGTGAAGCAGGATGG - Intergenic
917834631 1:178931593-178931615 AAAAGAGAGGAGAGGGAGGGAGG + Intergenic
918125856 1:181582865-181582887 CACTAAGGAGGGAAGGAGGGAGG + Intronic
918276386 1:182957072-182957094 AAAGGAGGAGAGAAGGAGGGGGG + Intergenic
918298532 1:183181013-183181035 CACAGAGCGGAAAAGGACTGGGG - Intergenic
918857757 1:189780673-189780695 GATGGAGGGAAGAAGGAGGGAGG + Intergenic
918887749 1:190218736-190218758 AATAGAGGGGACAAGGAGGGTGG - Intronic
919058836 1:192605784-192605806 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
919506133 1:198399578-198399600 CACAGAGGAGAAGAGGAGGAGGG + Intergenic
919780621 1:201218525-201218547 CACAGAGAGGAGGTGGACGGTGG + Exonic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920248390 1:204605584-204605606 CAGAGAGGAGAGAAGAAGTGGGG - Intergenic
920415339 1:205795693-205795715 CATAGAGGGGAGGATGGGGGAGG - Intronic
920440758 1:205979085-205979107 GACACAGGGAAGAAGGAGGGTGG - Intronic
920442939 1:205993513-205993535 CACATATTGGTGAAGGAGGGAGG + Exonic
920484342 1:206354785-206354807 GGCAGAGGGGAGAAGGAAGGGGG - Intronic
920501433 1:206487847-206487869 CACAGAGGAAAGAGGGAGGGAGG - Intronic
920528666 1:206685879-206685901 CAGAGAGAGAAAAAGGAGGGAGG - Intronic
920951817 1:210579128-210579150 CAGACACGGGAGATGGAGGGTGG + Intronic
921266344 1:213423790-213423812 CCCAGAGGGGAGGCGGCGGGAGG + Intergenic
921603430 1:217132070-217132092 ATCAGAGTGGAAAAGGAGGGAGG + Intronic
922362280 1:224834115-224834137 CACAGGAGGAGGAAGGAGGGAGG - Intergenic
922531716 1:226350074-226350096 GGCAGAGGAGAGAAGGAGGCAGG - Intergenic
922568238 1:226616088-226616110 CACAGAGGGGAGAGGGAGCAAGG + Intergenic
922597898 1:226827983-226828005 CACGCAGGGGAGGTGGAGGGGGG - Intergenic
922614495 1:226953631-226953653 CACTGACGGGGGAAGGACGGAGG + Intronic
923042982 1:230333040-230333062 CCCTGAGGGGAGAGGGAGGAAGG + Exonic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923551870 1:234970591-234970613 TAAAGAGGGAAGGAGGAGGGTGG - Intergenic
924112922 1:240717491-240717513 TGCAGAGGGGAAATGGAGGGAGG + Intergenic
924319900 1:242838629-242838651 CAGAGAGGGGAGTTGGAGAGGGG - Intergenic
924452077 1:244187415-244187437 CACCAAGGGGAGGAGGACGGCGG + Intergenic
924517507 1:244779094-244779116 CACAGCAGGAAGATGGAGGGTGG + Intergenic
924685125 1:246281181-246281203 CACACAGGTGAGAAGGAAGTGGG + Intronic
1062812717 10:478190-478212 AAGGGAGGGGAGAAGAAGGGAGG + Intronic
1062931483 10:1355374-1355396 CACTGAGGGGTGGAGCAGGGAGG - Intronic
1062997872 10:1883847-1883869 CACAGAGCGGAGGACGAGGCAGG + Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063624796 10:7678863-7678885 CAGAGAGGGGGAAGGGAGGGAGG + Intergenic
1063687778 10:8254958-8254980 CAAAGAGGGGAGAGGGAAGATGG - Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1064248203 10:13686245-13686267 TACAGGGAGGAGAAGGAGGAAGG + Intronic
1064305892 10:14165851-14165873 AAAAGAGGGGAGGAAGAGGGTGG + Intronic
1064324317 10:14334405-14334427 CACAGAAGGAAGAAGGTGTGGGG + Intronic
1064715696 10:18174308-18174330 AAAAGAGGGGGGAGGGAGGGAGG - Intronic
1064769848 10:18712046-18712068 CTTGGAGGGGAGAAGGAAGGAGG - Intergenic
1064859957 10:19816208-19816230 CAAAGTGTGGAGAAGGAGCGCGG + Intergenic
1064966405 10:21019376-21019398 GGAAGAGGGGAGAAGGAAGGTGG - Intronic
1065485952 10:26236832-26236854 CCCTGAGGTGAGAAGGAGGTAGG - Intronic
1065497396 10:26343313-26343335 CACACAGGGAGGATGGAGGGAGG + Intergenic
1065639817 10:27770370-27770392 AACGAAGGAGAGAAGGAGGGAGG - Intergenic
1066249335 10:33617925-33617947 CACAGAGGGGACAGGGCGGCGGG - Intergenic
1066390653 10:34975250-34975272 CTCAAAGGGGAGAATGAGGAGGG + Intergenic
1067182130 10:43996278-43996300 CACGGGGGAGAGAAGGAAGGAGG + Intergenic
1067419364 10:46133471-46133493 GACACAGGGCACAAGGAGGGTGG - Intergenic
1067426770 10:46216739-46216761 TCCACAGGGGACAAGGAGGGTGG + Intergenic
1067504715 10:46840068-46840090 GACACAGGGCACAAGGAGGGTGG - Intergenic
1067522121 10:47015885-47015907 CACAGAGGTGAGAAGAAGCGTGG + Intergenic
1067524323 10:47029106-47029128 CATGGAGCGGAGAAGGAAGGAGG - Intergenic
1067557627 10:47283699-47283721 CACAGAGGTGGGAAGGAGTCAGG + Intergenic
1067710780 10:48649512-48649534 CACAGTGGAGAGAAAGACGGTGG - Intronic
1068054185 10:51990714-51990736 CTCAGAGGGTAGAGGGTGGGAGG - Intronic
1068199109 10:53760122-53760144 CACGGAGGGGAGAGAGAGGTAGG + Intergenic
1068830719 10:61491580-61491602 GAGAGAGGGAAGAGGGAGGGAGG + Intergenic
1069034267 10:63630665-63630687 AACAGAGGGGAGAAGCAGAGGGG - Intergenic
1069197481 10:65570928-65570950 CACAGAGGGGAGGGGGAGTGAGG - Intergenic
1069464042 10:68622258-68622280 CAAAGAGGGAAGAGGGAGAGAGG - Intronic
1069819367 10:71217941-71217963 CTGGGAGGTGAGAAGGAGGGCGG - Intronic
1069835973 10:71308413-71308435 CACAGAGGAATGCAGGAGGGAGG - Intergenic
1069942847 10:71966689-71966711 CACAGAGGGCATAATGAAGGTGG - Intronic
1069964848 10:72105914-72105936 AACAGAGGTGGGGAGGAGGGTGG + Intronic
1070097994 10:73357080-73357102 CACAGGGAGGAAAAGGGGGGTGG + Intronic
1070313694 10:75292122-75292144 CACAGAGGGGACCATGGGGGAGG + Intergenic
1070672291 10:78386489-78386511 CAGAGATGAGAGATGGAGGGAGG + Intergenic
1070734557 10:78854685-78854707 GAGAGAGGGGAGAAAGATGGAGG - Intergenic
1070782966 10:79148120-79148142 GAAAGAGGGAAGAAGCAGGGAGG - Intronic
1070920981 10:80186284-80186306 GACTGAAGGGGGAAGGAGGGGGG + Intronic
1070976254 10:80608288-80608310 CACAGAGGGCGGGAGGAGGAGGG + Intronic
1071149773 10:82620399-82620421 CAGAGAGGGGAGCTGGAGAGGGG + Intronic
1071409737 10:85377354-85377376 CAGAGAGAGAATAAGGAGGGAGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071852670 10:89590889-89590911 AAAAGAGGGAAGAAGGAGAGAGG + Intronic
1071876246 10:89846362-89846384 AGGAGAAGGGAGAAGGAGGGAGG + Intergenic
1072944721 10:99799414-99799436 CACAGTGGCAAAAAGGAGGGTGG - Intronic
1073009217 10:100346946-100346968 AACAGAGGGGAGGGGGAGCGAGG + Intergenic
1073037492 10:100574584-100574606 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1073094726 10:100972666-100972688 CTAAGAGGTCAGAAGGAGGGAGG - Intronic
1073339625 10:102735158-102735180 CACAGAGGGGAGGAGGGATGAGG - Intronic
1073639971 10:105241666-105241688 CAGAGAGGGGAGCTGGAGAGGGG + Intronic
1074002438 10:109386721-109386743 GAGGGAGGGGAGAGGGAGGGAGG + Intergenic
1074104226 10:110376579-110376601 AACAGAGGAGAGAGGGAGGAAGG - Intergenic
1074339504 10:112613473-112613495 CAGAGAGGGGAGAAGGTGAAAGG - Intronic
1074462532 10:113651487-113651509 CACAGAGGGGAGTTGAGGGGAGG - Intronic
1074602289 10:114927093-114927115 GAGAGAGGGGGGAGGGAGGGGGG + Intergenic
1074827998 10:117228495-117228517 AAGGAAGGGGAGAAGGAGGGAGG - Intergenic
1074866948 10:117550151-117550173 CCCAGAAGGGGGAAGGAGGGAGG - Intergenic
1075027806 10:118999376-118999398 CACAATGGGGAGAGGGAGAGAGG + Intergenic
1075093118 10:119454436-119454458 TGCAGAGGGGAGGAGGAGGGAGG - Intronic
1075531094 10:123230411-123230433 CACAGAGGTGAGAGGGAGGCTGG + Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1075724951 10:124606367-124606389 CACTGATGGGAGAGGGAGTGGGG - Intronic
1075955426 10:126519169-126519191 AACAGAGTGGAGAGGGATGGTGG + Intronic
1076071277 10:127491867-127491889 GAGAGAGGGGAGGAGAAGGGGGG - Intergenic
1076109159 10:127848228-127848250 GAGAGAGGGGGGAGGGAGGGAGG + Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076570821 10:131431915-131431937 CCCAGAGGCAAGAAGGAGTGCGG + Intergenic
1076838118 10:133031585-133031607 CTCAGAGGGGACATGGAGCGCGG - Intergenic
1076870793 10:133192843-133192865 GAAAGAGAAGAGAAGGAGGGTGG + Intronic
1077108465 11:851864-851886 CACGGAGGACAGGAGGAGGGTGG - Intronic
1077312132 11:1893572-1893594 GAGAGAGGGGGGATGGAGGGAGG + Intergenic
1077328650 11:1974379-1974401 CGGAGACGGGAGGAGGAGGGTGG + Intronic
1077391847 11:2303937-2303959 CCCTGAGGGAAGGAGGAGGGAGG - Intronic
1077392564 11:2306887-2306909 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1077599452 11:3563820-3563842 CACACAAGGAATAAGGAGGGGGG + Intergenic
1077675596 11:4191130-4191152 CACAGAGGGGAGAGGGGGACTGG - Intergenic
1077714711 11:4569406-4569428 AACTGAGGGCAGCAGGAGGGCGG + Intergenic
1078047217 11:7926205-7926227 CAGAGAGGGGATATGGGGGGTGG - Intergenic
1078163403 11:8862022-8862044 CACAGAAGGGGGAGGAAGGGAGG + Intronic
1078657962 11:13260033-13260055 AAAACAGAGGAGAAGGAGGGAGG + Intergenic
1078727515 11:13944856-13944878 GTTAGAGGGAAGAAGGAGGGAGG + Intergenic
1078766095 11:14300136-14300158 CACTGAGGGGAAAGGAAGGGTGG + Intronic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1079370416 11:19847465-19847487 CACTGAGGGAAGAAGGCAGGAGG - Intronic
1079551599 11:21705677-21705699 CAAAGAGAGAAAAAGGAGGGGGG - Intergenic
1080329485 11:31119021-31119043 CACAAAGAGGAGGAGGAGTGGGG + Intronic
1080384076 11:31800131-31800153 CCCAGAGGGGCGAACGGGGGAGG + Intronic
1080434343 11:32226037-32226059 CAGGGAGGGGAGAAAGACGGTGG - Intergenic
1080575704 11:33597367-33597389 GGCAGAGGGGAGAAGGGAGGAGG + Intronic
1080695743 11:34601586-34601608 CTCAGAGGGCAGAAGGTGGAAGG - Intergenic
1080711559 11:34752691-34752713 CTCATAGGGAAGAGGGAGGGTGG + Intergenic
1081240686 11:40702855-40702877 CACAGGGGGATGAAGGAGTGGGG - Intronic
1081622164 11:44624997-44625019 CACAGAGGGGAGGAACAGAGTGG + Intergenic
1081625609 11:44653533-44653555 GACAGAGGGGAGAACAAGGCAGG - Intergenic
1081630844 11:44688565-44688587 ACCAGAGGGAAGAAGGAGAGAGG + Intergenic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1081896062 11:46587650-46587672 GACAGAGGGAAGAAGGAGTGAGG - Intronic
1081935885 11:46903742-46903764 CACACAGGGGAGCAGGAAGCAGG + Intronic
1083205538 11:61146573-61146595 CTGGGAGGGGAGGAGGAGGGAGG + Intronic
1083224633 11:61276996-61277018 GACAGAGGAAGGAAGGAGGGAGG + Intronic
1083266124 11:61547654-61547676 GACAGAGGGGAGAAGGGTTGGGG + Intronic
1083288946 11:61679563-61679585 CACAGAGAGGAGCAGAAGGCGGG - Intergenic
1083421307 11:62554745-62554767 CAAAGAGGGGTGGAGAAGGGAGG + Intronic
1083737112 11:64687647-64687669 CAAGGAGGAGGGAAGGAGGGAGG + Intronic
1083899669 11:65637512-65637534 CGCAGAGGGGTGAAGGATGTGGG + Intronic
1083914311 11:65730155-65730177 CTCTGAGGGGAGAATGAGGTAGG + Intergenic
1084104897 11:66975022-66975044 AGGGGAGGGGAGAAGGAGGGGGG + Intergenic
1084176026 11:67422831-67422853 CACTGAAGAGAGAGGGAGGGTGG - Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084206021 11:67593490-67593512 CACAGAAGGGAGCAGGCTGGTGG - Intergenic
1084215660 11:67645642-67645664 CCCAGAGGGGAGTGGGAGGGAGG - Intronic
1084322375 11:68380785-68380807 CACAGAGGCCAGAGAGAGGGTGG - Intronic
1084400579 11:68940689-68940711 CAGAGAGGTCAGAAGGAGAGGGG - Intergenic
1084437874 11:69154808-69154830 CACAGGAGGGAGGAGCAGGGAGG + Intergenic
1084450002 11:69231038-69231060 CAGAGATGAGAGAGGGAGGGAGG + Intergenic
1084477844 11:69398950-69398972 CACAGTGGGGACCAGGAAGGGGG + Intergenic
1084529282 11:69717523-69717545 CAGAGAGGGGAGGAGGGAGGAGG - Intergenic
1084604096 11:70162446-70162468 CAAAGTGGGGACAAGGAGAGAGG + Intronic
1084702251 11:70795073-70795095 CACAGAGGAGTCGAGGAGGGCGG - Intronic
1084817393 11:71656870-71656892 CACACAAGGAATAAGGAGGGAGG - Intergenic
1084870076 11:72092637-72092659 GACAGAGAGGAAAAGGAGGCAGG - Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085099420 11:73788041-73788063 CAGAGAGGGGAGATGGCGGAGGG + Intronic
1085402711 11:76244224-76244246 CACAGATGGGAGAATGGGGGTGG - Intergenic
1085411951 11:76296706-76296728 CACAGAGGGGTGCAGGAAGCAGG + Intergenic
1085472955 11:76769665-76769687 CACAGAGGGCAGGAGGGGAGGGG - Intergenic
1085478813 11:76805261-76805283 CTCAGAGGGGAGGAGGTGGAGGG + Intergenic
1085482999 11:76838089-76838111 TATACAGGGGAGAGGGAGGGAGG + Intergenic
1085561236 11:77474148-77474170 GGCAGAGGGGAGGAGGAGGCGGG - Intronic
1086196641 11:84148371-84148393 ATCAGAGGGGAGAGGGAAGGAGG - Intronic
1086296016 11:85369208-85369230 CACAGAGGGGAGGGGGAGCAAGG - Intronic
1086307128 11:85493669-85493691 CAGAGAGGAGAGAAGGGGAGGGG + Intronic
1087175710 11:95092933-95092955 CACACAGGGGAGGAAGAGGCAGG + Intronic
1087272282 11:96123732-96123754 CACAGATGGGGAAGGGAGGGAGG + Intronic
1087575589 11:99985306-99985328 CAGACAGGGGAGCAGGAGAGGGG + Intronic
1087978138 11:104575902-104575924 CTCAGAGGGGAGAAGGGGTGAGG - Intergenic
1088560617 11:111112104-111112126 AAAAGGGGGGAGAAGGAGGAAGG + Intergenic
1089374323 11:117983786-117983808 CAGAGAGGGGATGGGGAGGGGGG - Intergenic
1089693189 11:120199287-120199309 CACAGTGGGAAGAAGGAGTCCGG + Intergenic
1090446109 11:126766184-126766206 AAGAGAGGGGAGGAGGAGAGAGG - Intronic
1090663181 11:128895922-128895944 GACACAGGGCAGTAGGAGGGAGG + Intronic
1091364307 11:135004976-135004998 AGCAGAGGGGAGAAGGAGGAAGG - Intergenic
1202811629 11_KI270721v1_random:29558-29580 CGGAGACGGGAGGAGGAGGGTGG + Intergenic
1091416851 12:295372-295394 GAAAGAGGGAGGAAGGAGGGAGG + Intronic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1091562147 12:1622998-1623020 CACAGCGGGGAGAAACAGGATGG + Intronic
1091713450 12:2759610-2759632 GCCAGAGGGGAGAAGGGGTGTGG - Intergenic
1091723582 12:2830608-2830630 CCCTGATGGGAGAGGGAGGGAGG - Intronic
1091916315 12:4273616-4273638 ACGAGAGGGGAAAAGGAGGGAGG + Intergenic
1092009656 12:5098856-5098878 CACATAGAGGAGTAGAAGGGAGG + Intergenic
1092161872 12:6319503-6319525 CGCAGAGGGGAGGAGGAGAGAGG + Intronic
1092281475 12:7101118-7101140 GAGGGAGGGAAGAAGGAGGGAGG - Intronic
1092861527 12:12724101-12724123 CGCAGAGGAGAGGAGGAGGGAGG - Intergenic
1092968249 12:13666354-13666376 CACAGAAGAGAGAGGGAGGGTGG + Intronic
1094042810 12:26135183-26135205 CTCAGAGGCCAGAAGTAGGGAGG + Intronic
1094634460 12:32211831-32211853 CACTGTGGGGAGAGGGAGAGAGG + Intronic
1094670999 12:32569229-32569251 AAAACAGGGGAGAAGCAGGGTGG - Intronic
1095389637 12:41690060-41690082 CTCAGAGGGGTGAAGATGGGCGG + Intergenic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1095958233 12:47818808-47818830 GCCAGCGGGGAGAAGGAGTGAGG + Intronic
1096267449 12:50135095-50135117 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1096313783 12:50545387-50545409 AACGGAGGGGAGGGGGAGGGAGG - Intronic
1096455020 12:51777705-51777727 CACAGTGTGGAGAATGAAGGAGG - Intronic
1096586845 12:52628392-52628414 CACAAAAGGGAGGAGGAGAGAGG - Intergenic
1096693016 12:53332828-53332850 GTCAGGGGGGAGAAGAAGGGAGG - Intronic
1096977895 12:55709923-55709945 AATAGAGGGGCAAAGGAGGGAGG + Intronic
1096992787 12:55818525-55818547 CACGGAGGTGAGAGAGAGGGTGG + Intronic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1097035280 12:56119763-56119785 CACATAGGGGAGTAGGAAGGGGG + Intronic
1097103226 12:56604167-56604189 CAGAGAGGAGAGAAGTGGGGCGG - Intronic
1097858796 12:64496593-64496615 CCATGATGGGAGAAGGAGGGGGG + Intronic
1098216392 12:68224691-68224713 GAGAAAGGGGAGAGGGAGGGAGG + Intronic
1098387683 12:69935984-69936006 CACAGATGGGAGCAGGGGGGAGG - Intronic
1098921319 12:76304730-76304752 CAAAGAGTGGAAATGGAGGGCGG - Intergenic
1099010398 12:77284761-77284783 CTCAGAGAGGAAAAGGAGGCAGG + Intergenic
1099494968 12:83335611-83335633 CACAGAGGAGAGCTGGAGAGGGG + Intergenic
1100178045 12:92053002-92053024 TACAGACGTGAGAAAGAGGGAGG - Intronic
1100436068 12:94572673-94572695 GACAAAGCAGAGAAGGAGGGAGG + Intronic
1100761613 12:97813382-97813404 CACAGTAGGGAAAAAGAGGGAGG + Intergenic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101375560 12:104168406-104168428 CACAGATGGGAGCAGGATGGGGG - Intergenic
1101861920 12:108489434-108489456 GATAGAGGAGAGAAGGAGAGGGG + Intergenic
1102199570 12:111048045-111048067 TAGAGAGGGGAGAAGAGGGGAGG + Intronic
1102208701 12:111108658-111108680 CAGAGAGGGGAGATGGGGTGGGG - Intronic
1102219660 12:111186060-111186082 AACAGAGGGCAGGAGGAGGAAGG - Intronic
1102232891 12:111275761-111275783 CTCAGAGGGGAGCAGAAAGGTGG - Intronic
1102425083 12:112837867-112837889 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1102529152 12:113533250-113533272 CACAGCCGGGAGATGGAGGAAGG - Intergenic
1102549611 12:113682318-113682340 TACAAAGGGGATAATGAGGGGGG - Intergenic
1102556037 12:113727264-113727286 AAGAGAGGGGGGAGGGAGGGAGG - Intergenic
1102565496 12:113794811-113794833 CACAGTGGGGAGGGGGGGGGTGG - Intergenic
1102721921 12:115023848-115023870 TGCAGTGGGGAAAAGGAGGGAGG + Intergenic
1102976029 12:117207783-117207805 AAAAGAGGGGAAGAGGAGGGAGG - Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103164306 12:118757105-118757127 AAGAAAGGGGAGAAGGAAGGAGG + Intergenic
1103239070 12:119398122-119398144 GGCAGAGGGGAGGAGGAAGGCGG + Intronic
1103360668 12:120351579-120351601 CACAGAGGAGAGACAGAGAGAGG + Intronic
1103917594 12:124384031-124384053 CAGAGAGGGGAGGCGGGGGGAGG + Intronic
1103917814 12:124385021-124385043 CAAAGAGGGAGAAAGGAGGGAGG + Intronic
1103931956 12:124455496-124455518 CTCAGAAGGCAGAAGCAGGGAGG - Intronic
1103946747 12:124531475-124531497 GCCTGTGGGGAGAAGGAGGGAGG + Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104034250 12:125087539-125087561 CATGGAGGGGAAAGGGAGGGAGG - Intronic
1104098509 12:125583785-125583807 CACAGGGGCGAGCAGGAGAGGGG - Intronic
1104191107 12:126482514-126482536 GAGGGAGGGGGGAAGGAGGGAGG - Intergenic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104357890 12:128104414-128104436 CCCAGATGGGAGAAGGTTGGTGG - Intergenic
1104438451 12:128775612-128775634 GACAGAGGGGGGAAGGGAGGAGG + Intergenic
1105014184 12:132776194-132776216 CACAGGCGGGAGCAGCAGGGAGG - Intronic
1105014249 12:132776509-132776531 CACAGGCGGGAGCAGCAGGGAGG - Intronic
1105014266 12:132776588-132776610 CACAGGCGGGAGCAGCAGGGAGG - Intronic
1105308269 13:19184078-19184100 CACAAAGAGGAGGAGCAGGGAGG + Intronic
1105760811 13:23512655-23512677 CACAGAGGAAAGGCGGAGGGCGG - Intergenic
1106440370 13:29761543-29761565 ACCAGAGGGTAGAAGGTGGGAGG + Intergenic
1106503294 13:30349532-30349554 CACACAGGCGAGAAGGTGTGAGG + Intergenic
1106558067 13:30827238-30827260 CACACAGGGGAGAGGCCGGGAGG - Intergenic
1107037050 13:35912595-35912617 CAGAGAGGGGAGCTGGAGAGGGG - Intronic
1107615129 13:42158952-42158974 CACATAGGAGAGAGGGAGAGAGG - Intronic
1107645654 13:42492009-42492031 CATAGGGAGGAGAAGGACGGAGG + Intergenic
1107675441 13:42791813-42791835 CAGAGAGGAGAGAGGGATGGGGG - Intergenic
1107764377 13:43718372-43718394 ACCAGATGGGAGAGGGAGGGAGG + Intronic
1107911121 13:45106645-45106667 CAAAGAGGGGAGCCGGAGAGGGG + Intergenic
1108014436 13:46059655-46059677 CACAGAGATGAGAAGGGGAGAGG + Intronic
1108575429 13:51786368-51786390 GACAGATGGGAGAGGGAGGGCGG - Intronic
1108822424 13:54369597-54369619 CTCAGAAGGGAGAGGGAGTGAGG - Intergenic
1108953490 13:56120075-56120097 CACAGTGGGTAGTAGGAAGGTGG - Intergenic
1110047303 13:70846248-70846270 AACAGGGGGAAGCAGGAGGGAGG - Intergenic
1110084081 13:71355269-71355291 TACATAGGGGAGAAGGAGCAAGG + Intergenic
1110119849 13:71866847-71866869 AAAAGGGGGGAGAAGGAGCGAGG + Intronic
1110408859 13:75182416-75182438 GACAGACAGGAGAAGGAGTGGGG - Intergenic
1110471611 13:75866359-75866381 CACCGATGGGGGAAGGAGAGAGG - Intergenic
1110545179 13:76747940-76747962 GTTAGAGGGGAGAGGGAGGGAGG + Intergenic
1110565206 13:76950881-76950903 GACAGAGGTGAGAAGGAGAATGG - Intronic
1110695093 13:78478625-78478647 AGAAGAGGGGAGAAGAAGGGTGG + Intergenic
1111234839 13:85396500-85396522 ACCAGAGGGCAGAAGGTGGGAGG - Intergenic
1111255143 13:85657958-85657980 GAGGGAGGGGGGAAGGAGGGAGG + Intergenic
1111446195 13:88348125-88348147 GAAGGAGGGAAGAAGGAGGGAGG + Intergenic
1111726253 13:92013283-92013305 CAGAGAGGGGAGCTGGAGAGGGG + Intronic
1112048206 13:95618204-95618226 TACAGAAGGGAGTAGGAGTGAGG - Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112390183 13:98976147-98976169 CAGAGAGGGGTGAGGGAGTGAGG - Intronic
1112806406 13:103167795-103167817 CACAGCAGGGAGGAGAAGGGCGG + Intergenic
1113149985 13:107252477-107252499 GAGAGAGAGGAGAAGGAAGGAGG + Intronic
1113179787 13:107612087-107612109 GAGAGAGGGGAGGGGGAGGGAGG + Intronic
1113618007 13:111694745-111694767 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618018 13:111694804-111694826 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623540 13:111780006-111780028 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623551 13:111780065-111780087 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113674039 13:112196059-112196081 GAATGAGGGGAGAGGGAGGGAGG - Intergenic
1113940769 13:114017616-114017638 CGCAGAGGGGAGAGGGCGGGAGG - Intronic
1113958847 13:114114394-114114416 CGCAGAGGGGTGAAGGAACGGGG + Intronic
1113990510 14:16024197-16024219 CACGGGTGGGCGAAGGAGGGTGG + Intergenic
1114045449 14:18871643-18871665 AAGAGAGGAGGGAAGGAGGGAGG + Intergenic
1114118763 14:19647825-19647847 AAGAGAGGAGGGAAGGAGGGAGG - Intergenic
1114464362 14:22910504-22910526 AAAGGAAGGGAGAAGGAGGGAGG + Intronic
1114535181 14:23418054-23418076 CCCTGAGAGGAGAAGGAGGTGGG + Intronic
1114646604 14:24259622-24259644 CAGAAAGGGCAGGAGGAGGGTGG + Intronic
1114761919 14:25325430-25325452 CCCAGAGGGAGTAAGGAGGGAGG + Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1115211009 14:30967211-30967233 CACAGAGGGGAAAGAGAGGGTGG + Intronic
1115724139 14:36194642-36194664 TACAGAGGGGAGAGGGGGAGGGG + Intergenic
1116021854 14:39470868-39470890 GACAGAGGGCAGAAGGTGAGAGG + Intergenic
1116047296 14:39760309-39760331 CAAAGAGGAGAGAAGAAAGGAGG + Intergenic
1116085010 14:40224409-40224431 CAAAAAGGGGTGAAGGAGGAAGG + Intergenic
1116133321 14:40889248-40889270 AAGGGAGGGAAGAAGGAGGGAGG + Intergenic
1116380486 14:44261823-44261845 CAGAGAGGGGACAAAGAGGGTGG + Intergenic
1117006830 14:51428974-51428996 GACAGAGGGGAGAGAGAGGGTGG + Intergenic
1117006837 14:51428999-51429021 GAGAGAGGGGAGAGAGAGGGTGG + Intergenic
1117113293 14:52481647-52481669 GACATAGGGGAAAATGAGGGAGG - Intronic
1117151082 14:52888977-52888999 GACAGAAGGGAGAAGGAGACGGG + Intronic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117928572 14:60812811-60812833 CAGAGAGGGGAGCTGGAGAGGGG - Intronic
1118384284 14:65242786-65242808 CTTAGAGGGCAGGAGGAGGGAGG + Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118710732 14:68517266-68517288 CAGAGAGGGGAGAGGAGGGGAGG + Intronic
1119180213 14:72600325-72600347 CAGAGAGGAGGGAGGGAGGGAGG - Intergenic
1119463168 14:74829131-74829153 CACACAGGGGAAAAGAAGGCTGG - Intronic
1119641255 14:76316692-76316714 CAGAGAGGAGAGAAGGATAGGGG - Intronic
1119665889 14:76484697-76484719 CACAGATGGGAGATGGAGCTGGG - Intronic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1119918602 14:78425750-78425772 CGAAGAGGGGTGAAGGAGGTAGG - Intronic
1119920010 14:78438050-78438072 GACAGAGTGGACAGGGAGGGAGG + Intronic
1120167973 14:81220678-81220700 CGGAGAGAGGAGGAGGAGGGGGG + Exonic
1120716201 14:87843514-87843536 ACTTGAGGGGAGAAGGAGGGAGG - Intronic
1121333076 14:93060051-93060073 ACCAGAGGGCAGGAGGAGGGGGG + Intronic
1121343101 14:93116355-93116377 CACTGAGGGGGGAAGGGGCGGGG + Intergenic
1121592351 14:95125656-95125678 CAGAGATGGGGGGAGGAGGGAGG + Intronic
1121767779 14:96502499-96502521 CACTGAGGCGGGAGGGAGGGGGG - Exonic
1121832731 14:97066003-97066025 CAGGGAGGGAGGAAGGAGGGAGG - Intergenic
1121840286 14:97128451-97128473 CAGGGAGGGGAGGGGGAGGGGGG + Intergenic
1122366679 14:101198581-101198603 CACAGAGGAGCGGAGGAAGGAGG - Intergenic
1122448095 14:101782754-101782776 GAGAGAGGGGAGAGAGAGGGAGG - Intronic
1122631387 14:103109217-103109239 GACAGGGTGGAGAGGGAGGGAGG - Intronic
1122631401 14:103109254-103109276 GACAGGGTGGAGAGGGAGGGAGG - Intronic
1122631499 14:103109507-103109529 GACAGGGTGGAGAGGGAGGGAGG - Intronic
1122631570 14:103109689-103109711 GACAGGGTGGAGAGGGAGGGAGG - Intronic
1122719457 14:103714167-103714189 CTCAGAGGGGAGGAGAGGGGAGG - Intronic
1122789943 14:104179915-104179937 CTCAGAGAGGAGACGGAGTGTGG + Intronic
1122931185 14:104933661-104933683 GACTGAGGGGACAGGGAGGGCGG + Exonic
1123057908 14:105580706-105580728 CAGAGATGGGAGAAAAAGGGAGG - Intergenic
1202926207 14_KI270724v1_random:28397-28419 GACCCAGCGGAGAAGGAGGGCGG - Intergenic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1124359524 15:29025599-29025621 CATACAGGGGAGACGGATGGTGG + Intronic
1124642409 15:31404104-31404126 AGCAGAGGTGAGAAGGAGAGTGG + Intronic
1125117041 15:36106634-36106656 CAAAGAGGAGAGAAAGAGGTAGG + Intergenic
1125126385 15:36227060-36227082 ACCAGAGGGCAGAGGGAGGGAGG + Intergenic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1125475533 15:40045773-40045795 CAAAGAGGTGACAAGAAGGGAGG + Intergenic
1125501960 15:40245498-40245520 CACAGAGGGTGGAGGGAGCGAGG + Intronic
1125588738 15:40841162-40841184 ACCAGAAGAGAGAAGGAGGGAGG - Intergenic
1125679072 15:41519620-41519642 GACAAAGGGCAGAAGGAGGGAGG - Intronic
1125839769 15:42789213-42789235 CACAGGGGGTTCAAGGAGGGAGG - Intronic
1126437734 15:48653241-48653263 CACAGAGGAGAGAGGTGGGGTGG + Intergenic
1127808902 15:62546134-62546156 CACAGTGTGGAGAGGGAGGTCGG + Intronic
1128372495 15:67050540-67050562 CACAGAGGGGAAGGGGAGCGGGG + Intergenic
1128607145 15:69045493-69045515 GAAAGAAGGGAGAGGGAGGGAGG - Intronic
1128755217 15:70179061-70179083 AACTGAGTGGAGAAGGAGTGTGG + Intergenic
1129039172 15:72670881-72670903 TGCAGACAGGAGAAGGAGGGAGG - Intergenic
1129111040 15:73337291-73337313 CACAGAAGTGAGAAGTAGAGAGG - Intronic
1129317261 15:74752471-74752493 CACAGAGGGCACTGGGAGGGAGG - Intronic
1129447548 15:75629415-75629437 CCCAGAGGGGAAATGGAGGGAGG + Intergenic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129469111 15:75740516-75740538 CACAGAGAGGAAAAGGGGAGAGG + Intergenic
1129597348 15:76975155-76975177 CCCAGAGGGATGCAGGAGGGTGG - Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129814679 15:78540967-78540989 CACAGAGCAGAGAAGCAGGGAGG - Intronic
1129999843 15:80036864-80036886 TAAATAGGGGAGAAGGAGGCAGG - Intergenic
1130045408 15:80440466-80440488 CACAGGGTGGAGAAGGAAGCTGG + Intronic
1130268071 15:82427402-82427424 AAAAAAGGGAAGAAGGAGGGAGG - Intergenic
1130390106 15:83447588-83447610 CGCAGAGGAGGGAAGGAGGGAGG + Intronic
1130503953 15:84519436-84519458 AAAAAAGGGAAGAAGGAGGGAGG + Intergenic
1130579567 15:85123940-85123962 CACAGAATGGAGAAGAAGGGAGG - Intronic
1130636495 15:85625909-85625931 GAAATAGGGCAGAAGGAGGGGGG + Intronic
1130909167 15:88259137-88259159 ACCAGAGGGTAGAAGGTGGGAGG + Intergenic
1131067032 15:89441256-89441278 CTCAGAGGGGAGTGAGAGGGTGG + Intergenic
1131246630 15:90799881-90799903 GAGGAAGGGGAGAAGGAGGGGGG + Intronic
1131260581 15:90885381-90885403 CACAGATGGGGGAGGCAGGGAGG - Intronic
1131312615 15:91304601-91304623 CGGAGAGGAGAGAAGGAGAGAGG + Intergenic
1131539057 15:93260856-93260878 AATAAAGGGGAGAAGAAGGGAGG - Intergenic
1131668581 15:94595984-94596006 CATACATGGAAGAAGGAGGGGGG - Intergenic
1132307359 15:100826033-100826055 CAGGGAGGGGAGAAGAAGGTGGG - Intergenic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133293560 16:4738384-4738406 TACAGTGGGGAGTGGGAGGGAGG + Intronic
1133383887 16:5353422-5353444 CACAGAGGGGCGGAGGAAGAGGG - Intergenic
1133655943 16:7864017-7864039 GACAGGGGAGAGAAGAAGGGAGG - Intergenic
1133758648 16:8781031-8781053 CTCAAAGGAGAGAGGGAGGGAGG + Intronic
1133760261 16:8792950-8792972 CACAGAGGTGCGGATGAGGGAGG + Intronic
1134016336 16:10891146-10891168 CACAGATGGGGGATGGTGGGAGG - Intronic
1134290256 16:12899033-12899055 CACAGAGTGGAGGAAGAGGCCGG + Intergenic
1134322552 16:13176839-13176861 CAGAGAGGGGAGAAGAGGTGTGG - Intronic
1134619385 16:15676116-15676138 GACAGAGGAGAGAGGAAGGGAGG - Intronic
1134716978 16:16362210-16362232 CACAGAGGAGAGGAGGTGGCCGG - Intergenic
1134901998 16:17946707-17946729 CAGAGAGGAGAATAGGAGGGTGG + Intergenic
1134957773 16:18389949-18389971 CACAGAGGAGAGGAGGTGGCCGG + Intergenic
1135251332 16:20902672-20902694 GACAGCTGGGAGAGGGAGGGAGG - Exonic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135926818 16:26702073-26702095 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1136077766 16:27828662-27828684 GACAGAGGGGTTATGGAGGGGGG - Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136285545 16:29238386-29238408 GAGAGAGGGAAGAAGGAAGGAGG + Intergenic
1136401558 16:30021897-30021919 CACAGAGGGGAAAAGTAGTGTGG - Intronic
1136618134 16:31410895-31410917 GCCAGAGGGGAGGATGAGGGTGG + Intronic
1136626243 16:31463962-31463984 GCCAGGGGAGAGAAGGAGGGCGG - Intronic
1136870190 16:33799974-33799996 CACAGAGAGTAGAATGAGGCTGG + Intergenic
1136922764 16:34345708-34345730 GAATGAGGGGAGAAGGAGGAAGG + Intergenic
1136981809 16:35066098-35066120 GAATGAGGGGAGAAGGAGGAAGG - Intergenic
1137488893 16:48914250-48914272 CACAGGGAGGAGAGGAAGGGAGG - Intergenic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1137697800 16:50473879-50473901 GACAGAGGTTAGGAGGAGGGCGG + Intergenic
1137780391 16:51093414-51093436 CACAGAGGGGTGTAGGATGAGGG + Intergenic
1137977261 16:53042299-53042321 AGGAGAGGGGAGACGGAGGGAGG - Intergenic
1138058188 16:53858542-53858564 AAAAAAGGGGAGAAGGAGAGGGG - Intronic
1138130618 16:54476598-54476620 AAGAGAGGGGAGACAGAGGGAGG + Intergenic
1138637424 16:58352195-58352217 TGCAGAGTGGAGAAGGAGGTTGG - Intronic
1139144480 16:64307540-64307562 GGCAGAGGGGAAAAGGAGAGAGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139583082 16:67884745-67884767 CCCAGATGGGAAAAGGAGCGAGG - Intergenic
1139684632 16:68593408-68593430 CAGAGAGGGCAGAAGGCTGGCGG + Intergenic
1139956658 16:70696600-70696622 CACACTGGGGAGAAGCAGGCTGG - Intronic
1139964827 16:70739491-70739513 GCCAGAGGGGAGGAGGAGAGGGG - Intronic
1140021356 16:71241968-71241990 CACAGAGGAAAGAAGGGGTGAGG + Intergenic
1140040586 16:71404953-71404975 CACAGCCGGGAGAACAAGGGAGG + Intergenic
1140257513 16:73349751-73349773 AAAAGAGGGAGGAAGGAGGGAGG - Intergenic
1140790997 16:78391116-78391138 CACAGAAGGCAGACGGCGGGTGG - Intronic
1140809096 16:78559848-78559870 GATAGAGGGGGGAAGGAGGGTGG - Intronic
1140814014 16:78604673-78604695 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814022 16:78604688-78604710 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814030 16:78604703-78604725 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814038 16:78604718-78604740 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814046 16:78604733-78604755 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814054 16:78604748-78604770 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814062 16:78604763-78604785 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814070 16:78604778-78604800 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814092 16:78604828-78604850 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1141493911 16:84393689-84393711 CAAAGAGGGGAGGAGGATAGAGG + Intronic
1141494118 16:84395171-84395193 CACAGAGGGAAGTCGGAGGCTGG + Intronic
1141513138 16:84525386-84525408 GACAGAGCGGAGGGGGAGGGAGG - Intronic
1141523883 16:84598945-84598967 CACAAAGGGGCTAGGGAGGGGGG + Intronic
1141624406 16:85253701-85253723 TAGCCAGGGGAGAAGGAGGGTGG + Intergenic
1142008506 16:87701775-87701797 CACAGACGGGAGAAGGATGGCGG - Intronic
1142027863 16:87824129-87824151 CACAGAGGGGAGACAGTGGATGG - Intergenic
1142071315 16:88092455-88092477 ATCAGAGGGAAGAGGGAGGGAGG + Intronic
1142090874 16:88208528-88208550 GAGAGAGGGAAGAAGGAAGGAGG + Intergenic
1142104946 16:88297665-88297687 CACAGAGAGGAGAGGGTGCGTGG - Intergenic
1142127713 16:88418432-88418454 CACAGAGGGGCAGAGGAGAGGGG + Intergenic
1142198218 16:88748537-88748559 CACAGCGGGCAGCGGGAGGGCGG + Intronic
1203101981 16_KI270728v1_random:1316080-1316102 CACAGAGAGTAGAATGAGGCTGG - Intergenic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1142978114 17:3657095-3657117 CACAGAAGGGAGGAGGGAGGAGG + Intronic
1143124670 17:4634033-4634055 GACAGAGGGTGGAAGGAGTGAGG + Intronic
1143410828 17:6707382-6707404 CACACAGCTGGGAAGGAGGGAGG - Intronic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143542949 17:7580380-7580402 CTCAGAGGGAAGAAGGAAGAGGG + Intronic
1143544601 17:7588842-7588864 CACACAGGCCAGAAGCAGGGGGG + Intronic
1143823187 17:9581536-9581558 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1144031815 17:11329911-11329933 GACAGGAGGGAGAGGGAGGGAGG - Intronic
1144384930 17:14740666-14740688 CACAGAGGTGTGATGGAGGCTGG - Intergenic
1144787929 17:17842157-17842179 CACCCAGGGGAGAAGGGGAGTGG - Intergenic
1144879754 17:18425247-18425269 ACCAGAGGGGAGGAGGAGGAAGG + Intergenic
1145067749 17:19773640-19773662 CAGAGAGGCGAGCTGGAGGGAGG + Intronic
1145152480 17:20519137-20519159 ACCAGAGGGGAGGAGGAGGAAGG - Intergenic
1145214612 17:21042518-21042540 AAGAGAGGGCAGAAGGAGAGAGG + Intronic
1145961114 17:28887005-28887027 GAAATAGGGGAGAGGGAGGGAGG + Intronic
1146689726 17:34865128-34865150 CGCAGAGGGAGGATGGAGGGTGG - Intergenic
1146906842 17:36623531-36623553 GAGAGAGGGTAGAAGGAAGGAGG - Intergenic
1146950283 17:36900602-36900624 CTCAGAGGGGAGGAAGAGGAAGG + Intergenic
1146954738 17:36930957-36930979 CCCAGAGAGAAAAAGGAGGGAGG - Intergenic
1147050145 17:37788243-37788265 CCAAAAGGGGAGAGGGAGGGAGG - Intergenic
1147167651 17:38602004-38602026 CACAGAGGAGAGATGGGGGAGGG + Intronic
1147241948 17:39096233-39096255 CCCACGGGGGAGAAGTAGGGGGG + Intronic
1147338716 17:39741446-39741468 TGCAGAGGGGAGAAGGAGGTGGG - Intronic
1147559283 17:41499124-41499146 CACACAGGGGAGCAGCAGAGGGG + Intergenic
1147723079 17:42550515-42550537 CACAGAGGGGCAAAGGGGGTTGG - Exonic
1147724291 17:42556741-42556763 CACAGAGGGGCAAAGGGGGTTGG - Intergenic
1148016760 17:44527476-44527498 CAGAGAGGGGGGGAGGAGGGAGG + Intergenic
1148018787 17:44540167-44540189 TTGAGAGTGGAGAAGGAGGGGGG - Intergenic
1148533128 17:48414442-48414464 CACAGAGGTCAGGAGAAGGGTGG + Intronic
1148551406 17:48552575-48552597 CAGAGAGGGGAGGTGGGGGGGGG - Exonic
1148681152 17:49474208-49474230 CGCAGTGGGGAGAAGGGGAGGGG - Intronic
1148716611 17:49720292-49720314 AACAGAGGGGAGAGGGCTGGGGG + Intronic
1148756213 17:49974266-49974288 GAGAGAGGGAAGAAGGAGTGGGG - Exonic
1148966119 17:51437610-51437632 CACAGAGGCGAGCAGGGGAGTGG - Intergenic
1149515207 17:57275923-57275945 CACAGAGAACTGAAGGAGGGAGG - Intronic
1150004926 17:61463559-61463581 CCCAGCAGGGAGAAGGAGAGGGG + Intronic
1150168670 17:62967973-62967995 TACAGAGGGGAGCAAGAGAGAGG - Intergenic
1151126895 17:71855118-71855140 CAGAGAGGGAGGAAGGAGAGAGG - Intergenic
1151208536 17:72526470-72526492 TACCTAGGGGAGAAGGCGGGAGG + Intergenic
1151219675 17:72603213-72603235 CACAGGGGGTAGTAGGAGTGGGG - Intergenic
1151232646 17:72695740-72695762 CACAGAGGAGAGGAGGAGGAAGG + Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151491489 17:74434266-74434288 CTCAGAGGGTTCAAGGAGGGGGG - Intronic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151698095 17:75728276-75728298 CTCAGAAGGGAGGAAGAGGGAGG - Intronic
1151766347 17:76135295-76135317 GACAGTGGGGAAAAGGAGAGGGG + Intergenic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1151982400 17:77521125-77521147 CGCAGAGAGGGGACGGAGGGTGG - Intergenic
1152104150 17:78319076-78319098 CACAGAAGAGAGGTGGAGGGAGG + Intergenic
1152322456 17:79615587-79615609 CACAGAGGGGAGCAGGGGCCAGG - Intergenic
1152340458 17:79721335-79721357 GACAGAGGGAGAAAGGAGGGAGG + Intergenic
1152472836 17:80499931-80499953 CAAAGAGGCCAGAGGGAGGGGGG + Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152598424 17:81249416-81249438 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152598447 17:81249488-81249510 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152621444 17:81366884-81366906 CCCAGAGCGGAGAAGGCGCGTGG - Intergenic
1152859102 17:82685263-82685285 GCCAGAAGGGAAAAGGAGGGTGG + Intronic
1152908212 17:82981977-82981999 CACGGAGGTGAGAAGGTTGGAGG - Intronic
1152908225 17:82982025-82982047 CACGGAGGTGAGAAAGATGGAGG - Intronic
1152908237 17:82982073-82982095 CATGGAGGTGAGAAGGATGGAGG - Intronic
1152908250 17:82982121-82982143 CACAGAGGTGAGAAGGATGGAGG - Intronic
1152908262 17:82982169-82982191 CACAGAGGTGAGAAGGATGGAGG - Intronic
1153170823 18:2313996-2314018 CATTGAGAGGTGAAGGAGGGAGG + Intergenic
1153354504 18:4120791-4120813 GAAAGAGGAGAGAAGGAGGGAGG - Intronic
1153482093 18:5556994-5557016 CACAGAGGTGAGAGGAAGGAGGG - Intronic
1153870626 18:9316170-9316192 GAGGGAGGGGGGAAGGAGGGAGG + Intergenic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1154014261 18:10602845-10602867 CACAGAGAGGAGAGAGAGAGAGG - Intergenic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155286365 18:24293248-24293270 CACAGAGGGGGAAAGGGGAGAGG + Intronic
1155760115 18:29554640-29554662 CACAGAGGGAAAACGGAGAGAGG - Intergenic
1155907410 18:31468508-31468530 AACAGAGAGGACAAGGAGGCAGG + Intronic
1156179348 18:34584801-34584823 TTCAGAGAGAAGAAGGAGGGAGG + Intronic
1156254220 18:35379520-35379542 CACAGAGGGGACGAGAATGGAGG + Intergenic
1156279188 18:35617105-35617127 CACAGACAGGAAATGGAGGGGGG - Intronic
1156474067 18:37394691-37394713 CACACGGGTGAGAAGGTGGGAGG + Intronic
1156501958 18:37565865-37565887 GAGAGAGAGGAGAGGGAGGGAGG - Exonic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156553602 18:38043445-38043467 CTCAAAGGGGAGAGGGAGGGAGG + Intergenic
1156644798 18:39148079-39148101 CTCTGAGGGGAGAATGAGGTAGG - Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157138530 18:45082533-45082555 CACAGAAGGAAGAAGGAGAGGGG + Intergenic
1157294115 18:46430000-46430022 TCCACAGGGGAGCAGGAGGGCGG - Intronic
1157481847 18:48060234-48060256 AGCAGAGGGGAGAAGGAGGAGGG + Intronic
1157768991 18:50327812-50327834 CACAGACCGGGGAAGGCGGGAGG + Intergenic
1158337970 18:56434262-56434284 AACAGAGGGGTGAAGAAGGTGGG - Intergenic
1158493143 18:57928535-57928557 GAGAGAGGGGAGATGGAGAGAGG - Intergenic
1158493147 18:57928550-57928572 AAGAGAGGGGAGATGGAGAGAGG - Intergenic
1158535942 18:58308583-58308605 CACAGAGAGGAGAATAAAGGCGG + Intronic
1158678718 18:59547129-59547151 GAGAGAGGGGAGAGAGAGGGAGG + Intronic
1159057629 18:63481885-63481907 CCCTGAGGGGAGAAGGAGTAAGG + Intronic
1159217015 18:65405625-65405647 ACTAGAGGGGAGAAGGAGGTAGG + Intergenic
1159773202 18:72573440-72573462 GGCTTAGGGGAGAAGGAGGGAGG - Intronic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160566785 18:79790906-79790928 GAGAGAGGAGAGAGGGAGGGAGG - Intergenic
1160573245 18:79832587-79832609 AAAAGAGTGGAGAAGAAGGGAGG - Intergenic
1160661897 19:305183-305205 CACAGAGGGCAGAGGTTGGGCGG - Intergenic
1160673428 19:376959-376981 CACAGGGGGGAGAGGCTGGGTGG - Intergenic
1160673470 19:377063-377085 CACAGGGGGGAGAGGCTGGGTGG - Intergenic
1160673481 19:377088-377110 CACAGGGGGGAGAGGCTGGGTGG - Intergenic
1160673523 19:377192-377214 CACAGGGGGGAGAGGCTGGGTGG - Intergenic
1160673578 19:377323-377345 CACAGGGGGGAGAGGCTGGGTGG - Intergenic
1160673609 19:377400-377422 CACAGGGGGGAGAGGCTGGGTGG - Intergenic
1160970696 19:1766554-1766576 CAGAGAGGGGAGAGGGAGGGAGG + Intronic
1161035154 19:2080269-2080291 CAGAGAGGGGAGAGGGAGTGAGG + Intronic
1161095468 19:2387897-2387919 CACAGAGGGGCAGGGGAGGGAGG + Intergenic
1161322355 19:3647091-3647113 CACAGAGGGAGGAGGGATGGGGG + Intronic
1161806032 19:6443522-6443544 TATAAAGGGGAGAAGGAGGCCGG - Intronic
1162029719 19:7912107-7912129 GACAGATGTGAGAACGAGGGAGG - Intronic
1162071003 19:8151963-8151985 AAGAGAGGGGAGAAGGAAGCCGG + Intronic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162175015 19:8823968-8823990 CACAGAGGGGACAGGGGAGGAGG - Intronic
1162402423 19:10454186-10454208 CACCCAGGGGAGGGGGAGGGGGG - Intronic
1162439997 19:10686947-10686969 CACAGCAGGGAGGAGGGGGGTGG + Intronic
1162552628 19:11366023-11366045 CACAGAGGGCACAAGGAATGGGG + Intergenic
1163093212 19:15035804-15035826 GGAAGAGAGGAGAAGGAGGGAGG + Intergenic
1163409255 19:17143400-17143422 CTCAAAGCCGAGAAGGAGGGAGG + Intronic
1163442689 19:17329629-17329651 CAGACAGGAGAGAAGGATGGAGG + Intronic
1163703582 19:18799359-18799381 CACAGAGGGGAACAAGATGGTGG - Intergenic
1163772029 19:19197070-19197092 CAAGGAGAGGAGTAGGAGGGTGG + Intronic
1163926755 19:20353250-20353272 CACAGAGGGGGGAGGGGGGAGGG - Intergenic
1163933290 19:20419688-20419710 CTTTGAGGGGACAAGGAGGGTGG + Intergenic
1164543661 19:29141417-29141439 AACCGAGGAGGGAAGGAGGGGGG - Intergenic
1164559209 19:29277083-29277105 CACAGGGGGAAGAGGGAGGGAGG + Intergenic
1164771865 19:30815923-30815945 GAAAGAGGAGAAAAGGAGGGAGG - Intergenic
1164834601 19:31349422-31349444 TGCGGAGGGAAGAAGGAGGGCGG + Exonic
1165031147 19:32998977-32998999 AACAGAGGGGAGGAGAGGGGAGG + Intronic
1165133476 19:33648186-33648208 CACAGAGGAGAGAGAGAGAGAGG - Intronic
1165395828 19:35563163-35563185 CAGAAAGGGGAGGAGGAGAGAGG - Intronic
1165498982 19:36172459-36172481 CATTGAGGGGAAAAGGTGGGTGG - Intergenic
1165671838 19:37686517-37686539 CACAGACTGGAGAAGGAGAATGG + Exonic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1165832531 19:38736628-38736650 CACAGAGGTGAGAAGGGGCAGGG - Intronic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166160230 19:40947232-40947254 GGCGGAGGGGAGAAGGAAGGAGG + Intergenic
1166840321 19:45693168-45693190 GAGAGAGGGGAGATGGAGGAAGG - Intronic
1166853553 19:45771426-45771448 CGTGGAGGGGCGAAGGAGGGCGG + Intronic
1166880882 19:45929325-45929347 GACAGAGGGGAGACAGAGGTGGG + Intergenic
1167036793 19:46999602-46999624 CTCAGACAGGAGCAGGAGGGAGG - Intronic
1167089187 19:47331796-47331818 CTCAGAGCCGAGGAGGAGGGAGG + Intergenic
1167105434 19:47427644-47427666 GGGAGAGGGGAGTAGGAGGGTGG - Intergenic
1167191233 19:47991568-47991590 GACAGAGGGGAAAGAGAGGGAGG - Intronic
1167191294 19:47991775-47991797 GAAAGGGGGGAGAAGGGGGGAGG - Intronic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167528017 19:49997461-49997483 CAAGGAGGGGAGAGTGAGGGGGG - Intronic
1167601417 19:50457213-50457235 CACGGAGGAGAGGAGGAGGGAGG - Intronic
1167621715 19:50564444-50564466 CACAGAGGGACAAAGAAGGGAGG + Intronic
1167634970 19:50649107-50649129 GACAGAGGGGAGGAGGCAGGGGG + Intronic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167743325 19:51337569-51337591 GCCAGAGGGGAGAGGGAAGGGGG + Intronic
1167799104 19:51728796-51728818 GACAGAGGAGAAAAGGAGGGAGG + Intergenic
1168009354 19:53518138-53518160 CACAGAAGGCAGAAGAAGGTGGG + Intergenic
1168242926 19:55096247-55096269 CACAGAAGGTATAGGGAGGGAGG - Exonic
1168359312 19:55725528-55725550 CACAGAGGGGAACAGCAGGCTGG + Intronic
1168411183 19:56141360-56141382 GAGCGAGGGGGGAAGGAGGGAGG + Intronic
1168433797 19:56302287-56302309 AAAAGAGGGAAGAAGGAGAGAGG - Intronic
1168468233 19:56621101-56621123 CAGAGAGGGAGGGAGGAGGGAGG - Intronic
1168546799 19:57259249-57259271 CACAGAGAGGAGAAAGAGTAGGG - Intergenic
1202708889 1_KI270714v1_random:5635-5657 GAGGGAGGAGAGAAGGAGGGAGG - Intergenic
925017610 2:543707-543729 CACAGAGGTGGGAAAGTGGGAGG + Intergenic
925017657 2:543837-543859 CACAGAGGTGGGAAAGTGGGAGG + Intergenic
925225743 2:2182887-2182909 TGCAGGGGAGAGAAGGAGGGAGG + Intronic
925305964 2:2848657-2848679 CACAGTGGGGAGAGAGAGAGGGG - Intergenic
925310546 2:2878567-2878589 CAAAGAGGGGAGCTGGAGAGGGG + Intergenic
925718788 2:6808785-6808807 GAGAAAGGGGAGGAGGAGGGAGG + Intergenic
925923181 2:8651722-8651744 CAAAAAGAGGAGAGGGAGGGAGG + Intergenic
925943261 2:8839344-8839366 AATAGAGATGAGAAGGAGGGTGG + Intergenic
925950910 2:8910288-8910310 GAAAGAGGGGTGAAGGAGAGAGG + Intronic
926090866 2:10048378-10048400 CACAGGGGGCAGGCGGAGGGAGG - Exonic
926111277 2:10185756-10185778 CAGAGAGGGGAGGTGAAGGGTGG - Intronic
926149232 2:10415508-10415530 CACGGGGGTGAGAAGGAGAGGGG - Intronic
926226687 2:10971841-10971863 CACAGAGGGGAGGATGAGCGAGG - Intergenic
926293344 2:11548708-11548730 AACAGAGGGTAGAAGGAGAGGGG - Intronic
926306577 2:11641400-11641422 AACAGAAGAGAGAAGGAGGCAGG + Exonic
926313042 2:11688284-11688306 GACTGTGGGGAGAGGGAGGGTGG - Intronic
926355756 2:12039172-12039194 CACAGAGGAGAGGAAGAGGAGGG + Intergenic
926473020 2:13285068-13285090 CAGAGAGGGGAGGCAGAGGGTGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926781954 2:16481110-16481132 AATAGATGGGAGAATGAGGGCGG - Intergenic
927406037 2:22768313-22768335 AAAGGAGGGGGGAAGGAGGGAGG + Intergenic
927444066 2:23142270-23142292 CAAAGAGGGAAGAATGAGGCTGG - Intergenic
927904839 2:26848719-26848741 CTCGGAGGCGAGAAGGACGGAGG - Intronic
928167885 2:28983957-28983979 CACAGAGAGCAGAGGAAGGGAGG - Intronic
928405257 2:31009883-31009905 TAGAGATGGGAAAAGGAGGGTGG - Intronic
928574684 2:32642912-32642934 CACTTAGGGGAGATGGAGGCAGG - Intronic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929703366 2:44184670-44184692 AACTTAGGGGAGAAGAAGGGAGG - Intronic
929826326 2:45311567-45311589 TACAGAGGGGACAAAGAGAGGGG - Intergenic
929960690 2:46494076-46494098 CAGAGAGGGGAGGAGAAGGAGGG + Intronic
930000745 2:46859990-46860012 CCCAGAAGGAGGAAGGAGGGAGG + Intergenic
930312257 2:49755965-49755987 GAAAGAAGGGAGAGGGAGGGAGG + Intergenic
930676626 2:54208252-54208274 GACAGAGGGAAGAAGAGGGGAGG - Intronic
931463335 2:62466735-62466757 CTCAGAGGGGAGATGATGGGCGG - Intergenic
931634112 2:64326696-64326718 CACAGAGGGGTGTAGCAGTGAGG + Intergenic
931999278 2:67869163-67869185 CACAGTGTGGAGAGGGAAGGAGG - Intergenic
932302536 2:70677230-70677252 GGGAGAGGGGAGAGGGAGGGAGG + Intronic
932468631 2:71939754-71939776 AACAGAGAGGAAGAGGAGGGTGG + Intergenic
932535537 2:72589971-72589993 CAAAGAGGGGAGAATGATGAAGG + Intronic
933019647 2:77174607-77174629 TGCAGAGGGAATAAGGAGGGAGG + Intronic
933302202 2:80554569-80554591 GAAAGAGGGTAGAAAGAGGGAGG + Intronic
933624371 2:84582252-84582274 CAGAGATGAGAGAAGGAGAGAGG - Intronic
935037327 2:99391274-99391296 CTGAGAGGGAAGAAGGAGAGGGG + Intronic
935210874 2:100938582-100938604 CAGAGAGGAGGGAGGGAGGGAGG - Intronic
935302909 2:101709023-101709045 CACAGAAGGGAGAAAGGAGGGGG + Intronic
935869266 2:107427364-107427386 CAGAGATGGGATAAGGAAGGTGG - Intergenic
935934948 2:108171694-108171716 AACAGAAGGAAGAAGTAGGGAGG + Intergenic
936015852 2:108958555-108958577 TAGAGAGGGCAGAAGGACGGTGG + Intronic
936152664 2:110030177-110030199 CAGGGAGGGGAGCAGGCGGGAGG + Intergenic
936162827 2:110097707-110097729 CAAGGAGCTGAGAAGGAGGGAGG + Intronic
936192016 2:110341235-110341257 CAGGGAGGGGAGCAGGCGGGAGG - Intergenic
936432282 2:112474912-112474934 CAAAGAAGAGAGATGGAGGGAGG + Intergenic
936510515 2:113141579-113141601 CACAGAGAGAAGGAGGAGCGTGG - Intergenic
936918326 2:117662440-117662462 CACTGAGAAGAGAAGGAGAGAGG - Intergenic
936923896 2:117717290-117717312 GAAGGAGGGGAGCAGGAGGGTGG - Intergenic
937140041 2:119592128-119592150 TACAAAGAGGAGAAAGAGGGAGG + Intronic
937363352 2:121244141-121244163 CACAGAGGGTACAAGCAAGGTGG + Intronic
937685984 2:124697950-124697972 CCCAGAGGGGAGACAGAGGATGG + Intronic
937690432 2:124749339-124749361 GAGAGAGGGAAGGAGGAGGGAGG - Intronic
937871461 2:126789210-126789232 CCCAGAGGAGGGAAGGAGAGAGG - Intergenic
938108707 2:128550300-128550322 GACAGAGGGAAGGAGGAGGAAGG - Intergenic
938126831 2:128680337-128680359 AAGAGAGGGGGGAGGGAGGGAGG - Intergenic
938236500 2:129710396-129710418 GCCAGAGGGCAGAGGGAGGGAGG + Intergenic
938305164 2:130248303-130248325 CCCAGAAGGGAGAAGGGGTGTGG - Intergenic
938614430 2:132982658-132982680 CCCATAGGGGAAAGGGAGGGAGG - Intronic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939611458 2:144315680-144315702 GACAGAGGTGAGAAGTAGGAGGG - Intronic
939779871 2:146432688-146432710 GACAGAGGTGAGAAAGAGGCAGG - Intergenic
939950009 2:148458780-148458802 GACGGAGGGGACAAGGAAGGAGG + Exonic
939992182 2:148886240-148886262 CACAGAGGGCAGATGCAGGAAGG - Intronic
940072818 2:149708656-149708678 CACATAGCAGAGAAGGAGGTGGG + Intergenic
940150998 2:150600403-150600425 AACTGAGGGGAGAGGGAGGGAGG + Intergenic
940259546 2:151765802-151765824 CACAGAGTGGGGAAGGAGATGGG + Intergenic
940774233 2:157870226-157870248 TACAGAGGGGAGAACGAAGGTGG - Intronic
940966605 2:159844921-159844943 AGCACAGGGGAGAGGGAGGGAGG - Intronic
941143490 2:161814762-161814784 ACCAGAGAGGAGAGGGAGGGTGG + Intronic
942073941 2:172339623-172339645 CACAGAGGAGGGCAGGAGTGAGG + Intergenic
942492026 2:176498992-176499014 CAGAGAGGGGAGAAAGTGGAGGG - Intergenic
943035823 2:182744917-182744939 CACAGAGAAGAGAAGAGGGGGGG - Intronic
943090753 2:183372036-183372058 CAAAGAGGAGAGAAGGAAGATGG + Intergenic
943155568 2:184170516-184170538 ACTAGAGGGGAGAGGGAGGGAGG + Intergenic
943938969 2:193965381-193965403 CACAGAAGGGACTAGGTGGGAGG + Intergenic
944069699 2:195655214-195655236 CACAGGGGTGAGAAGCATGGGGG + Intronic
944367040 2:198933418-198933440 CCCAGAGGGGAGAAAGAAGAAGG + Intergenic
944797782 2:203206421-203206443 GAAAGAGGGGAGAGGGAGAGAGG - Intronic
945605658 2:211926807-211926829 CAAAGAGGGGAGAACCAGGCTGG - Intronic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946161989 2:217841067-217841089 GACAGAGGAGAGAAGGAAGAAGG + Intronic
946174492 2:217914069-217914091 AAGAGAGGAGGGAAGGAGGGAGG - Intronic
946430586 2:219625193-219625215 CTCAGAGGGGTGGAGGAGAGAGG + Intergenic
946433805 2:219639390-219639412 CACAGAGACGAGATGGTGGGGGG - Intronic
946519117 2:220446687-220446709 GAGGGAGGGGAGAAGGGGGGAGG - Intergenic
946795900 2:223352426-223352448 CTCAGAAGCGAGAGGGAGGGAGG + Intergenic
946907419 2:224430127-224430149 CAGAGAGGGGAGCTGGACGGGGG - Intergenic
947148004 2:227086283-227086305 CAGAGAGAGGAGATGTAGGGAGG + Intronic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947526855 2:230882377-230882399 TACTGAGGGGAGAGGGATGGCGG - Intergenic
947543369 2:230993624-230993646 CACAGAGGGCAGGCCGAGGGAGG - Intergenic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947833387 2:233158029-233158051 AAGAGAGAGGGGAAGGAGGGAGG + Intronic
947854277 2:233312821-233312843 CACTGAGGAGGGAAGGAGAGAGG - Intronic
948088070 2:235267229-235267251 AGCAGAGGGGAGATGCAGGGGGG - Intergenic
948091769 2:235301688-235301710 GAGAGGTGGGAGAAGGAGGGAGG - Intergenic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948653222 2:239462055-239462077 CCCAGAGTGAAGAGGGAGGGTGG - Intergenic
948800172 2:240429916-240429938 CAGGGAGGGAAGGAGGAGGGGGG - Intergenic
949030694 2:241795820-241795842 CACAGAGAGGAGAGCGAGAGGGG - Intronic
1169104970 20:2987048-2987070 GACAGATGGAAGAAAGAGGGAGG - Intronic
1170032706 20:11959354-11959376 GAAAGAGAGGGGAAGGAGGGTGG + Intergenic
1170311116 20:14993044-14993066 AAGAGAAGGGAGAAAGAGGGAGG - Intronic
1170438618 20:16355234-16355256 CACAGAGTGGGGAGGGAGGAAGG - Intronic
1170484803 20:16805533-16805555 ATAAGAGGGGAGAAGCAGGGAGG - Intergenic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1170792176 20:19517362-19517384 TCCAGAGGGGAGATGGAGGTGGG - Intronic
1170830056 20:19832398-19832420 GACAGTGGGGAGCAAGAGGGAGG - Intergenic
1170920301 20:20671939-20671961 CAAAGAGGGAAGAAGAAAGGAGG + Intronic
1170933037 20:20786037-20786059 GAGAGAGAGAAGAAGGAGGGGGG - Intergenic
1171013904 20:21523010-21523032 CTCAGAGGGGCGCAGGAGGGAGG - Intergenic
1171232650 20:23500059-23500081 CACAGAGAGGAGAGGCGGGGAGG + Intergenic
1171370886 20:24661365-24661387 AACCGAGGGAAGAGGGAGGGAGG + Intronic
1171724838 20:28606902-28606924 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1171753225 20:29076148-29076170 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1171789029 20:29501412-29501434 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1171858499 20:30373086-30373108 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1172113935 20:32562921-32562943 GAGAGAGTGGAGAAGGAGGGTGG + Intronic
1172506550 20:35467075-35467097 CAGTGTGGGGAGAAGAAGGGAGG + Intronic
1172644867 20:36462721-36462743 CACAAAGGGGGAAAGGAGGGAGG + Intronic
1172647655 20:36481281-36481303 ATCAGAGGGGAAAAGGAAGGTGG - Intronic
1172717947 20:36977738-36977760 GAAAGAGGGGAGAGGGAGAGGGG + Intergenic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1172880506 20:38196679-38196701 CACAGAGGGCACAGGGAGGAAGG - Intergenic
1172918772 20:38462622-38462644 GAAAGAGGGGAGAGGGAGAGGGG + Intergenic
1173113546 20:40218551-40218573 GAGGGAGGGGAGAAGGAAGGAGG - Intergenic
1173419591 20:42889203-42889225 AGCAGAGGGGAGAAGCAAGGTGG - Intronic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173590760 20:44222800-44222822 CAGAGAGGGAAGCAAGAGGGAGG - Intergenic
1173593968 20:44247218-44247240 CACGGAGCGGGGAGGGAGGGAGG + Intronic
1173666310 20:44765814-44765836 AACAGAGGGAAGAAGCAGGTGGG + Intronic
1173715720 20:45203083-45203105 ACTAGAGGAGAGAAGGAGGGAGG + Intergenic
1174174355 20:48635701-48635723 GACAGAGGAGGGAAGGAAGGTGG - Intronic
1174278827 20:49423544-49423566 AACAGAGGGGAGTCAGAGGGAGG + Intronic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174494510 20:50930567-50930589 CACAGGGCGGAGAAGGGGGTCGG + Intronic
1174533777 20:51235636-51235658 TACAAAGGGGACAAGGAGGCTGG + Intergenic
1174580539 20:51568382-51568404 CACAGAGAGGAGCTTGAGGGTGG - Intergenic
1174822330 20:53737455-53737477 TACAGAGGGGGGATGGAGGGAGG + Intergenic
1175117316 20:56691652-56691674 CACCGAGAGAAGCAGGAGGGAGG + Intergenic
1175120271 20:56711143-56711165 CAAGGAGGAGAGGAGGAGGGAGG - Intergenic
1175169953 20:57073226-57073248 CACCCAGGGCAGAAGGAGGTGGG + Intergenic
1175179721 20:57137133-57137155 GACAGAGTGGAGACGGAGAGTGG + Intergenic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175335461 20:58193178-58193200 GACAGGGGTGAGAAGGAGCGGGG - Intergenic
1175487312 20:59355527-59355549 AAGAGAGGGGAGAGGGAGAGAGG - Intergenic
1175487439 20:59355875-59355897 AAGAGAGGGGAGAAGGAGAGAGG - Intergenic
1176057119 20:63154777-63154799 AGGAGAGGGGAGGAGGAGGGAGG - Intergenic
1176286878 21:5023060-5023082 AGAAGAAGGGAGAAGGAGGGAGG + Intronic
1176719115 21:10379081-10379103 CAGAGAGGGGAGAGAGAGGGGGG - Intergenic
1177115069 21:17075320-17075342 GGCAGGGGGGAGAGGGAGGGTGG + Intergenic
1177222118 21:18208868-18208890 CACAGAGGGGCGGGGGTGGGGGG - Intronic
1177679189 21:24341817-24341839 CACAGATGGGGGAAGGTGGGAGG + Intergenic
1178308431 21:31509634-31509656 CACAGAGAGGAGAGAGAGGCAGG + Intronic
1178471925 21:32901527-32901549 ACTAGAGGGGAGAGGGAGGGAGG + Intergenic
1179117583 21:38508182-38508204 GACAGTGGGGAGAAGAGGGGTGG - Intronic
1179154745 21:38840184-38840206 CACAGGGTGGAGAAGGACAGAGG - Intergenic
1179167698 21:38947592-38947614 CAGAAAGGAGAGATGGAGGGAGG - Intergenic
1179353541 21:40636394-40636416 AAGAGAGGGAAGAAGGAAGGGGG + Intronic
1179568602 21:42264718-42264740 GACAGAGGAGAGAGGGAAGGAGG + Intronic
1179870303 21:44240415-44240437 AGAAGAAGGGAGAAGGAGGGAGG - Intronic
1180298396 22:10965593-10965615 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1180410021 22:12598208-12598230 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1180463980 22:15594260-15594282 AAGAGAGGAGGGAAGGAGGGAGG + Intergenic
1181260775 22:21595560-21595582 CACAGAGGAGGGCAGGTGGGAGG + Intronic
1181266076 22:21631761-21631783 AGCAAAGGGGAAAAGGAGGGAGG + Intergenic
1181570124 22:23763889-23763911 CACACATGGGAGATGGATGGAGG + Intronic
1181596321 22:23917287-23917309 CCCAGAGGGGACCAGGAGGCTGG - Intergenic
1181947482 22:26529451-26529473 CAGGGAGGGGAGAAGGCAGGTGG - Intronic
1182050668 22:27310495-27310517 GAGAGAGAAGAGAAGGAGGGAGG + Intergenic
1182715684 22:32354681-32354703 CACAGAGGGGAGTGGGTTGGGGG - Intergenic
1182899182 22:33883856-33883878 TACAGAAGGGAGAGAGAGGGAGG - Intronic
1183218631 22:36497513-36497535 CACAGAGGGGTGAGGGGCGGGGG - Intronic
1183294784 22:37023054-37023076 GATAGAGAGGAGAGGGAGGGAGG + Exonic
1183607019 22:38871952-38871974 AACAGAGGGGAGAAAAACGGGGG + Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1184639687 22:45863812-45863834 CACAGAGTGGGGAAGGATGGTGG - Intergenic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1184955567 22:47883865-47883887 CACAGTGGGCAGAAGCTGGGAGG + Intergenic
1185002497 22:48254420-48254442 CAAAGAAGGAAGAGGGAGGGAGG + Intergenic
1185023250 22:48392915-48392937 CACTGATGGGTGGAGGAGGGAGG + Intergenic
949237470 3:1826991-1827013 CACAGAGTGGGGAAGAAGCGTGG - Intergenic
949401102 3:3665959-3665981 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
949751780 3:7360119-7360141 CACAGAGGGAAAAAAAAGGGGGG - Intronic
949992494 3:9591303-9591325 GAAAGAGGGGAGAGGGAGAGGGG - Intergenic
950079333 3:10209862-10209884 AATAGCGGGGAGAGGGAGGGAGG + Intronic
950107074 3:10395003-10395025 CACAGAGGGCAGGGGCAGGGCGG - Intronic
950193242 3:10992424-10992446 AAGAGAGGGGAGAAAGAGGGAGG + Intergenic
950464960 3:13148270-13148292 CACAGAGGGAGGGAGGAGGGAGG + Intergenic
950577517 3:13841659-13841681 CACAGAGGGGAAAAGGTGGGAGG + Intronic
950645575 3:14374659-14374681 CACCCAGGGGAGTGGGAGGGAGG + Intergenic
950751176 3:15129322-15129344 CACACAAGGAATAAGGAGGGAGG - Intergenic
950818149 3:15729261-15729283 CACAGAGGTGGGAAGGATTGTGG - Intronic
950948644 3:16976722-16976744 GAGAGTGGGGAGATGGAGGGAGG + Intronic
951033003 3:17903760-17903782 AACAAAGGAGAGAGGGAGGGAGG - Intronic
951078673 3:18425716-18425738 CGCAGAGGGGAGGAGGAGAGGGG + Intronic
951520716 3:23608844-23608866 CACAGAGGTAAGAAGGAAAGGGG + Intergenic
951938904 3:28055433-28055455 CACAGAGGGCAGAAAGTGGAAGG - Intergenic
951959478 3:28300710-28300732 GAGAGAGGGAGGAAGGAGGGAGG - Intronic
952849148 3:37713482-37713504 CACAGAGGGAGGAGGGAGGAGGG + Intronic
953481233 3:43254201-43254223 CAAAGAGGGGAGGAAAAGGGAGG - Intergenic
953526244 3:43691649-43691671 GAGGGAGGGGAGAAGGAGTGAGG + Intronic
953771562 3:45781819-45781841 TCCAGAGAAGAGAAGGAGGGTGG + Intronic
953879109 3:46682431-46682453 CACAGAAGTGGGGAGGAGGGTGG - Intronic
953903649 3:46857525-46857547 CAGAGAGGAAAGAAGGAGAGAGG + Intergenic
954240861 3:49292413-49292435 CACACATGGGAGAAGGGGGTTGG - Intronic
954593064 3:51800809-51800831 CACTGAGAGGTGAAGGAGGGAGG + Intergenic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
954865479 3:53725581-53725603 CACTGAGGGGAGAGGCAGTGAGG - Intronic
955286871 3:57650131-57650153 CTCAGTGGGGAAAGGGAGGGAGG + Intronic
955566225 3:60249715-60249737 CACACACGGGAGAAGGGGGAAGG + Intronic
955887234 3:63613474-63613496 GAGAGAAGGAAGAAGGAGGGAGG + Intronic
956122059 3:65976381-65976403 CACTGTGGGGAGACGGAGGAGGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956342433 3:68240683-68240705 CACAGAGTGGACAGGGAGGAAGG + Intronic
956347490 3:68296994-68297016 CCCATAGGAGAGAAGAAGGGTGG + Intronic
956784267 3:72629450-72629472 CACAGAGGTCAGAAGCAGGTAGG + Intergenic
956896841 3:73669496-73669518 CACTGAGGCTAGGAGGAGGGTGG - Intergenic
957761841 3:84569033-84569055 CACAGAGGGGAGGAGGAGACAGG - Intergenic
957769035 3:84663931-84663953 GATACAGGGGAGAAGGAGAGAGG + Intergenic
958630177 3:96673934-96673956 GACAGAGGAGAGAAAGAGAGAGG - Intergenic
958661127 3:97068793-97068815 CACAGACGGTAGAAAGAGAGTGG - Intronic
959206016 3:103308053-103308075 CAGAGAGGGGAAAAAAAGGGAGG - Intergenic
959904313 3:111693801-111693823 CACAAAGGGGTGAAGGAGGTGGG - Intronic
960057206 3:113284221-113284243 CACAGAGGGTTGAAGGACGTAGG - Intronic
960356181 3:116656189-116656211 TAAAGAAGGGAGAGGGAGGGAGG - Intronic
960928756 3:122822958-122822980 CACAGTGGGGAGGTGGAGGGCGG - Intronic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
961061539 3:123832942-123832964 CACAAAGGAGAGAGAGAGGGTGG + Intronic
961191729 3:124968045-124968067 CACAGATGGGGGAAGGTGAGAGG - Exonic
961283816 3:125784072-125784094 CACACAAGGAATAAGGAGGGAGG - Intergenic
961422223 3:126815508-126815530 CACAGAGGTGAGAGAGAGGGAGG - Intronic
961523548 3:127482504-127482526 CAAAGAGGGGTGAAGGACAGGGG - Intergenic
961650802 3:128415857-128415879 CACAGAGGGGAAACTGAGGCAGG + Intergenic
961737083 3:129009155-129009177 AACAGAGGAGAGAAGAAAGGTGG - Intronic
961754099 3:129116937-129116959 CACTGAGGTGGGGAGGAGGGAGG + Intronic
961806544 3:129493347-129493369 CACAGAGCTGAGGAGGAGAGAGG + Intronic
961817816 3:129560301-129560323 CACAGAGGGGAGACTGAGGCCGG + Intronic
962064003 3:131960113-131960135 GAAAGAGTGGAGAGGGAGGGAGG + Intronic
962635262 3:137324928-137324950 CACTGAGAGGAAAAGGTGGGAGG - Intergenic
962693567 3:137925794-137925816 CACAGAGCTGGGAAGGAGGAAGG + Intergenic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
962890225 3:139665350-139665372 CAAGGAGGGAAGAAGGAGGGAGG - Intronic
963358221 3:144237397-144237419 CACAGAGGTGGGAAGCTGGGAGG - Intergenic
963563719 3:146900990-146901012 CACACGTGAGAGAAGGAGGGAGG + Intergenic
963782542 3:149501339-149501361 CAGAGAGGAGAGATGAAGGGAGG - Intronic
963799167 3:149659125-149659147 CACTGAGGGGAAAGGGTGGGGGG + Intronic
964894656 3:161581149-161581171 CACAGAGAGAAGGAGGCGGGAGG - Intergenic
964968766 3:162532977-162532999 TACAGATGGGAGCAGGTGGGGGG + Intergenic
965039705 3:163490581-163490603 CAGAGAGGGGAGCTGGAGAGGGG + Intergenic
965173076 3:165293864-165293886 GAAAGAGGGGGGAGGGAGGGAGG + Intergenic
965357107 3:167689586-167689608 AACACAGGGGAGAAGAAGGGAGG + Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
965652274 3:170946938-170946960 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
965659763 3:171028991-171029013 AAAAAAGGGGAGAGGGAGGGCGG - Intergenic
965874807 3:173303419-173303441 CATAGAGAGGAGAAAGAGGGAGG + Intergenic
966006461 3:175019661-175019683 TCCAGAGGGGAAAAGGAAGGAGG - Intronic
966525225 3:180912617-180912639 ACCAGAGGGGAGGAGGGGGGAGG - Exonic
966616380 3:181917962-181917984 AAGAGAGGGGAGGAGGAGGAAGG + Intergenic
966908167 3:184542683-184542705 AACAGATGGGAGAAGGGGGGAGG + Intronic
967000351 3:185327979-185328001 GAAAGAAGGGGGAAGGAGGGAGG + Intronic
967234938 3:187374881-187374903 CCCAGAGGGCAGAGGGTGGGAGG - Intergenic
967277394 3:187789943-187789965 GAGGGAGGGGAGGAGGAGGGAGG + Intergenic
967364485 3:188670350-188670372 TACAGATGGGAGAAAGAGTGAGG + Intronic
967498868 3:190174744-190174766 GAAAGAGAGAAGAAGGAGGGAGG - Intergenic
967726447 3:192866947-192866969 CCCAGAAGGGAGAAGGAATGGGG + Intronic
967976283 3:195036289-195036311 CACCGAGGGGAGAAAGGGGTCGG + Intergenic
968016754 3:195341986-195342008 CAGAAAGGGGGGAAGGTGGGAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968126762 3:196165793-196165815 CCCAGAGGAGTGAAGGTGGGAGG + Intergenic
968482042 4:837578-837600 CACAGAGGAGAGATTCAGGGTGG - Intergenic
968508367 4:982883-982905 TATACAGGGGAGACGGAGGGGGG - Intronic
968570489 4:1338009-1338031 CAAAGAGGGGACAAGGGAGGGGG - Intronic
968646781 4:1745034-1745056 GACAGACGGGAGCAGGGGGGCGG - Exonic
968652245 4:1764880-1764902 CCCCGAGGAGAGGAGGAGGGAGG - Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968969683 4:3787252-3787274 GCCAGAGGGGAGGGGGAGGGAGG - Intergenic
969013889 4:4090137-4090159 CACACAAGGAATAAGGAGGGAGG + Intergenic
969032132 4:4223973-4223995 GACAGTGGAGAGAAGGATGGAGG + Intronic
969234011 4:5852488-5852510 AAAAGAGGAGAGAAGCAGGGAGG - Intronic
969238005 4:5880204-5880226 CACTGAGGGGAGAATGGTGGGGG + Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969399100 4:6941887-6941909 CACCTAGGGCAGAAGGAAGGTGG - Intronic
969531495 4:7733292-7733314 CACAGAGGGGACAGTGAGTGAGG - Intronic
969604715 4:8196711-8196733 CCCTGATGGGAGAAGGAAGGTGG + Intronic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969740096 4:9018298-9018320 CACACAAGGAATAAGGAGGGAGG - Intergenic
969799260 4:9549807-9549829 CACACAAGGAATAAGGAGGGAGG - Intergenic
971311567 4:25529917-25529939 AAGAGAGGAGAGAAGAAGGGAGG + Intergenic
971377553 4:26067412-26067434 CACAGTTGGGAGAAGAAGGCCGG + Intergenic
971677628 4:29654035-29654057 AGCAGAAGGGAGAGGGAGGGAGG + Intergenic
972211446 4:36842789-36842811 CGGAGAGGGGAGAAGCAGAGAGG - Intergenic
972288109 4:37668221-37668243 GAAAGAGGGGAGAGGGAGAGGGG - Intronic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
973874515 4:55203480-55203502 CACACAGTGGGCAAGGAGGGTGG + Intergenic
974377080 4:61092675-61092697 CTCAGAAGCCAGAAGGAGGGTGG + Intergenic
974824258 4:67106426-67106448 CACAGAAGGAAGACGTAGGGAGG - Intergenic
975504387 4:75122419-75122441 AGGAGAGGGGAGAGGGAGGGAGG + Intergenic
975779640 4:77824775-77824797 GACAGAGGAGGGAGGGAGGGAGG - Intergenic
975986266 4:80203299-80203321 CACAGCGAGGTGAAGGAGGGCGG - Exonic
976052191 4:81022360-81022382 CAGACAGGGGAGAAGGAAAGAGG + Intergenic
976413067 4:84739511-84739533 CCCAGAGGGAAGAAGGAGTGTGG - Intronic
976748415 4:88429367-88429389 CACAGAGGGGTGAAGAATTGGGG + Intronic
977220474 4:94332203-94332225 CAGAGAGGGGAGCTGGAGAGAGG - Intronic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
978234577 4:106443269-106443291 GAAAGAGAAGAGAAGGAGGGAGG - Intergenic
978294400 4:107186690-107186712 GCTAGAGGGAAGAAGGAGGGAGG + Intronic
978706474 4:111718804-111718826 GCCAGAGGGGGGAGGGAGGGAGG + Intergenic
978740137 4:112127742-112127764 TACACAGAGGAGAAGCAGGGTGG - Intergenic
978940878 4:114434796-114434818 CACAGTGGGGAGGAGGAATGGGG + Intergenic
979275041 4:118806037-118806059 GAAGGAGGGGAAAAGGAGGGAGG - Intronic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
980729133 4:136804661-136804683 CAGAGAGGGGAGATGGAGGGAGG - Intergenic
980848139 4:138348781-138348803 CACAGAAGGAGGAAGGTGGGAGG + Intergenic
980972849 4:139583114-139583136 CCCAGAGGGGAAGAGGAGGCAGG + Intronic
981091147 4:140733916-140733938 AGCGGAGGAGAGAAGGAGGGAGG - Intronic
981229763 4:142338975-142338997 CCAGGAGGGGAGAAGGAGGTCGG + Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
982721528 4:158864963-158864985 CACAGAGTGGAGACTCAGGGAGG - Intronic
983472804 4:168177133-168177155 GCCAGTGGGGAGAAGGAGGTAGG - Intronic
983890019 4:173021113-173021135 GACAGAGGGGAGAGGGATGAGGG - Intronic
984171326 4:176362744-176362766 TAGAGAGGGGAGAAGGAGAAGGG - Intergenic
984634159 4:182092948-182092970 CACACAGTGGACAAGGAGTGGGG - Intergenic
984966643 4:185145261-185145283 GGCATCGGGGAGAAGGAGGGTGG + Intronic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985131241 4:186740659-186740681 CCCAGATGGGAGATGCAGGGAGG - Intergenic
985436635 4:189936807-189936829 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
985545132 5:505481-505503 CACAGAGGGGAGAGTGACTGTGG + Intronic
985545187 5:505640-505662 CACAGAGGGGAGAGTGACTGTGG + Intronic
985643543 5:1074654-1074676 CACAGGGCCGAGAAGGAGTGGGG - Exonic
985793590 5:1945916-1945938 CATTGAGGGGAGACAGAGGGCGG + Intergenic
985933478 5:3077709-3077731 TACAGAGTGGGAAAGGAGGGAGG + Intergenic
985983021 5:3488133-3488155 CAGAGAGGGGAGGAAGGGGGAGG + Intergenic
986296671 5:6445079-6445101 CTGAGATGGAAGAAGGAGGGGGG + Intergenic
986313342 5:6571040-6571062 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313406 5:6571223-6571245 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313430 5:6571293-6571315 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313451 5:6571359-6571381 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313511 5:6571530-6571552 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986337545 5:6766689-6766711 CAGCGAGGGGAGAGGGAGGGAGG - Intergenic
986689977 5:10306365-10306387 GGCAGAGAGGAGGAGGAGGGAGG + Intronic
987034130 5:14003498-14003520 CAGAGAGGTGAGAGGGAGGAAGG - Intergenic
987258327 5:16179660-16179682 GGGAGAGGGGAAAAGGAGGGAGG + Exonic
987486444 5:18532969-18532991 CAGAGAGGGGAGCTGGAGAGAGG - Intergenic
987799017 5:22668856-22668878 AAAAGAGGAGAGGAGGAGGGAGG - Intronic
988493198 5:31722395-31722417 TACAGAGTGGAGAGGGTGGGAGG - Intronic
988643914 5:33072879-33072901 CAGAGATGGGAGATGGAGTGAGG + Intergenic
988662275 5:33284748-33284770 CGCAGAAGTGAGAAGGAGGATGG + Intergenic
988731824 5:33980209-33980231 CACTGATTGGAGTAGGAGGGGGG - Intronic
988998656 5:36738711-36738733 CACAGAGGAGACAGGCAGGGAGG - Intergenic
989077199 5:37576125-37576147 GAGGGAGGGGGGAAGGAGGGCGG - Intronic
989231845 5:39095836-39095858 CACACTGGGGTGAGGGAGGGAGG + Intergenic
990109997 5:52310825-52310847 CATAGAGAGGAGAGAGAGGGAGG - Intergenic
990637226 5:57742488-57742510 ATTAGAGGGGGGAAGGAGGGAGG - Intergenic
990782251 5:59378276-59378298 ACCAGAGGGTAGAAGGTGGGAGG + Intronic
991023175 5:62002227-62002249 GTGAGAGGGGAGGAGGAGGGGGG - Intergenic
991483000 5:67103505-67103527 ATTAGAGGGGAGGAGGAGGGAGG + Intronic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
991693158 5:69245274-69245296 AAGGGAGGGGAAAAGGAGGGAGG - Intronic
991964858 5:72080697-72080719 ATCAGAGGGTAGAAGGTGGGAGG + Intergenic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992503327 5:77362879-77362901 CACAGCGGGGAGGAGGAGAGAGG - Intronic
992611281 5:78510396-78510418 CACCTAGGGGAGAGGGAGGGCGG + Exonic
992623447 5:78616035-78616057 AACAGAGGGCAGAAGGAAGGAGG - Intronic
992678959 5:79134089-79134111 CAGGGAGGGAGGAAGGAGGGCGG + Intronic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
992831828 5:80601123-80601145 AACCAAGGGGAGAAGGAGGTGGG - Intergenic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
993588950 5:89769946-89769968 AACAGAGGAGAGAGTGAGGGAGG + Intergenic
993736034 5:91477542-91477564 CCCAGAGGGGAGTAGGGGGCAGG - Intergenic
994055355 5:95408106-95408128 GAGAGAGGAGGGAAGGAGGGAGG + Intronic
994541722 5:101108234-101108256 CACAGAGGACCGAAGGAGTGAGG - Intergenic
994714574 5:103306241-103306263 TACATAGGGGTGAAGGAGGTTGG + Intergenic
995815013 5:116158181-116158203 GAGAGAGGGGAGACGGAGAGAGG - Intronic
995815017 5:116158196-116158218 GAGAGAGGGGAGACGGAGAGAGG - Intronic
995815021 5:116158211-116158233 GAGAGAGGGGAGACGGAGAGAGG - Intronic
995815025 5:116158226-116158248 GAGAGAGGGGAGACGGAGAGAGG - Intronic
995815029 5:116158241-116158263 GAGAGAGGGGAGACGGAGAGAGG - Intronic
995815033 5:116158256-116158278 GAGAGAGGGGAGACGGAGAGAGG - Intronic
995815045 5:116158296-116158318 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815050 5:116158311-116158333 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815055 5:116158326-116158348 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815060 5:116158341-116158363 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815065 5:116158356-116158378 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815070 5:116158371-116158393 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815075 5:116158386-116158408 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815080 5:116158401-116158423 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815085 5:116158416-116158438 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815090 5:116158431-116158453 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815095 5:116158446-116158468 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815100 5:116158461-116158483 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
996507472 5:124284545-124284567 CAGAGATGGGAGCAGTAGGGTGG + Intergenic
996810107 5:127506947-127506969 CTCAGGTGGGAGCAGGAGGGTGG + Intergenic
997284868 5:132670714-132670736 CACAGGGGCGAGATGGAGGAGGG - Intergenic
997621332 5:135298187-135298209 CACATGGGGGAGAACAAGGGAGG - Intronic
997710698 5:136001624-136001646 CACAGAGGAAGGAATGAGGGAGG - Intergenic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
998630065 5:143888356-143888378 CTCAGAGTGAAGAAGGAGGAGGG + Intergenic
998656831 5:144190653-144190675 GACAGAGGGGACAAGGAAAGAGG - Intronic
998804054 5:145901142-145901164 ACTAGAGGGGGGAAGGAGGGAGG + Intergenic
998887808 5:146712700-146712722 CACAGAGTGGTGAGGGAGGAAGG - Intronic
998976027 5:147648892-147648914 CACAGAGGGGAGAGAGTAGGAGG + Intronic
999040248 5:148401609-148401631 CCCATGGGGGAGGAGGAGGGTGG + Intronic
999272161 5:150302841-150302863 CCCAGAGGGGAAGGGGAGGGAGG + Exonic
999694679 5:154178624-154178646 CACAGAGGGAAGAAGGCAGCTGG - Intronic
999737256 5:154521981-154522003 CACAAAGGGGAGGTGGGGGGAGG + Intergenic
1000410194 5:160929502-160929524 CCTAGAGTGGATAAGGAGGGTGG - Intergenic
1000830796 5:166098764-166098786 AGCAGAGGGGAAAAGGAGGCAGG - Intergenic
1000898266 5:166882439-166882461 TTCAGTGTGGAGAAGGAGGGAGG + Intergenic
1000963031 5:167622799-167622821 CAAAGAGGAGACCAGGAGGGTGG + Intronic
1001129580 5:169052869-169052891 CAGAGTGGGGTGAGGGAGGGTGG - Intronic
1001150222 5:169220894-169220916 TACAGAAGGGAGAAGTTGGGGGG - Intronic
1001624303 5:173117630-173117652 GAGAGAGGAGAGAAGGAGGGAGG - Intronic
1002042881 5:176527615-176527637 CACTGCGAGGAGAACGAGGGTGG + Exonic
1002210620 5:177596813-177596835 CCCAGAGGCCAGAGGGAGGGGGG - Intergenic
1002471444 5:179438386-179438408 CACAGAGGGGCTGAGGAGCGTGG + Intergenic
1002590714 5:180290289-180290311 CACAGAGGTGTGAAGGAGCAGGG - Intronic
1002840106 6:898094-898116 GAGAGAGGCGAGAGGGAGGGAGG + Intergenic
1003081269 6:3023722-3023744 CAAAGAGGGGAGAAAAAGGAAGG - Intergenic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003153155 6:3569964-3569986 CACAGAGGGGAGAGTGCAGGAGG - Intergenic
1003153185 6:3570075-3570097 GAGGGAGGGGACAAGGAGGGAGG - Intergenic
1003387165 6:5679495-5679517 GACAGAGGGGTGATGGAGGAGGG - Intronic
1003443506 6:6164780-6164802 AACAGAGGAGAAAAGGATGGAGG - Intronic
1003496019 6:6663868-6663890 CACAGAGCGCTGGAGGAGGGAGG - Intergenic
1003498638 6:6686419-6686441 CACAGAGGGAAGACGGTGTGAGG - Intergenic
1003759693 6:9162778-9162800 AAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1004565473 6:16791998-16792020 CCCAATGGGGAGAGGGAGGGAGG - Intergenic
1004772162 6:18796164-18796186 GAAAGAGGAGAGAAGGAAGGAGG - Intergenic
1004903239 6:20212541-20212563 CCGAGAGGAGGGAAGGAGGGAGG + Intergenic
1005026429 6:21466927-21466949 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1005769390 6:29051213-29051235 GACGAATGGGAGAAGGAGGGAGG - Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1005963181 6:30707718-30707740 CAGAGAGGGGAGCCAGAGGGAGG - Exonic
1006096991 6:31662322-31662344 GAGGGAGGAGAGAAGGAGGGAGG - Exonic
1006338368 6:33432450-33432472 CACAGCTTGGAGAAGGTGGGAGG - Intronic
1006546450 6:34785716-34785738 GAAAGAGGGGAGAGGGAGAGGGG - Intergenic
1006836157 6:36999947-36999969 CTCAGATGGGGGAAGGTGGGAGG - Intergenic
1006836417 6:37001675-37001697 CTCAGATGGGGGAAGGTGGGAGG + Intergenic
1007282222 6:40721021-40721043 CTCAGATGGGAAAAGGAGGTCGG + Intergenic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007390066 6:41545862-41545884 CGCAGTGGGGAGCAGGAGGGAGG + Intergenic
1007506894 6:42342455-42342477 AACAGAGGTGAGAAGGATGTGGG - Intronic
1007519594 6:42441323-42441345 CTCAAAGGGGGGAAGGAGGAGGG + Intronic
1007531781 6:42549104-42549126 CATAAAGGGGAAGAGGAGGGAGG + Intergenic
1007622369 6:43222924-43222946 AACAGAGGGGAGGAGGCAGGAGG - Intronic
1008016417 6:46525568-46525590 AGAAGAGAGGAGAAGGAGGGAGG + Intergenic
1008165870 6:48137549-48137571 TAGAGAGGGGAGAAAGAGTGAGG - Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008624989 6:53306360-53306382 GAGAGAGGGGAGAGGGAGAGGGG + Intronic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1009060453 6:58392283-58392305 ACTAGAAGGGAGAAGGAGGGTGG + Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009230458 6:61055051-61055073 ACTAGAAGGGAGAAGGAGGGTGG - Intergenic
1009990601 6:70838718-70838740 AACAGAGGAGACAAGGAAGGAGG + Intronic
1010294720 6:74182715-74182737 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1010578897 6:77569326-77569348 CTCAGAAGGGAGGAGAAGGGAGG - Intergenic
1010613961 6:77990619-77990641 AAGAGAGAGGAGAAGGAGAGGGG - Intergenic
1010704368 6:79090025-79090047 GAGAGAGGGGGGAAGAAGGGAGG - Intergenic
1010940762 6:81915165-81915187 GACAGTGGGGGGAAGGGGGGGGG - Intergenic
1011476289 6:87752099-87752121 GAAAGAGGGGAGAGGGAGAGGGG + Intergenic
1011549731 6:88520038-88520060 CAAGGAGGTGAGAAAGAGGGTGG + Intergenic
1011566960 6:88685524-88685546 AGGAGAGGGGAGAAGGGGGGAGG + Intronic
1011717668 6:90123890-90123912 TTCTGAGGGGAGCAGGAGGGAGG + Intronic
1011780821 6:90787384-90787406 TGCAGAGGGTAGAAGGTGGGGGG + Intergenic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012166167 6:95955211-95955233 CTCAGAGGGTGGAAGGTGGGAGG + Intergenic
1012639922 6:101597222-101597244 AATAGAGGGGAGGAGGAGGGAGG + Intronic
1012875969 6:104726216-104726238 AAAAGAGGGGGGAGGGAGGGGGG + Intergenic
1013196922 6:107852184-107852206 CAAAGAGGGAAGAAGCAGGATGG - Intergenic
1013592008 6:111626818-111626840 CACAAAGGGCAGAGGTAGGGGGG + Intergenic
1013605823 6:111746808-111746830 GAGAGAGGGTAGAGGGAGGGAGG + Intronic
1013840476 6:114386641-114386663 CAAAGAGAGGAAAAGGAGGGAGG + Intergenic
1014266730 6:119286407-119286429 CACAGAGGGGAGTAGGATTGTGG - Intronic
1014300118 6:119671256-119671278 CACATAGTGAAAAAGGAGGGAGG - Intergenic
1014420383 6:121236397-121236419 CACAGAGGGAAGATGAAGGATGG + Intronic
1014919834 6:127200849-127200871 AACATAGGAGAGACGGAGGGAGG + Intergenic
1015171757 6:130261955-130261977 GACAGAGAGGAGAAAGAGAGAGG + Intronic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015715937 6:136191882-136191904 CCCAGAGGGCAGAAGCAGCGTGG + Exonic
1015821952 6:137270913-137270935 ATCAGAGGGGGGAAGGTGGGAGG + Intergenic
1015853807 6:137602739-137602761 GACAGAAGGGAGAAGAAGAGCGG + Intergenic
1016879799 6:148899894-148899916 CACAGAAGGGTGATGGGGGGTGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016932262 6:149422960-149422982 CACTGAGAGGCCAAGGAGGGAGG + Intergenic
1016943922 6:149510297-149510319 CACAGAGGGAAGAAGGAAAAGGG + Intronic
1017129287 6:151094164-151094186 GTCAGTGGGGAGAAGGAGGCGGG - Intronic
1017414429 6:154204907-154204929 AAAGGAGTGGAGAAGGAGGGAGG - Intronic
1017512648 6:155128054-155128076 GAAAAGGGGGAGAAGGAGGGAGG - Intronic
1017775749 6:157679472-157679494 CATAGAGGAGAGAAGGGGGTGGG - Intergenic
1017776082 6:157681684-157681706 CATAGAGGGGAGTATAAGGGAGG - Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018036473 6:159886869-159886891 GAAAGAGGGGAGAGGAAGGGAGG + Intergenic
1018063170 6:160106191-160106213 TACAGCGCGGAGGAGGAGGGAGG + Exonic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018432185 6:163730988-163731010 CACAGCAGGAAGCAGGAGGGAGG + Intergenic
1018654775 6:166024764-166024786 CAGAGAGGGGAGCTGGAGAGGGG + Intergenic
1018762009 6:166901157-166901179 CACAGAGGGGAGAACGCCAGGGG + Intronic
1018762211 6:166902416-166902438 CACAGAGGGGAGAACGCCAGGGG + Intronic
1019007189 6:168808830-168808852 CACAAATGGGCTAAGGAGGGAGG + Intergenic
1019075119 6:169380708-169380730 CACAGAGGGGCTGAGAAGGGAGG + Intergenic
1019151739 6:170010975-170010997 GACAGAGGGAAGGAGGAGGGAGG + Intergenic
1019298459 7:290991-291013 CCCCGAGGGGACAAGGCGGGCGG + Intergenic
1019334900 7:478445-478467 GACAAAGGGAGGAAGGAGGGAGG + Intergenic
1019536699 7:1533206-1533228 CACAGTGCGGAGAAGCAGGAAGG - Intronic
1019549253 7:1594032-1594054 CATAGAGGAGAGAGGGATGGAGG - Intergenic
1019716821 7:2542963-2542985 CCCAGAGGTGAGAAGGATGCGGG - Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020473058 7:8561413-8561435 CCCAGAGGAGGGAAGGAGGGAGG - Intronic
1020722256 7:11761901-11761923 CCAAAAGGGGGGAAGGAGGGAGG - Intronic
1020809135 7:12829992-12830014 TCAAGAGGGGAGAGGGAGGGTGG + Intergenic
1020852115 7:13367499-13367521 GAGGGAGGGGAGAAGGTGGGAGG - Intergenic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021509999 7:21425279-21425301 GAGAGAGGGGAAAGGGAGGGAGG - Intergenic
1021554988 7:21909957-21909979 CACAGGGGTGGGCAGGAGGGTGG + Intronic
1021851620 7:24814226-24814248 GACAGTGGGGAAAAAGAGGGAGG + Intronic
1021927835 7:25550409-25550431 CCCAGAGGGGAGAAGGAGAAAGG - Intergenic
1022012790 7:26323515-26323537 CACAGAGGAGAGGAAGAGAGTGG + Intronic
1022097152 7:27148136-27148158 CAAAAAGGGGAGGAGGAAGGAGG - Intronic
1022097861 7:27152010-27152032 CACGGAGGGCCGAAGGAAGGCGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1022673734 7:32479155-32479177 CACACACAGGAGAAGAAGGGAGG - Intergenic
1023888545 7:44377045-44377067 CACAGGAGGGACAGGGAGGGAGG - Intergenic
1024046866 7:45591031-45591053 CAAAGAGGTGACAGGGAGGGAGG - Intronic
1024217489 7:47259675-47259697 CAAAGAGGAGAGAAGCAAGGAGG + Intergenic
1024266825 7:47613133-47613155 AACACTGGGGAGAGGGAGGGAGG - Intergenic
1024359599 7:48454703-48454725 AACAGAGAGGAAAAGGATGGTGG + Intronic
1024539460 7:50464225-50464247 TTCAGAGTGGAGAAGCAGGGAGG + Intronic
1024797260 7:53035440-53035462 GAGAAAGGGGAGAGGGAGGGAGG + Intergenic
1024811518 7:53217882-53217904 CACATATGAGAGACGGAGGGTGG + Intergenic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026104439 7:67409985-67410007 CAGAGAGGGAGGGAGGAGGGAGG - Intergenic
1026551977 7:71376527-71376549 CACATACGGGAGCAGAAGGGAGG - Intronic
1026579464 7:71601833-71601855 CCAAGAGGGAAGAAGGAGGCAGG + Intronic
1027271093 7:76519352-76519374 AAAAGAGGGAAGAAGGAGAGAGG + Intergenic
1027320856 7:77009287-77009309 AAAAGAGGGAAGAAGGAGAGAGG + Intergenic
1027877804 7:83793596-83793618 GACAGAGGAGAAAAGGATGGCGG + Intergenic
1028253349 7:88561630-88561652 CAGGGAGGGGAGAAGAAGAGAGG - Intergenic
1028281547 7:88936025-88936047 AAGAGAGGGAAGAGGGAGGGTGG - Intronic
1028382164 7:90211832-90211854 CAGCCAGGGGAGAAGGAAGGAGG - Exonic
1028751858 7:94391856-94391878 GGGAGAGGGGAGAGGGAGGGAGG - Intergenic
1029072541 7:97911755-97911777 CACACAAGGAATAAGGAGGGAGG + Intergenic
1029441154 7:100587269-100587291 AACGGAAGGGAGAGGGAGGGAGG - Intronic
1029513220 7:101009785-101009807 CCCAGAGGGGAGAGAGAGGAGGG + Intronic
1029640205 7:101815742-101815764 CGCGGAGGGGAGGGGGAGGGCGG + Intergenic
1030216211 7:107045392-107045414 CAGAGAGCGGAGTAGGAAGGTGG - Intronic
1030314040 7:108096158-108096180 ATTAGAGGGGAGAAGGAGTGGGG - Intronic
1030492919 7:110261095-110261117 TAGAGAGGGGGGAAAGAGGGAGG + Intergenic
1030603969 7:111619447-111619469 TTCATAGGGGAGAAGGAGTGGGG - Intergenic
1030829119 7:114198785-114198807 AAGAGTGGGGAGAAGGAGAGAGG + Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031449152 7:121893062-121893084 CAGAGAGGCAGGAAGGAGGGAGG + Intronic
1031490615 7:122383327-122383349 AGTAGAGGGGAGAGGGAGGGAGG + Intronic
1031931176 7:127687463-127687485 CCAAAAGGGGAGAAGGAGTGAGG - Intronic
1032056498 7:128688788-128688810 GACTGTGGGGAGAGGGAGGGGGG - Intergenic
1032601378 7:133299863-133299885 CAAAGAGAGGAGAAGGACTGAGG - Intronic
1032670059 7:134074312-134074334 AAGAAAGGGGAGAAGAAGGGAGG - Intergenic
1032728136 7:134611281-134611303 AACAGAGGGAAGAAGGCGTGTGG - Intergenic
1033250078 7:139751353-139751375 CACAAAGGGGAGGTGGAAGGTGG - Intronic
1033252883 7:139776522-139776544 CACAGAGGAGGGCACGAGGGGGG - Intronic
1033349079 7:140547102-140547124 CACAGAGGAGAGAAGAATTGGGG - Intronic
1033439429 7:141365460-141365482 CTCAGAGGGGTGAAGGAGATGGG - Intronic
1033885602 7:145941174-145941196 CATAGAGGGGAACAGCAGGGTGG - Intergenic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034160832 7:148993278-148993300 CACAGTGGGGTCAGGGAGGGTGG + Intergenic
1034205535 7:149311429-149311451 CCAAAAGGGGAGAGGGAGGGAGG - Intergenic
1034248973 7:149672948-149672970 CAGAGAGGAGAGAAAGAGAGAGG + Intergenic
1034298902 7:149998111-149998133 TACTGAGGGCAGAAGAAGGGTGG - Intergenic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1034493557 7:151407316-151407338 CACAGAGCTGGGCAGGAGGGTGG + Intronic
1034536252 7:151727704-151727726 CCCAGGAGCGAGAAGGAGGGAGG + Intronic
1034807115 7:154098666-154098688 TACTGAGGGCAGAAGAAGGGTGG + Intronic
1034939969 7:155224261-155224283 CACAGAGGAAAGAAGAAAGGAGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035237656 7:157509164-157509186 GAGAGAGGGGAGAGGGAGAGGGG + Intergenic
1035259449 7:157652383-157652405 CTCACAGGGGAGAAGAAGGTTGG + Intronic
1035299144 7:157885853-157885875 CACAGAGGGGAGACTGAGGCAGG - Intronic
1035590288 8:807896-807918 CATAAAGGGGAGAAGGTTGGCGG + Intergenic
1035732059 8:1860322-1860344 CATGGAGAGGAGGAGGAGGGGGG - Intronic
1035732081 8:1860389-1860411 CATGGAGAGGAGGAGGAGGGGGG - Intronic
1036191435 8:6674299-6674321 CACACAAGGGAGATGGAAGGAGG - Intergenic
1036245125 8:7109547-7109569 CACACAAGGAATAAGGAGGGAGG - Intergenic
1036255624 8:7204262-7204284 CACACAAGGAATAAGGAGGGAGG + Intergenic
1036361861 8:8083240-8083262 CACACAAGGAATAAGGAGGGAGG - Intergenic
1036561504 8:9903598-9903620 GACAGCGGGGAGAGGGATGGGGG + Intergenic
1036663049 8:10720862-10720884 CGGGGAGGGGGGAAGGAGGGAGG - Intergenic
1036683501 8:10893225-10893247 ACCAGATGGGAGAAGGAAGGTGG + Intergenic
1036702024 8:11019248-11019270 GTCAGAGAGGAGAGGGAGGGTGG - Intronic
1036759124 8:11494852-11494874 CACAGAGGAGAGAAGGGACGTGG + Intronic
1036889106 8:12583775-12583797 CACACAAGGAATAAGGAGGGAGG + Intergenic
1036969099 8:13334206-13334228 CACAGAGGAGAGAAGCAGGGGGG + Intronic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037710390 8:21350903-21350925 CACAGTGGGAAGGAGGAGGGAGG + Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037858859 8:22390625-22390647 CACAAAGGGGAAGAGGAGAGGGG - Intronic
1037885526 8:22594196-22594218 CACAGAAGTGGGAAGGAGAGGGG + Exonic
1038012909 8:23488747-23488769 CACAGAGGGGAGATCTAGAGTGG + Intergenic
1038542607 8:28402207-28402229 AGAAGAGGGGAGGAGGAGGGAGG + Intronic
1038562953 8:28596431-28596453 CAGAGAGGGGACACGGAGCGGGG + Intergenic
1038650849 8:29402002-29402024 AAGAGAGGGAAGAGGGAGGGAGG - Intergenic
1038651220 8:29405227-29405249 ACTAGAGGGGAGAAGGAGGGAGG - Intergenic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1039042820 8:33424346-33424368 GACACAGGGAAGAAGTAGGGAGG - Intronic
1039044424 8:33436908-33436930 ACTAGAGGGGAGAAGGAGGGAGG - Intronic
1039187164 8:34930404-34930426 GAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1039793772 8:40895633-40895655 CACAGAGGGAAGAGGCAGTGTGG - Intronic
1039803060 8:40976297-40976319 CCCCGAGGGGAGCAGGAGGCTGG - Intergenic
1039988255 8:42466114-42466136 CACAGAGGGGACAGGGATGATGG + Intronic
1040284064 8:46091166-46091188 TGCAGAGGGGAGAAGCAGTGAGG + Intergenic
1040284425 8:46092662-46092684 CATAGAGGGGAGAAGCAGCGAGG + Intergenic
1040284784 8:46094176-46094198 TGCAGAGGGGAGAAGCAGTGAGG + Intergenic
1040285001 8:46095039-46095061 CACAGAGGGCAGAAGTGGTGAGG + Intergenic
1040285540 8:46098711-46098733 GGCAGAGGGGAGAAGCAGTGAGG + Intergenic
1040296459 8:46151558-46151580 GACAGAGGGGAGAAGTGGAGAGG - Intergenic
1040328315 8:46373527-46373549 TGCAGAGGGGAGAAGCAGTGAGG - Intergenic
1040759722 8:50824746-50824768 GGCTGAGGGGAGTAGGAGGGAGG + Intergenic
1040781463 8:51114774-51114796 GAGAGAAGGGAGAAGGAGAGAGG - Intergenic
1041098117 8:54369826-54369848 GAGAGAGGGGGGAGGGAGGGAGG - Intergenic
1041151464 8:54939726-54939748 AACAGAGGGGAGAGGAATGGGGG - Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041852664 8:62410097-62410119 TACAGAGGGGGAAGGGAGGGAGG - Intronic
1041908104 8:63055584-63055606 CACAGAGGGGACAAAGGGGCAGG + Intronic
1042040547 8:64584516-64584538 GAGTGAGGGCAGAAGGAGGGAGG + Intergenic
1042081560 8:65059761-65059783 CAGAGAGGGGAGAAGTAGCTGGG + Intergenic
1042238596 8:66639953-66639975 CATAGAGGGTGGGAGGAGGGAGG + Intronic
1042564569 8:70099070-70099092 AGGGGAGGGGAGAAGGAGGGAGG + Intergenic
1042777344 8:72448075-72448097 CACATACAGGAGAAGGAAGGCGG + Intergenic
1042942121 8:74118374-74118396 GAGAGAGGGAAGAAGGAAGGAGG - Intergenic
1043296382 8:78668151-78668173 GGGAGAGGGGAGAAGGAGGAAGG - Intronic
1043379151 8:79684166-79684188 CACAGAGGGTAACAGGAGAGCGG - Intergenic
1043918681 8:85955255-85955277 ACTAGAGTGGAGAAGGAGGGAGG + Intergenic
1044221074 8:89670166-89670188 CAGACAGGGGAGAGGGAGAGAGG - Intergenic
1044480664 8:92683759-92683781 CACTGAGGGGAAAAGGCAGGAGG - Intergenic
1044714809 8:95090514-95090536 CGCAGAGGAGAAAAGCAGGGAGG - Intronic
1045127786 8:99113044-99113066 AACAGAGGGGAGGGGAAGGGTGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045461065 8:102426261-102426283 CATAGAGGGGAGTAGCAGTGGGG - Intergenic
1046709413 8:117493032-117493054 GACAGAGGGTAGAAGGAGGGAGG - Intergenic
1046985683 8:120385794-120385816 CTCAGAAGGGTGAAGGTGGGAGG - Intronic
1047329014 8:123868111-123868133 AAATGAGGGGAGAAGGAGCGGGG - Intronic
1047894965 8:129356498-129356520 AACAGGGAGGGGAAGGAGGGAGG + Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048335664 8:133500318-133500340 CACGGGGGCCAGAAGGAGGGAGG + Intronic
1048383119 8:133885850-133885872 GAGAGACTGGAGAAGGAGGGAGG + Intergenic
1048468722 8:134688529-134688551 GAGAAAGGGGAGAAGGAAGGTGG + Intronic
1048629160 8:136222035-136222057 ACTAGAGGGGAGAAGGAGAGAGG + Intergenic
1048690773 8:136960670-136960692 TTCAAAGGGGAGAAGGAGGTGGG + Intergenic
1048952293 8:139506361-139506383 CACTGAGTTGAGAAGGAGTGGGG + Intergenic
1048979667 8:139696626-139696648 CACAGAGGAGGGAGGGAAGGAGG + Intronic
1049122618 8:140752905-140752927 CACAGAGGGTGGAAGGTAGGAGG + Intronic
1049367026 8:142244778-142244800 CACAGAGCGGAAAGGGAGGCTGG + Intronic
1049370269 8:142261050-142261072 GAAAGAGGGAAGCAGGAGGGAGG + Intronic
1049374063 8:142280783-142280805 GACAGTGGGGAGAAGGGGGGAGG + Intronic
1049759472 8:144325568-144325590 CATAAAGGGGGGATGGAGGGTGG + Intronic
1050580847 9:7054548-7054570 CACAGAAGGAAGAAGGCGGTAGG + Intronic
1050939708 9:11443336-11443358 CAGAGAGGGGAGCTGGAGAGAGG - Intergenic
1051014966 9:12463207-12463229 GAGAGAGGGAAGAGGGAGGGAGG - Intergenic
1051150314 9:14072588-14072610 CAGAGAGGGAAGGAGGAGTGTGG + Intergenic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1052010582 9:23403771-23403793 CACAGAGTGGAGAAGAAGTGAGG + Intergenic
1052366948 9:27622692-27622714 CAAAGAGGGAAAAAAGAGGGAGG + Intergenic
1052773115 9:32707319-32707341 GAGAGAGCTGAGAAGGAGGGAGG + Intergenic
1052970405 9:34373796-34373818 CCCAGAGGGGGAGAGGAGGGAGG + Intronic
1053724763 9:40988273-40988295 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1053845360 9:42231198-42231220 CACAGAGGGAAACATGAGGGTGG + Intergenic
1054341209 9:63863726-63863748 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055356994 9:75447940-75447962 AGCAGAGAAGAGAAGGAGGGAGG - Intergenic
1055381325 9:75710102-75710124 GAGAGAGAGGAGAGGGAGGGAGG - Intergenic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1055600895 9:77917353-77917375 TAAAGAGGGCGGAAGGAGGGTGG + Intronic
1055786970 9:79881573-79881595 GACAGAGGGGAGAGGTAGGGGGG - Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1055934733 9:81594038-81594060 GAAAGAGGGGAGAGGGATGGGGG + Intronic
1056367274 9:85918263-85918285 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1056429827 9:86516364-86516386 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1056648910 9:88440897-88440919 CACAAAGGGGAGGGGAAGGGAGG - Intronic
1056824070 9:89864616-89864638 CACAGAGGGGTAAGGGAAGGGGG + Intergenic
1056833076 9:89932179-89932201 GTCAGAGGAGAGAAGCAGGGTGG - Intergenic
1056869734 9:90266327-90266349 GAGGGAGGGGAGGAGGAGGGAGG - Intergenic
1056965168 9:91159369-91159391 AAGAGAGGAGGGAAGGAGGGAGG + Intergenic
1056965178 9:91159414-91159436 GAAAGAGGAGCGAAGGAGGGAGG + Intergenic
1056965189 9:91159463-91159485 GAAAGAGGAGGGAAGGAGGGAGG + Intergenic
1056965576 9:91160921-91160943 CCCAGAGGGGAGCAGCAGGCAGG + Intergenic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057195986 9:93115806-93115828 GAGAGACGGGTGAAGGAGGGAGG + Intergenic
1057196004 9:93115850-93115872 GAGAGACGGGTGAAGGAGGGAGG + Intergenic
1057196038 9:93115969-93115991 GAGGGAGGGGTGAAGGAGGGAGG + Intergenic
1057303954 9:93901908-93901930 CACAGAGGAGATAAGGAAGCAGG + Intergenic
1057307005 9:93918307-93918329 CATTGAGGGGAGGAGGCGGGTGG - Intergenic
1057735800 9:97658674-97658696 CACAGAGCTGAGAAGGTAGGAGG - Exonic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058317459 9:103586529-103586551 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1058341663 9:103904784-103904806 AAGGGAGGGGAGAAGGAGGGAGG + Intergenic
1058803573 9:108568051-108568073 CAGACAGGGGAGAAAGATGGGGG - Intergenic
1058959342 9:109978165-109978187 GGCAGAGGGGAGATGGAGAGAGG + Intronic
1059063748 9:111060521-111060543 GAAAGAGGGGAGAAGAAGGGAGG + Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059301261 9:113315319-113315341 AAGAGAGGGAAGAAGGAAGGTGG + Exonic
1059336474 9:113572294-113572316 GACAGAGGGAGGCAGGAGGGTGG + Intronic
1059410257 9:114127311-114127333 CCCAGAGGTGAGAAGGGGGCAGG - Intergenic
1059414528 9:114155018-114155040 GACAGAAGGGAGAGAGAGGGTGG + Intergenic
1059665252 9:116440265-116440287 CACAGAGGGGAACAGCAGTGGGG - Intronic
1059770239 9:117416959-117416981 CACAAAGGAGAGACTGAGGGAGG - Intergenic
1059821926 9:117983138-117983160 GAGAGAGGGGGGAGGGAGGGAGG + Intergenic
1060338900 9:122755269-122755291 CAGAGAGGAGAGAAGGACTGGGG - Intergenic
1060351603 9:122866375-122866397 GACCGTGGGGAGAGGGAGGGGGG - Intronic
1060395313 9:123312444-123312466 GAGGGAGGGGAGAGGGAGGGAGG + Intergenic
1060563300 9:124566665-124566687 CACAGAGGAGAGATGAAGAGAGG + Intronic
1060698663 9:125731615-125731637 AGCAGAGGAGAGAAAGAGGGAGG - Intergenic
1060705920 9:125800994-125801016 CACTGGGGGGCCAAGGAGGGAGG - Intronic
1060735742 9:126065572-126065594 GAGGGAGGGGGGAAGGAGGGAGG - Intergenic
1060891251 9:127189866-127189888 CACAGGGTGGAGAAGGGTGGAGG + Intronic
1061105834 9:128529709-128529731 CACAAAGGGGAGAGAGAGAGAGG - Intronic
1061204136 9:129153237-129153259 CACAGTGGGGAGGAAGAAGGAGG + Intergenic
1061257330 9:129460389-129460411 GAGAGGGGGGAGGAGGAGGGAGG - Intergenic
1061281686 9:129601350-129601372 CAGAGGGGGAAGAAGGAGAGAGG + Intergenic
1061287670 9:129633368-129633390 CAGAGAGGGAACATGGAGGGAGG - Intronic
1061339219 9:129965790-129965812 GAGGGAGGGGGGAAGGAGGGAGG + Intronic
1061360239 9:130136959-130136981 GACAGAAGGGAGTTGGAGGGAGG + Exonic
1061360456 9:130138550-130138572 CAGAGAAGGGAAGAGGAGGGAGG - Exonic
1061369140 9:130188004-130188026 CAAAGTGGGGAGATGGGGGGTGG + Intronic
1061614111 9:131768127-131768149 CACAGAGGGAAGACGAGGGGAGG - Intergenic
1061838836 9:133346201-133346223 GACTGAGGGGAGAAGTGGGGGGG - Intronic
1061913532 9:133737614-133737636 CACAGTCGGAAGGAGGAGGGAGG - Intronic
1061942546 9:133891394-133891416 GATGGAGGGGAGATGGAGGGGGG + Intronic
1061942579 9:133891493-133891515 CAGATAGAGGAGAAGGATGGAGG + Intronic
1061954641 9:133955420-133955442 GAGAGTGGGGAGAAGCAGGGGGG - Intronic
1061963312 9:133998956-133998978 GAGGGATGGGAGAAGGAGGGAGG - Intergenic
1061969828 9:134038938-134038960 CAAAAAGGAGAGAGGGAGGGAGG + Intronic
1062050580 9:134444586-134444608 GGCGGAGGGGGGAAGGAGGGAGG - Intergenic
1062095267 9:134699875-134699897 CACAGAGGTGAGAAGGCAGTCGG - Intronic
1062150022 9:135013380-135013402 CACAGAGAGGAGACGGAGATAGG - Intergenic
1062451103 9:136616181-136616203 GGCAGAGGGGAGACGGAGGAGGG - Intergenic
1062588675 9:137263354-137263376 GGGAGAAGGGAGAAGGAGGGAGG - Intronic
1062680738 9:137778546-137778568 GACAGAGGGGAGATCCAGGGAGG - Intronic
1062689536 9:137834164-137834186 CACAGCGAGGAGAAGGCTGGCGG + Intronic
1062744694 9:138203728-138203750 GACAAGGGGGAGAAGGAGTGGGG + Intergenic
1203450044 Un_GL000219v1:103717-103739 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1185604820 X:1362537-1362559 CAGAGAGGGGAGACAGAGAGAGG - Intronic
1185688311 X:1948389-1948411 GGGAGAGGGGAGGAGGAGGGAGG + Intergenic
1185688589 X:2133911-2133933 GGGAGAGGGGAGGAGGAGGGAGG + Intergenic
1185809541 X:3093408-3093430 CCAAAAGGGGAGAAGGAAGGTGG - Intronic
1185918915 X:4067246-4067268 GAGAGAGGGGGGAGGGAGGGAGG - Intergenic
1186201406 X:7158605-7158627 CACAGCAGGGGGAATGAGGGAGG + Intergenic
1186326688 X:8485504-8485526 CACAGAACGGAGCAGGAGTGTGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187552957 X:20324205-20324227 GAGAGAGAAGAGAAGGAGGGAGG - Intergenic
1187595469 X:20767021-20767043 CATAGAGCTGAGAAGAAGGGTGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882869 X:23862838-23862860 AAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187896930 X:23990772-23990794 GAAAGAGAGGAGAAGGAAGGGGG - Intronic
1188004855 X:25010226-25010248 AACAGAGGGAAGAGGGAGGGAGG - Intronic
1188026562 X:25216328-25216350 GAAAGGGGGGAGAAGGAGGAAGG - Intergenic
1188221029 X:27541834-27541856 GACAAGGGAGAGAAGGAGGGAGG - Intergenic
1188277291 X:28216014-28216036 GAGGGAGGGGGGAAGGAGGGAGG - Intergenic
1188590865 X:31833334-31833356 GAGAGAGTGGAGAGGGAGGGAGG + Intronic
1188969132 X:36591686-36591708 ATCAGAGGGTAGAAGGTGGGAGG - Intergenic
1189330065 X:40138936-40138958 CACAGATGGGGGAAGTAAGGTGG + Intronic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1190002724 X:46705151-46705173 CACACAGGGGAGAAAGGGGAAGG + Intronic
1190580871 X:51892592-51892614 CACACAGGGCAGGGGGAGGGTGG + Intronic
1190585138 X:51932376-51932398 CACACAGGGCAGGGGGAGGGTGG + Intergenic
1190732958 X:53236592-53236614 GACAGAGGGAGGGAGGAGGGAGG - Intronic
1190871634 X:54429736-54429758 TACAGATGGGAGAAGGTGAGAGG - Intergenic
1191754269 X:64577237-64577259 CAGAGAGGGGACACGGGGGGTGG - Intergenic
1191865998 X:65704365-65704387 CACAGAGCAGAGAAAGAGGAAGG - Intronic
1192105816 X:68315270-68315292 AAGAGGGGGGAGAAGGAGGTAGG + Intronic
1192533642 X:71910791-71910813 AAAAGAGAGGAGGAGGAGGGGGG + Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1192779026 X:74275490-74275512 CAAAGAGTGGAGATGGAGGTCGG - Intergenic
1192787478 X:74349276-74349298 CACATAGGTGAGAAAGAGAGAGG + Intergenic
1193119069 X:77804895-77804917 GTGAGAGGGTAGAAGGAGGGAGG - Intergenic
1193239094 X:79144862-79144884 AATACAGGAGAGAAGGAGGGAGG - Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1193964368 X:87966578-87966600 CTCATAAGGGAGAAGGTGGGAGG + Intergenic
1194597339 X:95874665-95874687 CTCAGAAGGGAGAGGGTGGGAGG + Intergenic
1194698050 X:97080172-97080194 AAGAGAGGAAAGAAGGAGGGAGG - Intronic
1194969457 X:100326886-100326908 CTCAGAGGGGAGAATCAGAGGGG - Intronic
1195163868 X:102198243-102198265 CACAGAGGGTTGGTGGAGGGAGG - Intergenic
1195194993 X:102488852-102488874 CACAGAGGGTTGGTGGAGGGAGG + Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195296260 X:103481135-103481157 CACAGGGGTGGGAAAGAGGGAGG - Intergenic
1196044065 X:111238034-111238056 ATTAGAGGGGAGAGGGAGGGAGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196616169 X:117769304-117769326 CACAGCGGGGGGCAGGGGGGGGG - Intergenic
1196738390 X:119001215-119001237 GAGAGAGGAGAGAGGGAGGGAGG + Intronic
1196910567 X:120480701-120480723 TACAGAGGGCAGAAGGAAGAAGG - Intergenic
1197107250 X:122731550-122731572 CACAGCGAGGAAAAGCAGGGTGG + Intergenic
1197308284 X:124871148-124871170 CAAACAGGGGAGGAGGAAGGGGG - Intronic
1197311626 X:124912421-124912443 GAGAGAGGGGATAAGGAGAGAGG + Intronic
1197707727 X:129646548-129646570 CGGAGAGGGGAGAAGAAGGAAGG - Exonic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197782252 X:130170939-130170961 CACAGAGGCTAGGAGAAGGGGGG - Intergenic
1197847949 X:130823723-130823745 CAGAGAGGGAAGAGGGAGTGAGG - Intronic
1198189292 X:134286700-134286722 CAAAGAGGGGAGAGGGGGAGGGG + Intergenic
1198223088 X:134621038-134621060 AGGAGAGGGGAGAAGGAAGGAGG - Intronic
1198518781 X:137432022-137432044 GAAAGAGGAGGGAAGGAGGGAGG + Intergenic
1198808319 X:140510129-140510151 CAAAGACGGGTGTAGGAGGGGGG - Intergenic
1199512700 X:148640391-148640413 CACAGAAGCCAGAGGGAGGGAGG - Intronic
1199799118 X:151231945-151231967 AACAGAGGGGAAAAAGAGGAGGG - Intergenic
1199871205 X:151900453-151900475 GACAGAGAGGAGAAGCTGGGAGG + Intergenic
1200093471 X:153646761-153646783 CACGGAGGGGAGGAGGAGGCAGG - Intronic
1200243760 X:154511810-154511832 CACAAAGGGGAGGAGCAGGGAGG + Intronic
1201576424 Y:15466097-15466119 CACAGCAGGGCGAATGAGGGAGG + Intergenic
1201741213 Y:17326084-17326106 GAGAGAGGGAAGAAGGAGAGAGG + Intergenic