ID: 1036978007

View in Genome Browser
Species Human (GRCh38)
Location 8:13436443-13436465
Sequence TGAAAACGGGTCAGTCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036978007_1036978010 20 Left 1036978007 8:13436443-13436465 CCAAAAGGACTGACCCGTTTTCA 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1036978010 8:13436486-13436508 TCCAGACTTGTCTATAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036978007 Original CRISPR TGAAAACGGGTCAGTCCTTT TGG (reversed) Intronic
906275852 1:44514973-44514995 TGAAAATGGGTCAGTCATGGGGG + Intronic
908524515 1:64975256-64975278 TGAAAGCTGGTCAGTTCTTTTGG - Intergenic
909110940 1:71476608-71476630 TGAAAACAGATCAGCCATTTAGG + Intronic
913610761 1:120507672-120507694 TGAAAAAGGGTCTGTTGTTTTGG - Intergenic
914580429 1:149014567-149014589 TGAAAAAGGGTCTGTTGTTTTGG + Intronic
915181253 1:154062319-154062341 TGAGAAAGGGATAGTCCTTTGGG + Intronic
920285926 1:204879670-204879692 TGAAAACAGGGCAGTTCTTTTGG + Intronic
921713507 1:218396026-218396048 TGAAATCAGGTCATTCTTTTTGG + Intronic
923280672 1:232440143-232440165 TGAAAAAGAGTCAATGCTTTTGG + Intronic
1065441953 10:25762149-25762171 TGAAAACAGGTGGGACCTTTGGG + Intergenic
1067404284 10:46007008-46007030 TGAAAGCTGGGCAGGCCTTTTGG + Intronic
1071254506 10:83858439-83858461 TGATAATGGGTCAGTTCTTCAGG - Intergenic
1073125584 10:101146851-101146873 TGAAAAGGGCTGGGTCCTTTGGG + Intergenic
1076203770 10:128578837-128578859 TGAAAATGCGTCAGGCCTGTAGG + Intergenic
1084944996 11:72633562-72633584 TGAAAACTGGTCAGACCATCAGG - Intronic
1096575642 12:52551193-52551215 AGAAGACGGGTAAATCCTTTCGG - Intronic
1098196828 12:68011046-68011068 TGTAAATGGATCAGTCCATTTGG + Intergenic
1098665652 12:73159603-73159625 TGGTTACTGGTCAGTCCTTTAGG + Intergenic
1105631522 13:22174298-22174320 TGAGAACAGGTCAGTCAGTTGGG + Intergenic
1108859992 13:54844501-54844523 TGAGAACGTCTTAGTCCTTTAGG - Intergenic
1109260111 13:60135324-60135346 TGAAAACAGATCAAGCCTTTAGG - Intronic
1109688107 13:65846987-65847009 TGAAAACATGACAGTCCTTGAGG - Intergenic
1112978337 13:105349052-105349074 TGAAAAGGGTTCAGTCCCCTAGG + Intergenic
1113312724 13:109147850-109147872 TCCAAACGAGTAAGTCCTTTGGG + Intronic
1116984686 14:51206127-51206149 TGAAGAGGGGACAGTCCTGTGGG - Intergenic
1121639571 14:95476012-95476034 TGAAAACAGGTCTGGCCTCTGGG + Intergenic
1125481462 15:40083813-40083835 TGAAAATGGTCCTGTCCTTTTGG - Intergenic
1128074333 15:64816818-64816840 TGGTAAAGGGTCAGGCCTTTCGG - Intronic
1130932765 15:88441562-88441584 TGAAAACATGCCTGTCCTTTTGG + Intergenic
1133090748 16:3401954-3401976 TGTAAACGGGTTAAGCCTTTGGG - Exonic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1145275900 17:21430182-21430204 TGGCAACGGGTCAGTGCTTGTGG + Intergenic
1145313747 17:21716095-21716117 TGGCAACGGGTCAGTGCTTGTGG + Intergenic
1150960790 17:69910230-69910252 TGAAAATGGGACAGGCCTTTTGG - Intergenic
1155960187 18:31987926-31987948 TGAAAACTATTCAGTCCTTGAGG + Intergenic
1156394400 18:36685426-36685448 TGATAAAAGGTCAGTCATTTGGG - Intronic
1161325263 19:3660617-3660639 TGAAAATGGGTCAGTCACTTTGG + Intronic
1162000202 19:7739758-7739780 TGAAGCAGGGTCAGTCTTTTGGG - Intergenic
1162127459 19:8507090-8507112 TGATGACTGGTGAGTCCTTTGGG - Intergenic
1162958258 19:14111898-14111920 GGAAAACGGACCAGACCTTTTGG - Intronic
1163577148 19:18117672-18117694 TGAGAAGGGGTCAGTGCTCTGGG + Intronic
1164453385 19:28386034-28386056 TGAAATAGGGTCAGTTCTCTGGG - Intergenic
1164624386 19:29716490-29716512 TGGAAAAGGGTCCGTCCTCTGGG - Intergenic
1168489533 19:56796550-56796572 GGAGAGCGGGTCAGTCCTCTAGG + Intronic
926961571 2:18363762-18363784 TGAAAGGGGGTCATTCCTATGGG + Intergenic
928459668 2:31458589-31458611 TGAGAACGTGTCTTTCCTTTTGG - Intergenic
930525742 2:52527121-52527143 GGAAAATGGATCAGTGCTTTGGG + Intergenic
935896386 2:107742406-107742428 TGAAAAGGGGTTAGGCCTTAAGG - Intergenic
938683488 2:133715135-133715157 TGAAAACTGAACAGTCCTTCTGG + Intergenic
943041353 2:182809090-182809112 TGAAAAGGGTTCATTGCTTTTGG + Intergenic
943347468 2:186756729-186756751 TGAAATGGGGGCAGTCCTATGGG - Intronic
944824746 2:203470837-203470859 TGAAAACAGGTGTGTCCATTAGG - Intronic
947581260 2:231320327-231320349 TGCAAATGGGTCAGCCCTTTGGG - Intronic
948071037 2:235125709-235125731 TGAAAACAGGCTAATCCTTTGGG + Intergenic
1169137928 20:3209025-3209047 TGAAAACGGGTGAGAAGTTTGGG + Intronic
1169166800 20:3431102-3431124 TAAAATTTGGTCAGTCCTTTAGG + Intergenic
1172059799 20:32179533-32179555 TGGAAACGGTTTAATCCTTTTGG + Intergenic
1172087672 20:32400379-32400401 TGAAAACCGTTGATTCCTTTAGG + Intronic
1183733221 22:39629751-39629773 TGAAAGGGGGTCAGGCCTGTGGG - Intronic
950096266 3:10332593-10332615 TGAAAAGGAGTCAGTCCTCCAGG - Intronic
954520548 3:51221806-51221828 TGATGACGGGTCTCTCCTTTAGG - Intronic
960419538 3:117426832-117426854 TGAAAACAGTTAAGTCCTTAAGG + Intergenic
961039963 3:123671337-123671359 TGAAGATGGGTCAATTCTTTGGG + Intronic
962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG + Intergenic
965439320 3:168692907-168692929 TGAAAACAGGTAAGTACTTGAGG + Intergenic
971057329 4:22928105-22928127 AGGAAAAGGGTGAGTCCTTTAGG - Intergenic
971340950 4:25768378-25768400 TGAAAAGTGGTCACTCATTTTGG - Intronic
974326339 4:60419444-60419466 GGAAAACTGGTCAGCCATTTGGG - Intergenic
974963903 4:68736471-68736493 TGAAAAAGAGTCAGTCCCTAAGG - Intergenic
979365972 4:119824095-119824117 TGAAAATGTGTCACTCCTCTTGG + Intergenic
982171357 4:152664899-152664921 TGAAAAGGAGTCAGGCTTTTGGG - Intronic
987703062 5:21426737-21426759 TCTTAACGGGTAAGTCCTTTTGG - Intergenic
990094386 5:52093977-52093999 TGATAAAGGGTCAATCCATTAGG + Intergenic
991597174 5:68317478-68317500 TGAGAAAGAGTCAGTTCTTTTGG - Intergenic
993007263 5:82442079-82442101 TGAAAAAGGGTTGGCCCTTTGGG - Intergenic
997263831 5:132483498-132483520 TGAAAAGGGGGTAGTTCTTTGGG + Exonic
998900852 5:146852473-146852495 TGATAACGGGGCTTTCCTTTTGG - Intronic
1003562824 6:7197423-7197445 TGAAGATGGGCCAGTACTTTGGG + Intronic
1004638659 6:17492846-17492868 GGAAAATGGGTCTTTCCTTTGGG - Intronic
1009297018 6:61963982-61964004 TTAAAACTGGTCATTCCTTTGGG - Intronic
1010533963 6:77002732-77002754 GGAAAAGGGGTTAGGCCTTTGGG - Intergenic
1010987395 6:82440508-82440530 TGAAAACAGGTCAGGCTTGTGGG - Intergenic
1014215373 6:118747803-118747825 TGATATTGGGTGAGTCCTTTGGG - Intergenic
1016617127 6:146063657-146063679 TGAAAACAGGTCATTTCTTAAGG + Intronic
1017900420 6:158714625-158714647 TGAAAAGGAGTCTGTCCTCTGGG - Intronic
1021621031 7:22551182-22551204 TGTAAAAGGGTTAGCCCTTTTGG - Intronic
1022446600 7:30475922-30475944 AGAAACCAGGTCAGACCTTTTGG + Intronic
1023375710 7:39552954-39552976 TGAAATAGGGGCAGTCTTTTGGG + Intergenic
1023969281 7:44979210-44979232 TGCAAACGGGTCAGACCGTTAGG - Intergenic
1027930644 7:84529887-84529909 TGAAAACAGGTCTGTCCTTGAGG + Intergenic
1031219559 7:118947092-118947114 TGAAAACCTCTCATTCCTTTTGG - Intergenic
1032095145 7:128934454-128934476 TGAAATCGGGTGAGGCCTTGAGG - Intergenic
1035567082 8:648625-648647 TGAACACGGGGCTGTCCTGTGGG + Intronic
1035926168 8:3730085-3730107 TGCAAACGGGAAAGTTCTTTTGG - Intronic
1036978007 8:13436443-13436465 TGAAAACGGGTCAGTCCTTTTGG - Intronic
1037084305 8:14828198-14828220 TGTAAACTGGTCATTTCTTTGGG - Intronic
1039017698 8:33170728-33170750 TGGACACTGGTCAGTCTTTTAGG - Intergenic
1040662883 8:49596220-49596242 TGAAAACTGTTCAGTCTCTTTGG + Intergenic
1045158920 8:99514112-99514134 TGAAAACAAGTCAGTCATGTAGG - Intronic
1189445906 X:41081337-41081359 TCAAAAGGGGACAGTCCTGTAGG + Intergenic
1195446353 X:104957111-104957133 TAAAAACTGGACAGTCCTTTTGG + Intronic
1196978788 X:121188723-121188745 AGAAAATGGCTCAGTCCTTCAGG + Intergenic