ID: 1036980318

View in Genome Browser
Species Human (GRCh38)
Location 8:13462699-13462721
Sequence AAGAATAAGAATAGTAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1700
Summary {0: 1, 1: 1, 2: 22, 3: 223, 4: 1453}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036980318 Original CRISPR AAGAATAAGAATAGTAGGCC GGG (reversed) Intronic
900016816 1:156954-156976 AAAAATAAAAATAATTGGCCAGG + Intergenic
900047076 1:515546-515568 AAAAATAAAAATAATTGGCCAGG + Intergenic
900069280 1:757261-757283 AAAAATAAAAATAATTGGCCAGG + Intergenic
900235867 1:1590150-1590172 AGAAATAAGAAACGTAGGCCGGG + Intergenic
900253549 1:1684458-1684480 GAAATTAAGAATAGGAGGCCGGG + Intronic
900295089 1:1944899-1944921 AATAAAAAGAATATTTGGCCGGG - Intronic
900860514 1:5226036-5226058 AAGAATTAGAATTGAAGGCCAGG - Intergenic
901424922 1:9176206-9176228 AAAAATAATAATTTTAGGCCGGG - Intergenic
901443092 1:9291565-9291587 AATAATAATAATAATTGGCCGGG - Intergenic
901552647 1:10007240-10007262 AAAAATAAAAACTGTAGGCCAGG - Intronic
901556000 1:10032181-10032203 AAGAATACAAATATTTGGCCGGG - Intergenic
901571839 1:10167142-10167164 AACAATAATAATAGAGGGCCGGG + Intronic
901583375 1:10264954-10264976 AAGAAAAAGAAAAAAAGGCCGGG - Intronic
901609667 1:10487776-10487798 AAAAACAAAAAAAGTAGGCCGGG - Intronic
901619120 1:10567788-10567810 AAAAATAAGAAAATTAGGCCAGG - Intronic
901620701 1:10583872-10583894 AGGAACAAGAATGGTAGGCCAGG + Intronic
901890488 1:12259302-12259324 AAAAATAAAAAGAGTAGGCTGGG - Intronic
901910816 1:12456340-12456362 AAGAATACAAAAATTAGGCCAGG + Intronic
902005340 1:13227428-13227450 AAAAATAATAATAATAGGCCTGG + Intergenic
902316460 1:15623552-15623574 AATAATAATAATAATAAGCCAGG - Intronic
902396794 1:16136322-16136344 AATAATAATAATAAAAGGCCAGG + Intronic
902406391 1:16185992-16186014 AAGAAAAAGAAAAAGAGGCCAGG - Intergenic
902515894 1:16989504-16989526 AAAAATAATAATTGTAGGCTGGG - Intronic
902516640 1:16993210-16993232 AAAAATAATAATGATAGGCCAGG - Intronic
902910617 1:19594346-19594368 AAGAATAGGAAAAATAGGGCTGG + Intergenic
903357251 1:22755805-22755827 AATAATAATAATAGTATGACTGG - Intronic
903400544 1:23042745-23042767 CAAAATAATAATAATAGGCCGGG - Intronic
903411434 1:23146800-23146822 AAAAATAATAATAATAGGCTGGG + Intronic
903423538 1:23236182-23236204 AAAAATAATAATAATAGGCCGGG - Intergenic
903512415 1:23886198-23886220 AAAAAAAAGAATAATATGCCTGG + Intronic
903669332 1:25026147-25026169 AATAATAATAGTAATAGGCCAGG + Intergenic
903688901 1:25155781-25155803 AAAAAAAAGAAAAATAGGCCAGG + Intergenic
903785395 1:25857870-25857892 AACAATAATAATAATATGCCGGG + Intronic
903789527 1:25883080-25883102 AAAAATAATAATAATAGGGCCGG + Intergenic
903805425 1:26002021-26002043 AAGAAAAAGAATTTTAGGCCGGG + Intergenic
903883227 1:26526540-26526562 AATAATAATAATAATAGGCCAGG + Intergenic
903937282 1:26905131-26905153 AATAATAATAATAATAGGCCAGG - Intronic
903939197 1:26917263-26917285 AATAATAATAATAATAGGGCTGG + Intronic
903979112 1:27172501-27172523 AAAAATAAAAATAACAGGCCAGG + Intergenic
903982915 1:27202878-27202900 AAAAATAAGAATAATGGGCTGGG + Intergenic
904075393 1:27837914-27837936 AAAAATACAAAAAGTAGGCCAGG + Intronic
904176456 1:28633155-28633177 AAAAAAAAAAAAAGTAGGCCGGG - Intronic
904519282 1:31081997-31082019 AAAAAAAAGGATAGGAGGCCAGG + Intergenic
904587346 1:31587611-31587633 AAGAATAAGAATACAGGGCTGGG - Exonic
904685904 1:32260304-32260326 AAAAATAAAAATAAAAGGCCAGG - Intronic
904918659 1:33988556-33988578 CAAAATAATAATAGTAGACCTGG - Intronic
905102240 1:35534562-35534584 AAGAATAACAATCGGTGGCCGGG + Intronic
905139205 1:35828038-35828060 AAGAATTACAACAGTAGGCTGGG - Intronic
905163331 1:36057033-36057055 AAGAAAAAGAATAGTAGGCCGGG - Exonic
905218161 1:36424875-36424897 AAGAATAAGTATCTTAGGCTGGG + Intronic
905406832 1:37739367-37739389 AGAAAGTAGAATAGTAGGCCAGG + Intronic
905687284 1:39917662-39917684 GAAAATAAGAATTGTTGGCCGGG - Intergenic
905819455 1:40978805-40978827 AAAAATAATAATAGTAGGCCGGG - Intergenic
905830359 1:41060980-41061002 AAGATTAAGGAAAATAGGCCAGG - Intronic
905981844 1:42235845-42235867 AAAAATCAGAAAACTAGGCCTGG - Intronic
906270495 1:44474077-44474099 AAAAATAATAATAATAGACCGGG + Intronic
906270544 1:44474409-44474431 AATAATAATAATAATAGGCTGGG + Intronic
906350033 1:45050788-45050810 AAGAACCAGAAGAGTAGACCAGG + Intronic
906386430 1:45372741-45372763 AAAAAAAAGAAAAGAAGGCCAGG + Intronic
906485807 1:46233916-46233938 AAGAAAAAAAACAATAGGCCAGG - Intergenic
906765122 1:48423159-48423181 AAAAGTCAGAAAAGTAGGCCGGG + Intronic
907134761 1:52129784-52129806 TAAAATAACAATAGTTGGCCGGG + Intergenic
907135461 1:52135978-52136000 AAAAATAATAATAATAGGCCGGG + Intergenic
907156567 1:52340602-52340624 ACTAATAAGAAAACTAGGCCAGG + Intronic
907178248 1:52545824-52545846 AATAATAATAATAATAGGCCAGG + Intronic
907198425 1:52705861-52705883 AATAATAATAATTTTAGGCCGGG - Intergenic
907204880 1:52760751-52760773 AAAAAAAAAAAAAGTAGGCCAGG - Intronic
907208691 1:52799190-52799212 AAGAATGAAAAAAATAGGCCGGG + Intronic
907296264 1:53457506-53457528 AAAAATATGATTAGTGGGCCGGG - Intergenic
907339267 1:53722835-53722857 AAAAAAAAAAAGAGTAGGCCAGG + Intronic
908244963 1:62220602-62220624 AAGAATATGAAAAGTAGGCCGGG + Intergenic
908744582 1:67363194-67363216 AAAAATAAGAATAATTGGCCAGG - Intronic
908744630 1:67363509-67363531 AAGAATAAGAATAATTGGCCGGG - Intronic
908756221 1:67471123-67471145 AAAAATAATAATAATTGGCCAGG - Intergenic
908840883 1:68278980-68279002 AAGAAAGAAAAAAGTAGGCCGGG + Intergenic
908950893 1:69561632-69561654 AAAAAAAAAAATAATAGGCCGGG + Intergenic
909095475 1:71281912-71281934 AAGAATAATAATTTTTGGCCGGG - Intergenic
909131649 1:71744361-71744383 AATAATAATAATAATAAGCCAGG + Intronic
909168056 1:72254405-72254427 AAGAAAAAGCATATTAGGCCAGG + Intronic
909891315 1:81010924-81010946 TAGAATAAGAATAGAAGGCCGGG + Intergenic
910150327 1:84134653-84134675 AAGAAGAAGAAAAATAGGACGGG + Intronic
910580063 1:88814631-88814653 AAGACTAAGAGTAGCAGGCCTGG - Intronic
911055787 1:93707412-93707434 TAAAATAATAATAATAGGCCGGG + Intronic
911165121 1:94718051-94718073 AAGAATATTAATTGCAGGCCAGG - Intergenic
911168906 1:94750275-94750297 AAGGAAAAGAAAAGAAGGCCCGG + Intergenic
911462415 1:98207096-98207118 AAGAAGGAGAAGAGCAGGCCAGG - Intergenic
911532661 1:99063988-99064010 AAGAAAAGGGATAGGAGGCCAGG - Intergenic
911632220 1:100195958-100195980 AAGATTAACAAAATTAGGCCGGG - Exonic
911866694 1:103034852-103034874 AAGAAAAATAACAGTAGGCCTGG - Intronic
912133478 1:106630710-106630732 GAGTATAAGAAATGTAGGCCAGG + Intergenic
912277785 1:108278752-108278774 AAAAGTAAGAAGAGTCGGCCGGG + Intergenic
912290441 1:108415607-108415629 AAAAGTAAGAAGAGTCGGCCGGG - Intronic
912302821 1:108535387-108535409 ATGAATGAGAATAGTTGGCTGGG - Intergenic
912332106 1:108829473-108829495 ATAAATAAAAATAGTAGGCCTGG + Intronic
912766219 1:112414068-112414090 AAGAAAAAGAAAAAAAGGCCAGG + Intronic
912792066 1:112662267-112662289 AAAAATAAAAAAAGTTGGCCAGG - Intronic
912823283 1:112884226-112884248 AAGAAAAAGAAAAGCGGGCCAGG + Intergenic
912846109 1:113075995-113076017 AAAAAAAAAAAAAGTAGGCCAGG - Intronic
912988017 1:114454388-114454410 AATAAGAAAAAAAGTAGGCCAGG + Intronic
913251402 1:116914591-116914613 AAAAATAAGAAAAGTTAGCCGGG + Intronic
913970603 1:143412829-143412851 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914064979 1:144238440-144238462 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
914114172 1:144727914-144727936 AAAAAAAAGAAAAGTTGGCCGGG + Intergenic
914194145 1:145436076-145436098 AATAATAATAATAATAGGCTGGG - Intergenic
914475477 1:148018959-148018981 AATAATAATAATAATAGGCTGGG - Intergenic
914708236 1:150189084-150189106 AAAAATAAGAATAATCGGGCCGG + Intergenic
914857254 1:151361839-151361861 AAAAAAAAGAATTGTAGGCAGGG + Intergenic
914860196 1:151379560-151379582 AAAAAAAAAAAAAGTAGGCCGGG + Intergenic
915198669 1:154209883-154209905 AAAAATAAAAAAATTAGGCCAGG - Intronic
915247553 1:154567540-154567562 AAGAGTAAGACAAGTAGGTCAGG - Intergenic
915373272 1:155370060-155370082 AAAAATAATGATAATAGGCCGGG - Intronic
915394085 1:155568819-155568841 AAGAAAAAGAAAAAAAGGCCGGG - Intergenic
915451100 1:156005890-156005912 AAGAATATAAAAATTAGGCCAGG + Intronic
915663319 1:157421966-157421988 AAGAGAAATAAAAGTAGGCCAGG + Intergenic
916081017 1:161232279-161232301 AAAAATAATAATAATAGGCCAGG - Intronic
916242070 1:162650298-162650320 AATAATAATAATAACAGGCCAGG + Intronic
916245775 1:162686871-162686893 AAAAACAAGAATGATAGGCCAGG - Intronic
916523981 1:165591804-165591826 AATAATAATAATAATTGGCCAGG - Intergenic
917212628 1:172645801-172645823 AAAAATAAAAATAGGAGGCATGG + Intergenic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
917952771 1:180057394-180057416 TAGAAAAAGAAAAGTAGGCCAGG - Intronic
917989299 1:180356465-180356487 AAAAATAATAACAATAGGCCGGG - Intronic
918360894 1:183756738-183756760 AAGAAGAAGACTAAGAGGCCTGG - Intronic
918435357 1:184505465-184505487 AAGTTTATTAATAGTAGGCCAGG + Intronic
918522942 1:185434737-185434759 GAGAAAAAGAATAACAGGCCAGG - Intergenic
918628457 1:186685786-186685808 TAAAATAAGAAAAATAGGCCAGG - Intergenic
919485849 1:198146278-198146300 AAGAATAAGATATATAGGCCGGG - Intergenic
919700211 1:200623859-200623881 AAGAAAAAGAAAATTAGGGCCGG - Intergenic
919711889 1:200737418-200737440 AAAAATAATAATAATAGGCTGGG + Intergenic
920337181 1:205252823-205252845 AAGAGAAAGAAAAGTAGGCCAGG + Intronic
920402079 1:205682134-205682156 TATAATAATAATAGTTGGCCAGG + Intergenic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
921347021 1:214196852-214196874 AACAATAAGAAAAATAGGCCGGG + Intergenic
921673551 1:217952326-217952348 AAAAAAAAAAATACTAGGCCAGG + Intergenic
921850047 1:219925236-219925258 AAGAATGAGGATAGTTGGCCGGG + Intronic
922047797 1:221963621-221963643 AAGAAAAAGAAAAGTTGGCCAGG + Intergenic
922104643 1:222502656-222502678 AAAAATAAAAATAATTGGCCAGG + Intergenic
922264957 1:223975169-223975191 AAAAATAAAAATAATTGGCCAGG + Intergenic
922638549 1:227202624-227202646 AAAAATAAAAATAATAGGCCAGG + Intronic
922984630 1:229856689-229856711 TAGAATAAGAAATATAGGCCAGG + Intergenic
923023259 1:230183680-230183702 AAGAATAAGAAAAATAGGCGAGG + Intronic
923051476 1:230393834-230393856 AAAAAAAAAAATAATAGGCCCGG + Intronic
923227839 1:231955783-231955805 AAGAAAAAGAAAAGTTGGCTGGG - Intronic
923450524 1:234112868-234112890 AAGAATGTGAATTATAGGCCGGG - Intronic
923593210 1:235338866-235338888 AAAAATAATAATAATAGGCCGGG + Intronic
923768028 1:236910959-236910981 AATAATAATAATAATAGGCCAGG - Intergenic
923902830 1:238347687-238347709 AAGAATTTGAAAACTAGGCCAGG + Intergenic
924346815 1:243080183-243080205 AAAAATAAAAATAATTGGCCAGG + Intergenic
924410401 1:243798533-243798555 AAGAACATAAATAGAAGGCCTGG - Intronic
924549863 1:245065346-245065368 AAAAATAAGAATATTAGGCTGGG - Intronic
924730365 1:246705929-246705951 AAGAATATGTATAGTGAGCCAGG + Intergenic
1063346930 10:5320378-5320400 GATAATAAGAATAGTTGACCGGG + Intergenic
1063554448 10:7064980-7065002 AAGAAAAATAATAGTAGCCGAGG + Intergenic
1063698332 10:8359410-8359432 AAAAATAAGAATAATAGGCCAGG + Intergenic
1063705035 10:8422378-8422400 AAGAATAATAATAATAGGCCGGG - Intergenic
1064042897 10:11983665-11983687 AAAAATAAGAATCCAAGGCCGGG - Intronic
1064135537 10:12747464-12747486 AAAAATAAAAATAATTGGCCAGG - Intronic
1064199910 10:13275641-13275663 AAAAAAAAAAAAAGTAGGCCGGG + Intergenic
1064210588 10:13357595-13357617 AAAAGAAAGAAAAGTAGGCCGGG - Intergenic
1064298114 10:14096837-14096859 AAGAACAAAAAAAGCAGGCCGGG + Intronic
1064493976 10:15888253-15888275 AATAATAATAATAATTGGCCAGG - Intergenic
1064605070 10:17030621-17030643 AAGAATAAGCATTGTTGGTCGGG + Intronic
1064716054 10:18177630-18177652 AAGAAAAAGAAAAGGAGGACAGG + Intronic
1064750625 10:18524727-18524749 AAGAAAAAGTATAGTAGGCTGGG + Intronic
1064756881 10:18579463-18579485 ATGAATAAAAATATGAGGCCGGG - Intronic
1064848957 10:19688264-19688286 GATAATAATAATAATAGGCCGGG - Intronic
1065028735 10:21564105-21564127 AAAAATAATAATAATAGGCCGGG - Intronic
1065103928 10:22360504-22360526 TAGAATAAGAAAAATAGGCAAGG + Intronic
1065164334 10:22959016-22959038 ATTAATAATAATAATAGGCCGGG - Intronic
1065181815 10:23133832-23133854 AAAAAAAAGAATAGTGGGCATGG + Intergenic
1065183023 10:23145788-23145810 AAGAATTATGATAGTTGGCCGGG - Intergenic
1065296580 10:24281763-24281785 AAGAGTAACAATAATCGGCCGGG + Intronic
1065494895 10:26317898-26317920 AAGAGTAAGAACAAGAGGCCGGG - Intergenic
1065513982 10:26506630-26506652 ACAAATAAGTAAAGTAGGCCAGG - Intronic
1065516408 10:26528373-26528395 AAGAATAAGAATAGATTTCCAGG - Intronic
1065823087 10:29544457-29544479 ATGAATAGGAATAGTCTGCCAGG + Intronic
1065859138 10:29856244-29856266 AAGAATGAGAAAATTTGGCCAGG - Intergenic
1065869454 10:29943894-29943916 AATAATAATAATAATAGGCCAGG + Intergenic
1065932266 10:30490441-30490463 AAAAATAAAAATAGAAGGCTGGG + Intergenic
1066088784 10:31997201-31997223 AAAAATAAGAAATCTAGGCCAGG - Intergenic
1066674598 10:37874934-37874956 AATAATAATAATAATAAGCCGGG - Intergenic
1066729531 10:38424679-38424701 AAAAATAAAAATAATTGGCCAGG - Intergenic
1068045734 10:51884149-51884171 AATTATAAGAAAAGTTGGCCGGG + Intronic
1068965264 10:62905568-62905590 GAAAATAAGAAAAGTTGGCCAGG + Intronic
1069381991 10:67850776-67850798 AATAAGAAGTATAATAGGCCGGG + Intergenic
1069385307 10:67878679-67878701 AAAAATAATAATAATTGGCCAGG + Intergenic
1069449871 10:68508416-68508438 AAAAAAAAGAATTCTAGGCCAGG + Intronic
1069450585 10:68514199-68514221 AATAGTAATAATAATAGGCCGGG + Intronic
1069882805 10:71604119-71604141 AACAATAATAATGGAAGGCCAGG + Intronic
1070082753 10:73205105-73205127 AAAACTAAGAATAATTGGCCAGG - Intronic
1070188749 10:74092200-74092222 AAAAATAAAAATAATAGGCCAGG - Intronic
1070223932 10:74480579-74480601 AAGAATAAGAAAATTAGGCTAGG - Intronic
1070623496 10:78032168-78032190 AAAAAGAAAAATAGTCGGCCGGG + Intergenic
1070672827 10:78390033-78390055 ATGAGTAAGAAGAGTTGGCCTGG - Intergenic
1070957325 10:80473128-80473150 AATAATAAAAATAGTAAGCTTGG + Intronic
1071521916 10:86336837-86336859 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1071593924 10:86903899-86903921 AAAAATAAAAATAATAGGCCGGG - Intronic
1071699796 10:87918282-87918304 AACAATAAAAAAATTAGGCCAGG - Intronic
1071760642 10:88601846-88601868 AAGAATTGGAATAGTAAGACAGG + Intronic
1072179129 10:92962937-92962959 AAGAATAAGTATGGCAGGCAGGG - Intronic
1072568233 10:96635910-96635932 AAGAAAAAGAAAACTAGGCCGGG + Intronic
1072627882 10:97125541-97125563 AAAAAAAAAAAAAGTAGGCCGGG + Intronic
1072649640 10:97284664-97284686 AAAAATAAAAATAGTTAGCCAGG - Intronic
1072676856 10:97473329-97473351 AAGAATAGAAATTCTAGGCCGGG - Intronic
1072726338 10:97816382-97816404 AAGTATGAGAAAAGGAGGCCGGG + Intergenic
1072877297 10:99186247-99186269 AAGAATAAGAATTGCAGACCGGG + Intronic
1073145035 10:101275027-101275049 AATAATAATAATTATAGGCCAGG + Intergenic
1073223057 10:101892290-101892312 AATAATAATAATAATAAGCCAGG + Intronic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073560587 10:104493162-104493184 AGGAATAAGAGCAGAAGGCCTGG - Intergenic
1073705592 10:105980143-105980165 AAAAATAAGGAAAATAGGCCGGG - Intergenic
1073795600 10:106984686-106984708 ACAATTAAGAATGGTAGGCCAGG - Intronic
1073799028 10:107021215-107021237 AAGAATATGCATATTTGGCCAGG + Intronic
1073810151 10:107143797-107143819 AAAAATAGGAAAATTAGGCCGGG - Intronic
1074881229 10:117660981-117661003 AAAAATAAAAAAAATAGGCCAGG - Intergenic
1075039592 10:119097412-119097434 AACAATAAAAATAATAGGCCAGG + Intergenic
1075085456 10:119411573-119411595 AAGAAAAAGAATAGGAGGTTAGG + Intronic
1075092096 10:119449503-119449525 GAGAATATAAAGAGTAGGCCGGG + Intronic
1075118323 10:119645870-119645892 AAGAATAAGTACAGTTGGCCAGG - Intergenic
1075177639 10:120180829-120180851 AATAATAATAATAGTAGACTGGG - Intergenic
1075314683 10:121443158-121443180 AAAAATAATAGTAATAGGCCAGG + Intergenic
1075347959 10:121698095-121698117 AAAAATAAAAATAAAAGGCCAGG + Intergenic
1075381844 10:122025554-122025576 ATAAATAAAAATAATAGGCCGGG - Intronic
1075381893 10:122025868-122025890 AATAATAATAATAATAGGCCGGG - Intronic
1075978912 10:126720417-126720439 AAGGATATGAATAGTAGGAATGG + Intergenic
1076043619 10:127273103-127273125 AAGAATAAGAAAAGAAGGTGAGG - Intronic
1076094314 10:127718672-127718694 AAGAAAAAGAAAAATGGGCCGGG + Intergenic
1076633247 10:131865587-131865609 AATAATAATAATAATAGTCCCGG - Intergenic
1076745850 10:132513208-132513230 AAGAATATTAAGAATAGGCCGGG + Intergenic
1076932597 10:133543118-133543140 AAGAAAACCAGTAGTAGGCCGGG - Intronic
1076973405 11:152027-152049 AAAAATAAAAATAATTGGCCAGG + Intergenic
1077039739 11:514574-514596 AATAATAATAATAATAGGCTGGG - Intergenic
1077527116 11:3073703-3073725 AAGAAGAAGGATCGTTGGCCAGG - Intergenic
1077649502 11:3957550-3957572 ATTAATAATAATAATAGGCCAGG - Intronic
1077695816 11:4392269-4392291 AAGAATAAAAATAATGGGTCAGG + Intronic
1078049859 11:7954334-7954356 AAGATTAAGAATTGTTGGCTGGG + Intergenic
1078204556 11:9216873-9216895 AATAATAATAATAATAAGCCAGG + Intronic
1078221339 11:9353987-9354009 AAGAATACAAAAATTAGGCCGGG + Intergenic
1078226198 11:9393676-9393698 AAGAAAAAGGAAATTAGGCCTGG - Intronic
1078676861 11:13427222-13427244 AATAATAATAATAATAAGCCAGG + Intronic
1079041716 11:17065579-17065601 AAAAATAAAAAAATTAGGCCAGG - Intergenic
1079062988 11:17265858-17265880 ATAAATAAAAATAATAGGCCGGG + Intronic
1079875978 11:25857935-25857957 AATAATAATAATAATAAGCCGGG - Intergenic
1079910696 11:26306267-26306289 AAGAATAGGAAGAATAGGCCGGG - Intergenic
1079950223 11:26792763-26792785 GAAAATAAGATTATTAGGCCGGG - Intergenic
1080276264 11:30506337-30506359 AAAAATAACAGTAATAGGCCAGG - Intronic
1080526711 11:33129385-33129407 AAAAAAAAAAAAAGTAGGCCGGG - Intronic
1080537302 11:33234351-33234373 AAGAAAAAGAAAATTAGGCCGGG + Intergenic
1080625093 11:34021778-34021800 AAGAATAAGATATGTAGGCTGGG - Intergenic
1081151711 11:39640915-39640937 AAGAATGGAAATAGGAGGCCAGG + Intergenic
1081225845 11:40521573-40521595 CAGTATAAGAAAAATAGGCCAGG + Intronic
1081320369 11:41685079-41685101 AAGAATAAGAACTTTAGGCCAGG + Intergenic
1081818961 11:45972616-45972638 AAGAATACAAAAAGTAGACCAGG + Intronic
1082023938 11:47557510-47557532 AAAAAAAAGAAAAATAGGCCGGG - Intronic
1082080755 11:48010829-48010851 AATAATAATAATAATAGGCCAGG - Intronic
1082201023 11:49367592-49367614 AAGAGAAAGAATAGTAGGACAGG + Intergenic
1083157630 11:60834626-60834648 AAGAATAGAAAAATTAGGCCTGG + Intergenic
1083345150 11:61984318-61984340 AAAAATAAAAATAGTTAGCCAGG - Intergenic
1083455098 11:62773437-62773459 AAAAAAAAAAATTGTAGGCCGGG - Intronic
1083473621 11:62901124-62901146 AGGGATAAGAATGCTAGGCCAGG + Intergenic
1083580780 11:63823891-63823913 AAGAAAAAGAAAAACAGGCCAGG - Intronic
1084011239 11:66349878-66349900 AATAATAATAATAATAGGGCTGG - Intronic
1085001365 11:73038967-73038989 AAGATTATGAATACTAGGCTGGG - Intronic
1085063876 11:73474103-73474125 ATCAATAAGAAGAGTAAGCCGGG - Intronic
1085068525 11:73520341-73520363 AACAATAATAAAATTAGGCCAGG - Intronic
1085098795 11:73782858-73782880 ATTAATAATAATAATAGGCCAGG - Intergenic
1085098841 11:73783164-73783186 AATAATAATAATAATATGCCAGG - Intergenic
1085635212 11:78153764-78153786 ATTAATAATAATAATAGGCCAGG - Intergenic
1085670816 11:78463388-78463410 AAGAATAAAAAAGGCAGGCCAGG + Intronic
1085911740 11:80834907-80834929 AAGAATAGGAAAAATAGGCCAGG - Intergenic
1086386678 11:86316213-86316235 AGGAAAAAGAAAAGAAGGCCGGG + Intronic
1086392481 11:86379679-86379701 AAGAATAATAAAAATAGGCCAGG + Intronic
1086452169 11:86927724-86927746 AATAAAAAGAATACTAGGCCGGG + Intronic
1086558389 11:88139077-88139099 AATATTAAGAATAATAGGCCAGG - Intronic
1086654654 11:89338613-89338635 AAGAGAAAGAATAGTAGGACAGG - Intronic
1087035914 11:93756183-93756205 AAAAAAAAGAATAGTATGGCTGG + Intronic
1087247030 11:95851336-95851358 AAGAATAGGAACATTTGGCCAGG - Intronic
1087752289 11:102020095-102020117 AAGAAGAAGAAGAAGAGGCCAGG + Intergenic
1087755989 11:102055272-102055294 AAGAATATGTATCATAGGCCGGG - Intronic
1087879673 11:103401405-103401427 AAGAGTAAGTCTAGTAGGACGGG + Intronic
1088216809 11:107519398-107519420 AAAAATAAAAATAATAGGCTGGG - Intronic
1088225586 11:107616290-107616312 AAGAATAACTACAGTAGGGCTGG - Intronic
1088704932 11:112453584-112453606 AATAAATAGAATAGTAGGCTGGG - Intergenic
1088739631 11:112756572-112756594 GAGAATAAGAATAGTGTTCCAGG - Intergenic
1089599087 11:119602583-119602605 AATAATAATAATAATAGGCTGGG - Intergenic
1089814035 11:121156637-121156659 AATAATAATAATAATAGGCCAGG - Intronic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1089965283 11:122650540-122650562 AAAAATAATAATAATAGACCTGG - Intergenic
1090367649 11:126220889-126220911 ATCAAAGAGAATAGTAGGCCGGG + Intronic
1090388034 11:126367850-126367872 AAGATTATGCATAGCAGGCCGGG + Intronic
1090802742 11:130183253-130183275 ATGTATAAGAAATGTAGGCCGGG - Intronic
1090827765 11:130399883-130399905 AAGAAAAAGAAAAATACGCCGGG - Intergenic
1091427785 12:406457-406479 AAGGATAAGAGTAGTAGGTGAGG + Intronic
1091498731 12:994799-994821 AAAAATAAAAAAATTAGGCCGGG + Intronic
1091507279 12:1084994-1085016 AACAATAATAATAATGGGCCAGG - Intronic
1091507285 12:1085062-1085084 AATAATAATAATAATGGGCCAGG - Intronic
1091507291 12:1085130-1085152 AATAATAATAATAATGGGCCAGG - Intronic
1091507297 12:1085198-1085220 AATAATAATAATAATGGGCCAGG - Intronic
1091507309 12:1085331-1085353 AATAATAATAATAATGGGCCAGG - Intronic
1091507315 12:1085399-1085421 AATAATAATAATAATGGGCCAGG - Intronic
1091507321 12:1085464-1085486 AATAATAATAATAATGGGCCAGG - Intronic
1091507333 12:1085603-1085625 AATAATAATAATAATGGGCCAGG - Intronic
1091507339 12:1085671-1085693 AACAATAATAATAATGGGCCAGG - Intronic
1091507345 12:1085740-1085762 AATAATAATAATAATGGGCCAGG - Intronic
1091507351 12:1085808-1085830 AATAATAATAATAATGGGCCAGG - Intronic
1091507357 12:1085876-1085898 AATAATAATAATAATGGGCCAGG - Intronic
1091507363 12:1085941-1085963 AATAATAATAATAATGGGCCAGG - Intronic
1091507369 12:1086006-1086028 AATAATAATAATAATGGGCCAGG - Intronic
1091507375 12:1086071-1086093 AATAATAATAATAATGGGCCAGG - Intronic
1091507381 12:1086136-1086158 AATAATAATAATAATGGGCCAGG - Intronic
1091507387 12:1086201-1086223 AATAATAATAATAATGGGCCAGG - Intronic
1091507411 12:1086461-1086483 AATAATAATAATAATGGGCCAGG - Intronic
1091507423 12:1086591-1086613 AATAATAATAATAATGGGCCAGG - Intronic
1091507429 12:1086656-1086678 AATAATAATAATAATGGGCCAGG - Intronic
1091507435 12:1086721-1086743 AATAATAATAATAATGGGCCAGG - Intronic
1091507441 12:1086786-1086808 AATAATAATAATAATGGGCCAGG - Intronic
1091507447 12:1086851-1086873 AATAATAATAATAATGGGCCAGG - Intronic
1091507453 12:1086916-1086938 AATAATAATAATAATGGGCCAGG - Intronic
1091507459 12:1086984-1087006 AATAATAATAATAATGGGCCAGG - Intronic
1091507465 12:1087049-1087071 AATAATAATAATAATGGGCCAGG - Intronic
1091507471 12:1087114-1087136 AATAATAATAATAATGGGCCAGG - Intronic
1091507477 12:1087179-1087201 AATAATAATAATAATGGGCCAGG - Intronic
1091507483 12:1087244-1087266 AATAATAATAATAATGGGCCAGG - Intronic
1091507501 12:1087439-1087461 AACAATAATAATAATGGGCCAGG - Intronic
1091507513 12:1087569-1087591 AATAATAATAATAATGGGCCAGG - Intronic
1091507519 12:1087634-1087656 AATAATAATAATAATGGGCCAGG - Intronic
1091507525 12:1087699-1087721 AATAATAATAATAATGGGCCAGG - Intronic
1091507531 12:1087764-1087786 AATAATAATAATAATGGGCCAGG - Intronic
1091507549 12:1087962-1087984 AACAATAATAATAATGGGCCAGG - Intronic
1091507561 12:1088092-1088114 AATAATAATAATAATGGGCCAGG - Intronic
1091507567 12:1088157-1088179 AATAATAATAATAATGGGCCAGG - Intronic
1091507573 12:1088222-1088244 AATAATAATAATAATGGGCCAGG - Intronic
1091507579 12:1088287-1088309 AATAATAATAATAATGGGCCAGG - Intronic
1091507585 12:1088352-1088374 AATAATAATAATAATGGGCCAGG - Intronic
1091507591 12:1088417-1088439 AATAATAATAATAATGGGCCAGG - Intronic
1091507639 12:1088937-1088959 AATAATAATAATAATGGGCCAGG - Intronic
1091507645 12:1089002-1089024 AATAATAATAATAATGGGCCAGG - Intronic
1091507651 12:1089067-1089089 AATAATAATAATAATGGGCCAGG - Intronic
1091507657 12:1089135-1089157 AATAATAATAATAATGGGCCAGG - Intronic
1091507663 12:1089200-1089222 AATAATAATAATAATGGGCCAGG - Intronic
1091507669 12:1089265-1089287 AATAATAATAATAATGGGCCAGG - Intronic
1091507675 12:1089330-1089352 AATAATAATAATAATGGGCCAGG - Intronic
1091507681 12:1089395-1089417 AATAATAATAATAATGGGCCAGG - Intronic
1091507705 12:1089655-1089677 AATAATAATAATAATGGGCCAGG - Intronic
1091507711 12:1089720-1089742 AACAATAATAATAATGGGCCAGG - Intronic
1091507723 12:1089850-1089872 AATAATAATAATAATGGGCCAGG - Intronic
1091507729 12:1089915-1089937 AATAATAATAATAATGGGCCAGG - Intronic
1091507735 12:1089980-1090002 AATAATAATAATAATGGGCCAGG - Intronic
1091507741 12:1090045-1090067 AATAATAATAATAATGGGCCAGG - Intronic
1091507747 12:1090110-1090132 AATAATAATAATAATGGGCCAGG - Intronic
1091507753 12:1090175-1090197 AATAATAATAATAATGGGCCAGG - Intronic
1091507771 12:1090370-1090392 AACAATAATAATAATGGGCCAGG - Intronic
1091507783 12:1090500-1090522 AATAATAATAATAATGGGCCAGG - Intronic
1091507789 12:1090565-1090587 AATAATAATAATAATGGGCCAGG - Intronic
1091507795 12:1090630-1090652 AATAATAATAATAATGGGCCAGG - Intronic
1091507801 12:1090695-1090717 AATAATAATAATAATGGGCCAGG - Intronic
1091507807 12:1090760-1090782 AATAATAATAATAATGGGCCAGG - Intronic
1091507813 12:1090825-1090847 AATAATAATAATAATGGGCCAGG - Intronic
1091737600 12:2935969-2935991 AAAAATAATAATAATCGGCCAGG + Intronic
1091740027 12:2954465-2954487 AAAATAAAGAATAGGAGGCCGGG + Intergenic
1092133659 12:6130859-6130881 AAGAATAAATAGAATAGGCCGGG + Intergenic
1092134821 12:6139566-6139588 AAAAAAAAAAAAAGTAGGCCGGG - Intergenic
1092335514 12:7629216-7629238 AAAAATAACACTACTAGGCCGGG + Intergenic
1092366868 12:7883559-7883581 AAGAAAAAGAAAAAGAGGCCGGG - Intronic
1092836775 12:12497674-12497696 AAAAAAAAGACTAATAGGCCAGG + Intronic
1093299336 12:17434992-17435014 AAAAATAACAAGAGTTGGCCAGG - Intergenic
1093486810 12:19661476-19661498 AAGAATACGAAAAATAGGCCGGG + Intronic
1093503978 12:19843497-19843519 AAGAAAAAGAGTTCTAGGCCGGG + Intergenic
1093665111 12:21803360-21803382 AAAAATAAAAACATTAGGCCAGG + Intronic
1093751548 12:22805643-22805665 AAGAATTAGAAGAGCAGGCCGGG - Intergenic
1094125569 12:27019441-27019463 AAAAAAAATAATAATAGGCCGGG + Intergenic
1094545375 12:31399572-31399594 AGGTTTAAGAATTGTAGGCCAGG - Intronic
1095219386 12:39591414-39591436 AATAAAAATAATATTAGGCCAGG + Intronic
1095323961 12:40864314-40864336 AAGAAAAAGAAAAATAGGTCTGG - Intronic
1095391555 12:41713177-41713199 AATAATAATAATAATAAGCCGGG - Intergenic
1095424289 12:42058870-42058892 AAGAATAAGACCACTAGGCCAGG + Intergenic
1095543158 12:43334478-43334500 AATAATAATAATAATAGGGCTGG + Intergenic
1095548876 12:43409305-43409327 AAAAACAAGAAAATTAGGCCAGG + Intronic
1095879654 12:47119681-47119703 AATAATAAAAAGATTAGGCCGGG + Intronic
1095966279 12:47869239-47869261 AGGAATAGGAAGAGAAGGCCGGG + Intronic
1096135536 12:49196930-49196952 AAAAATAATAATAATAGGCCAGG + Intronic
1096202219 12:49692828-49692850 AAGAAAAAGAATAGTAAGTGGGG + Intronic
1096284373 12:50285366-50285388 AAAAATAAAAGTAATAGGCCAGG + Intergenic
1096373378 12:51086887-51086909 AAAAATAAAAATAATAGGCTGGG + Intergenic
1096394068 12:51252387-51252409 AAAAATAATAATAATAGGCCGGG - Intronic
1096403674 12:51327303-51327325 AAGTATAAGATTAGGAGGCAGGG - Intergenic
1096576656 12:52557035-52557057 AAAAATAAAAATTGTAGGCCGGG + Intergenic
1096645979 12:53036077-53036099 AATAAAAAAAATAGAAGGCCAGG - Intronic
1096705981 12:53422523-53422545 AATAATAAAAATAATAGGCCAGG + Intergenic
1096830383 12:54309323-54309345 AAAAATAATAATAATAAGCCGGG - Intronic
1096936228 12:55280570-55280592 ATGTATAAGAGTAGTAGGTCTGG + Intergenic
1097129231 12:56798110-56798132 AAAAATAGAAATTGTAGGCCGGG + Intergenic
1097244284 12:57598223-57598245 AAGAATCCAAATTGTAGGCCGGG + Intronic
1097456241 12:59802201-59802223 AAGAATAAGAAAACTAGGCCGGG + Intergenic
1097547889 12:61027429-61027451 AAAAATAAGAAAAGAAGGTCTGG - Intergenic
1098037197 12:66316586-66316608 AATAATAATAATAATAAGCCAGG + Intronic
1098054873 12:66494575-66494597 AAAAATAAGGATATTAGGCCAGG + Intronic
1098657982 12:73057209-73057231 AAGAATAAGAAGAATGGGCTTGG - Intergenic
1098979972 12:76945440-76945462 CATAATAAGAAATGTAGGCCAGG - Intergenic
1099245915 12:80193220-80193242 AAGAATAAGGTAAGCAGGCCAGG + Intergenic
1099403422 12:82228604-82228626 AGGAAAAAGAATTGTTGGCCGGG + Intronic
1099407725 12:82284152-82284174 AACATTAAGAAAAGAAGGCCGGG - Intronic
1099751475 12:86779616-86779638 AATAATAATAATAAAAGGCCGGG + Intronic
1100198070 12:92270029-92270051 AAGAATAAAGATATTCGGCCAGG + Intergenic
1100270675 12:93021712-93021734 AAGAAAAAAAAAAGTAGGCCAGG + Intergenic
1100292746 12:93233471-93233493 AAGATTATGGGTAGTAGGCCAGG + Intergenic
1100326880 12:93548375-93548397 AAGAATAAGAATTCTAGCCCTGG - Intergenic
1100599544 12:96101074-96101096 ATGAAGAAGAAAAGGAGGCCGGG - Intergenic
1100835938 12:98567236-98567258 AAAAAAAAAAATTGTAGGCCGGG + Intergenic
1100928731 12:99581593-99581615 AAGAAAATGAAAAGTCGGCCGGG + Intronic
1100956436 12:99914467-99914489 AAGAATGAGAATGGCAGGCTTGG + Intronic
1101001124 12:100358844-100358866 AAGAATAAAAACCATAGGCCGGG + Intronic
1101147729 12:101856946-101856968 AAGAATTAAAATAAGAGGCCGGG - Intergenic
1101330575 12:103754652-103754674 AAGAATTAGAGTTCTAGGCCAGG + Intronic
1101387418 12:104270004-104270026 TAGAATTAGAAGAGAAGGCCAGG - Intronic
1101722527 12:107362495-107362517 AACAATAAAAATGGTAGACCAGG + Intronic
1101921058 12:108933380-108933402 AATAATAATAATAATAGGCCAGG + Intronic
1102072905 12:110036452-110036474 AAGACTAGAAAAAGTAGGCCAGG + Intronic
1102088306 12:110162628-110162650 AATAAGAAAAATATTAGGCCAGG - Intronic
1102096148 12:110242989-110243011 AAAAATATGCATAATAGGCCAGG - Intergenic
1102235355 12:111291163-111291185 AACAATAATAATAGTTGGCCAGG - Intronic
1102279542 12:111608115-111608137 AAGAAAAAAAAAAATAGGCCAGG - Intergenic
1102285283 12:111651242-111651264 AATAATAATAATAATAGGCCGGG + Intronic
1102540529 12:113616053-113616075 AAGAAAAAGAAAATCAGGCCTGG + Intergenic
1102915827 12:116751208-116751230 AATAACAAATATAGTAGGCCGGG - Intronic
1103106332 12:118229634-118229656 AATAATAATAACACTAGGCCGGG + Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103138650 12:118529579-118529601 AAAAATAAAAAAATTAGGCCGGG - Intergenic
1103213709 12:119185625-119185647 AATAATAATAATAATAGGCAGGG - Intronic
1103355423 12:120316339-120316361 TAAAATAATAATAATAGGCCCGG + Intergenic
1103359359 12:120344709-120344731 AAAAATAATAATAATAGGGCTGG + Intronic
1103378977 12:120479164-120479186 AAAAATAATAGTAATAGGCCAGG + Intronic
1103430287 12:120878816-120878838 AAGAATAAGACGATAAGGCCGGG + Intronic
1103529643 12:121591950-121591972 AAGAAAAAGAAAAATAGGCCGGG + Intergenic
1103610752 12:122122840-122122862 AAGAAAAAGAAAAGAAGGCCGGG - Intronic
1103672347 12:122628335-122628357 ACAAATAAGAATAGTTGGGCTGG + Intergenic
1103699974 12:122844132-122844154 AAAAGTAAAAATAATAGGCCAGG - Intronic
1103715679 12:122944222-122944244 AAGAATGATAATACTAGGCAGGG - Intronic
1103750374 12:123154857-123154879 AAGAATACCAAGAATAGGCCGGG + Exonic
1103766614 12:123284675-123284697 AAAAACAAGAATAATGGGCCGGG - Intergenic
1104045965 12:125163161-125163183 TAAAATAATAATGGTAGGCCGGG - Intergenic
1104249073 12:127072479-127072501 AATAATAATAATAATAGGCCAGG - Intergenic
1104407708 12:128532341-128532363 AAGAAAAAAAAAAGGAGGCCGGG + Intronic
1104662687 12:130622621-130622643 AAAAATATAACTAGTAGGCCAGG - Intronic
1104832065 12:131759502-131759524 ATGTATGAAAATAGTAGGCCGGG + Intronic
1105055996 12:133099524-133099546 AAGAATAAGAAAACTAAGGCTGG + Intronic
1105275152 13:18915546-18915568 AAGAAATAAAATAATAGGCCGGG + Intergenic
1105284598 13:18993964-18993986 AAGAACAAGACGAGGAGGCCAGG + Intergenic
1105366160 13:19767011-19767033 AAAAATACAAAAAGTAGGCCTGG + Intronic
1105683431 13:22752599-22752621 AAGAATAAGTACAGTAGGAGAGG - Intergenic
1105690617 13:22835261-22835283 AAAAATACGAAAAATAGGCCGGG - Intergenic
1105797989 13:23876196-23876218 CAGAATAAGAATAGTAGTTCTGG - Intronic
1105926727 13:25015501-25015523 ACAAAAAAGATTAGTAGGCCAGG - Intergenic
1106272697 13:28169751-28169773 AAAAATAATAATTTTAGGCCGGG + Intronic
1106530796 13:30589298-30589320 TAAAATAAGAATGATAGGCCGGG - Intronic
1106740550 13:32636062-32636084 AAGAATCAGAATACTAGGCCGGG - Intronic
1106774277 13:32993568-32993590 AATAATAATAATAATTGGCCAGG - Intergenic
1106820507 13:33459036-33459058 TAAAATAATAATAATAGGCCGGG - Intergenic
1106941779 13:34788024-34788046 AAGAATAAGGATTGTTGGTCTGG + Intergenic
1107026228 13:35804427-35804449 AAAAATAATAATAGTAGGCTGGG - Intronic
1107112348 13:36711666-36711688 TAAAAGAAGAATTGTAGGCCAGG - Intergenic
1107484246 13:40811193-40811215 AAGAAAAGCAATTGTAGGCCAGG + Intergenic
1107585366 13:41841489-41841511 AAAAATATAAACAGTAGGCCGGG + Intronic
1107607948 13:42080701-42080723 AAGAAAAAAAAAAGTAGGACAGG - Intronic
1107644593 13:42480824-42480846 AAAAATATAAGTAGTAGGCCAGG + Intergenic
1107783724 13:43933270-43933292 CTGGATAAGAATAGTAGGACTGG - Intergenic
1107946450 13:45421081-45421103 AAGAATAACAAAAAAAGGCCAGG + Intergenic
1108334337 13:49423420-49423442 AAGAGTAAGAATTAGAGGCCAGG + Intronic
1108420103 13:50240070-50240092 AAAAAAAAAAATAGTGGGCCGGG - Intronic
1108677868 13:52753086-52753108 AAAAAGAAAAAAAGTAGGCCGGG - Intergenic
1109183757 13:59245739-59245761 GTGAAAAAGAAGAGTAGGCCGGG + Intergenic
1109437892 13:62330161-62330183 AAAAATACTAATAGTTGGCCGGG - Intergenic
1109460284 13:62647030-62647052 AAGAAAAGGAACAGTATGCCTGG + Intergenic
1109563952 13:64086387-64086409 AAAAATAATAATCGTAGGCCGGG + Intergenic
1110092976 13:71477414-71477436 AAAAATATTAATAATAGGCCGGG - Intronic
1110564168 13:76941221-76941243 AAAAATATGAAAAGCAGGCCGGG + Intergenic
1110627264 13:77665261-77665283 GAGAAAAAGAAGAGAAGGCCAGG - Intergenic
1110982090 13:81912979-81913001 AAGTATAGGAATTCTAGGCCAGG - Intergenic
1111462148 13:88559056-88559078 AAAAATAAACATAATAGGCCTGG - Intergenic
1111722878 13:91969260-91969282 AAGTATAAGAAAAATAGGTCAGG - Intronic
1112016846 13:95338243-95338265 AAAAAAAAGAAAAATAGGCCAGG + Intergenic
1112407592 13:99135017-99135039 TAGAAGAAGCAAAGTAGGCCGGG + Intergenic
1112481053 13:99775866-99775888 AATAATAATAACAATAGGCCGGG + Intronic
1112488215 13:99838932-99838954 AAGAATGTGAAATGTAGGCCAGG - Intronic
1112781877 13:102909547-102909569 AAAAATAAGAATCTTAGGCCAGG - Intergenic
1112914972 13:104537029-104537051 AAGAATAAGAAAAGGAAGACTGG + Intergenic
1112997085 13:105587248-105587270 AAGAAAAAGAATTCTAGGGCCGG + Intergenic
1113044450 13:106140469-106140491 AATAATAACAATAATAGGCCGGG - Intergenic
1113151183 13:107265699-107265721 AACAAAAAAAAAAGTAGGCCAGG - Intronic
1113213222 13:108007006-108007028 AAGAATTATAATAATCGGCCAGG - Intergenic
1113496741 13:110736489-110736511 AAGAAAAATAATAACAGGCCGGG - Intergenic
1113658420 13:112086091-112086113 AAGAATAAGACAAGAATGCCAGG - Intergenic
1113722418 13:112569564-112569586 ATGAACAAGAAGAGGAGGCCGGG + Intronic
1113975686 13:114225701-114225723 AGGAATAAGAATTGCAGGCGTGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114041238 14:18680627-18680649 AATAATAATAATAATAAGCCTGG - Intergenic
1114439334 14:22733467-22733489 AATAATAATAATTCTAGGCCAGG - Intergenic
1114442772 14:22764083-22764105 AAAAAAAAAAATACTAGGCCGGG - Intergenic
1114588405 14:23836155-23836177 AATAATAATTATAATAGGCCGGG - Intergenic
1114625262 14:24124744-24124766 AAAAATACAAAAAGTAGGCCGGG + Exonic
1114712584 14:24793545-24793567 AATAATAATAATAATAAGCCTGG - Intergenic
1115179436 14:30605189-30605211 AAGAATCAGAATCTCAGGCCAGG - Intronic
1115250154 14:31336483-31336505 AAAAATAGTAATAATAGGCCAGG - Intronic
1115250800 14:31344576-31344598 AAGAATAACTAAAGTAGGTCAGG - Intronic
1115588490 14:34839546-34839568 AAAAAAAAAAAAAGTAGGCCAGG + Intronic
1115596683 14:34916411-34916433 AAGAATTAGCAAAGTGGGCCGGG - Intergenic
1115625683 14:35189813-35189835 AAAAATAAGCATAGCAGGCTGGG + Intronic
1116102993 14:40465351-40465373 AAGAAAAAGAAAAATATGCCTGG - Intergenic
1116448129 14:45035814-45035836 AAAAATAAAAGTAGTGGGCCAGG + Intronic
1116926886 14:50648482-50648504 AAGAATACTAATAGTTGGCCGGG + Intronic
1116975020 14:51106189-51106211 AAAAATAATAATTTTAGGCCGGG - Intergenic
1117177628 14:53161317-53161339 AAAAATAAGTAAAATAGGCCAGG + Intergenic
1117453375 14:55873789-55873811 AGGAATAAGGAAAATAGGCCAGG + Intergenic
1117570341 14:57042216-57042238 AAGAATAAGAATAGAAAACTGGG + Intergenic
1117660592 14:58000340-58000362 TAGAAAAAGAATAGAAGGCTGGG - Intronic
1117826938 14:59713938-59713960 AAAAATTAGACTAATAGGCCGGG + Intronic
1118518056 14:66548474-66548496 AACAATTACAATAGTAGGCTGGG - Intronic
1118537257 14:66781511-66781533 AAAAATCATAATAGTAGGCTGGG - Intronic
1118585472 14:67348363-67348385 AAGAATACAAAAATTAGGCCGGG - Intronic
1118794805 14:69132290-69132312 AAGAATAAAAAGAGTTGGCAAGG - Intronic
1118827004 14:69393019-69393041 AAGAATTAGAGTAGATGGCCTGG + Intronic
1119058404 14:71447862-71447884 AAAAAAATCAATAGTAGGCCAGG - Intronic
1119232704 14:72993405-72993427 AAAAAAAAAAAAAGTAGGCCAGG + Intronic
1119264699 14:73257265-73257287 AAGAATAAAATAAGTGGGCCAGG - Intronic
1119274837 14:73345613-73345635 AAAAATAAGAACATTTGGCCGGG + Intronic
1119368855 14:74120457-74120479 AAAAATACAAAAAGTAGGCCAGG + Intronic
1119414776 14:74462486-74462508 AAGAAAAAAAAAAGTAGGCTAGG + Intergenic
1119448799 14:74689889-74689911 AAGAATAAAAGTGCTAGGCCGGG - Intronic
1119518231 14:75265285-75265307 AAAAATACAAAAAGTAGGCCGGG + Intronic
1119738619 14:76999671-76999693 AAGAATAGGAATGGTGGGGCGGG + Intergenic
1119748513 14:77061494-77061516 AAAAATAAAAAAATTAGGCCAGG - Intergenic
1119819022 14:77597826-77597848 AAAAAAAAGAATTTTAGGCCAGG + Intronic
1119827721 14:77671395-77671417 AAAAAAAAAAAGAGTAGGCCAGG - Intergenic
1119984666 14:79123792-79123814 ATGAATAAGCAGAGCAGGCCAGG + Intronic
1120383143 14:83808589-83808611 AAAAAAAAAAAAAGTAGGCCTGG + Intergenic
1120452375 14:84684521-84684543 TACAATAAGAATTATAGGCCAGG + Intergenic
1120896655 14:89538812-89538834 AATAATAATAATAAAAGGCCAGG - Intronic
1120958537 14:90104177-90104199 AAGAACAAGATTAGGAGGCTCGG - Intronic
1120985296 14:90329539-90329561 AAGAAAAAAAAAAGTAGGCTGGG + Intronic
1121204629 14:92152422-92152444 ATTAATAATAATAATAGGCCGGG - Intronic
1121351517 14:93177142-93177164 AAGAAAAAGAAAACTAGGCCTGG + Intergenic
1121539497 14:94714385-94714407 ACTAATAAGAAAAGTAAGCCAGG - Intergenic
1122241531 14:100371455-100371477 AAAAAAAAAAAAAGTAGGCCAGG + Intronic
1122420826 14:101576061-101576083 ATAAATAATAATAATAGGCCGGG + Intergenic
1122516526 14:102312757-102312779 AATAATAATAATAATAGGCTGGG - Intergenic
1122872566 14:104646881-104646903 AAAAAAAAAAATAGGAGGCCGGG - Intergenic
1123692851 15:22853669-22853691 AAAAATGAAAAAAGTAGGCCGGG - Intronic
1123852314 15:24371649-24371671 AAGAAAAAGAAGTGAAGGCCAGG - Intergenic
1123950001 15:25262096-25262118 AAGAAAAAGAAAAAGAGGCCGGG + Intergenic
1124408061 15:29409618-29409640 AAAAAAAAGAAAAATAGGCCGGG - Intronic
1124704280 15:31948811-31948833 TAGAAATAAAATAGTAGGCCGGG - Intergenic
1124933568 15:34148013-34148035 AAAAATAAAAATAATAAGCCAGG - Intronic
1125051370 15:35301673-35301695 TAGAATAAAAAAATTAGGCCGGG + Intronic
1125544469 15:40492438-40492460 AATAATAATAATAATAAGCCAGG - Intergenic
1125642447 15:41242646-41242668 AAAAATAAGCAAAATAGGCCGGG + Intronic
1125822864 15:42648456-42648478 AAGAACAAGAAAAGCAGGCTGGG - Intronic
1125823861 15:42658815-42658837 AATAAAAAGAAAAGCAGGCCAGG + Intronic
1125913897 15:43467357-43467379 AAGAATACCTTTAGTAGGCCGGG - Intronic
1125951824 15:43758678-43758700 AAAATTAAAAATAGAAGGCCAGG + Intronic
1126024458 15:44432613-44432635 AAAAATAATAATAATAGGCCGGG - Intronic
1126152693 15:45537491-45537513 AAAAATAATAATTTTAGGCCAGG + Intergenic
1126172619 15:45706935-45706957 AAAAATAAAAAAATTAGGCCCGG - Intergenic
1126633365 15:50759197-50759219 AAAAATAGGAAAAGTTGGCCAGG - Intronic
1126821223 15:52506054-52506076 AAAAATATGAAAATTAGGCCGGG + Intronic
1126824259 15:52533211-52533233 AAAAATAATAGTAATAGGCCAGG - Intergenic
1127273842 15:57425201-57425223 CAAAATAAGAATAATAGGCTGGG + Intronic
1127463102 15:59217821-59217843 AAGAGTAAAACTAGTAGGCTGGG - Intronic
1127483110 15:59395404-59395426 AAAAATAAGATAAATAGGCCAGG - Intronic
1127489505 15:59448960-59448982 AAGAATATCAATAGCTGGCCAGG - Intronic
1127503496 15:59576579-59576601 AAGAGAAAGAAGAGTTGGCCAGG + Intergenic
1127660857 15:61098630-61098652 AAGAATAGGAGTAGCAGGCTGGG - Intronic
1128352351 15:66899626-66899648 AAGAAAAAGAAATGGAGGCCAGG - Intergenic
1128950136 15:71871077-71871099 AATAATAAACATACTAGGCCAGG + Intronic
1129218815 15:74118950-74118972 AAAAATAATAAAAGCAGGCCAGG - Intronic
1129311465 15:74712924-74712946 AAGAAAAAAAAAAATAGGCCAGG + Intergenic
1129315264 15:74739137-74739159 AATAATAATAATAATAGGCTGGG + Intergenic
1129337652 15:74863047-74863069 GAGAATACGAAAATTAGGCCGGG + Intronic
1129404933 15:75310257-75310279 AAAAATAATAAAAGCAGGCCGGG + Intergenic
1129414154 15:75365787-75365809 AAGAACATGAATACTGGGCCAGG + Intronic
1129454264 15:75668111-75668133 AATAATAAGAATGGTCGGCCTGG + Intergenic
1129533599 15:76291453-76291475 AAAAAAAAAAAAAGTAGGCCAGG + Intronic
1129553651 15:76481024-76481046 AAAAAGTAGAATAGTGGGCCGGG - Intronic
1129750688 15:78060948-78060970 AAATATAATAATAATAGGCCAGG + Intronic
1129750732 15:78061275-78061297 AAATATAATAATAATAGGCCAGG + Intronic
1129861961 15:78870116-78870138 AAAAATGAAAATAGTGGGCCGGG - Intronic
1130171580 15:81520239-81520261 AAGAAAAAGAAGAGGAGGCTAGG + Intergenic
1130538114 15:84801503-84801525 AAGAAAAAGAAAAGTATGCATGG + Intronic
1130557221 15:84931063-84931085 AAGAATACAAAAATTAGGCCGGG - Intronic
1130963859 15:88682726-88682748 AAAAATTAGCATACTAGGCCTGG + Intergenic
1131086933 15:89583981-89584003 AAGTATAAGTATTGAAGGCCAGG - Intronic
1131486033 15:92821261-92821283 AAGAAAAAGAAAAATAGGGCCGG - Intergenic
1131489818 15:92852843-92852865 AAAAATAATAATAATAGGTCGGG - Intergenic
1131581529 15:93648056-93648078 AATAATAAAAATAATAAGCCAGG + Intergenic
1131709600 15:95038390-95038412 AAGAATAAAAAGAGTAAGGCTGG + Intergenic
1131714897 15:95098033-95098055 TAAAATAATAATAATAGGCCAGG + Intergenic
1131956701 15:97743523-97743545 AAGAATAAGAGTGGTAGACTAGG + Intergenic
1132015235 15:98309469-98309491 AAAAAAAAGAAGAGGAGGCCGGG - Intergenic
1132471125 16:103817-103839 AAAAATACAAATATTAGGCCGGG + Intronic
1132888512 16:2193310-2193332 AAAAATAAGAATTTCAGGCCGGG - Intronic
1132922333 16:2403941-2403963 TAGGATAAGAATAATGGGCCAGG - Intergenic
1133070304 16:3242372-3242394 AAAAAAAAGAATCATAGGCCGGG + Exonic
1133124293 16:3635160-3635182 AAAAATAAGAAAAGTAGACCGGG + Intronic
1133221670 16:4321593-4321615 CAGAATGAGAAAACTAGGCCTGG - Intronic
1133443846 16:5843120-5843142 AAAAATAAAAATAATAGGCCTGG - Intergenic
1133466651 16:6034037-6034059 AAGAATAGGAATCGTTGGCCAGG + Intronic
1133508209 16:6432682-6432704 AAGAAAAATAATAATAGGCTGGG + Intronic
1133623208 16:7546029-7546051 AAGAAAAAGAAAATCAGGCCAGG + Intronic
1133832999 16:9341528-9341550 AAGAATAATAATAATAGGCCAGG + Intergenic
1134007432 16:10827685-10827707 AAAAATAAAATTAGCAGGCCGGG - Intergenic
1134144047 16:11745756-11745778 TAGAAAAAGTATAGTGGGCCGGG - Intergenic
1134689199 16:16179884-16179906 AATAATAATACAAGTAGGCCGGG - Intronic
1135019289 16:18950006-18950028 AAAAATAATAATAATAGGCTAGG - Intergenic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135107403 16:19662207-19662229 AATAATAATAAAAATAGGCCAGG + Intronic
1135107502 16:19663012-19663034 AATGATAATAATAATAGGCCGGG + Intronic
1135276591 16:21118586-21118608 AAAAATAAGAAAATTAGGCATGG - Intronic
1135278869 16:21136837-21136859 AAGAAGAGGAATAACAGGCCAGG + Intronic
1135300553 16:21323048-21323070 AAGAATAAAAAAGGTAGGCTGGG - Intergenic
1135337701 16:21617430-21617452 AAGAAAAAAAAAATTAGGCCAGG + Intronic
1135533132 16:23271731-23271753 AAGAAAAAGAAAAATAGGCTGGG - Intergenic
1135625238 16:23989257-23989279 AATAATAATAATAATAGGCCGGG - Intronic
1135697432 16:24602422-24602444 AAAAATAATAATAAAAGGCCAGG - Intergenic
1135767273 16:25188514-25188536 AAAAAAAAGAAAATTAGGCCAGG + Intergenic
1135779807 16:25290470-25290492 AAGAAAAAGAAAAGCAGGCCAGG - Intergenic
1135857102 16:26021955-26021977 AAAAATAATAATAGTAGGCTGGG - Intronic
1136037601 16:27551866-27551888 AATAATAATAATAATTGGCCAGG + Intronic
1136404657 16:30037245-30037267 AAAAATTAGAATAATAGGCCGGG + Intronic
1136502842 16:30682047-30682069 AAAAATACGTATAGGAGGCCGGG + Intergenic
1136584327 16:31174232-31174254 AAGAAAAAAAAAAGGAGGCCAGG + Intergenic
1137260530 16:46824957-46824979 AAGAATATGAGTATCAGGCCGGG - Intronic
1137281586 16:46981452-46981474 AAAAATAAAAAAATTAGGCCGGG + Intergenic
1137283643 16:46999122-46999144 AAAAATTATAAAAGTAGGCCAGG + Intergenic
1137406170 16:48191238-48191260 AAGAATAAGAGAAATGGGCCAGG + Intronic
1137646248 16:50077167-50077189 AAAAATAAAAAAATTAGGCCAGG - Intronic
1138011650 16:53386385-53386407 AAGAATAAAAACATGAGGCCGGG - Intergenic
1138079845 16:54080089-54080111 AATCATAAGAAGAGTAGGCCAGG + Intronic
1138350379 16:56343336-56343358 AATAATAATAATAATAAGCCAGG + Intronic
1138474445 16:57262572-57262594 AATAATAATAATAGTTAGCCAGG + Intronic
1138479379 16:57291817-57291839 AAAAATAAAAAAATTAGGCCAGG - Intergenic
1138563273 16:57814915-57814937 AAGAATGGCAATAATAGGCCAGG - Intronic
1138621471 16:58214637-58214659 AAAAATAAGAATAATGGGGCTGG + Intergenic
1138714446 16:59005259-59005281 AAGAATAAGAAGATTAGGCTGGG + Intergenic
1139190819 16:64860960-64860982 AAGAAAAAGAAAAAAAGGCCCGG + Intergenic
1139424415 16:66870396-66870418 AAGAAAAAGAAGCATAGGCCGGG + Intronic
1139502567 16:67379419-67379441 AATAATAATAAAAATAGGCCGGG + Intronic
1139592542 16:67941618-67941640 AAGAAAAAAAAAAGTAGGCGGGG + Intronic
1139639061 16:68277919-68277941 AATAATAATAATAATAGGCCAGG - Intronic
1139756369 16:69147206-69147228 AATAATAATAATAATAAGCCGGG + Intronic
1139763526 16:69207062-69207084 AAGAATAAAAATGCAAGGCCAGG - Intronic
1139876955 16:70153882-70153904 AAAAATACAAAAAGTAGGCCGGG + Intronic
1139895053 16:70281854-70281876 AAAAATAATAATAGCTGGCCGGG + Intronic
1140054838 16:71516549-71516571 AAGAAAAAAAAAATTAGGCCGGG + Intronic
1140084512 16:71782456-71782478 AATAATAATAATTGTAGGCTGGG - Intronic
1140130456 16:72156321-72156343 AAGAATCAGTATTGGAGGCCGGG + Intronic
1140155454 16:72420448-72420470 AAAAATAATAATAATGGGCCGGG - Intergenic
1140234647 16:73147395-73147417 AAGAATAAAAAAATTGGGCCGGG + Intergenic
1140373242 16:74424629-74424651 AAGAAAAAAAAAATTAGGCCAGG + Intergenic
1140402935 16:74686285-74686307 AAAAATAATGATACTAGGCCGGG + Intronic
1140575944 16:76168947-76168969 AAAAATAAGTAAAGCAGGCCGGG - Intergenic
1140921621 16:79543656-79543678 AAGAAAAAGAAAAGAGGGCCTGG - Intergenic
1141073322 16:80978572-80978594 AAGAAGAAGAACAAAAGGCCAGG + Intronic
1141571417 16:84936181-84936203 AAGAAAAAGAATAGCAGGCTGGG + Intergenic
1142039503 16:87883623-87883645 AAAAATACGAAAAGTAGGCCGGG - Exonic
1142264974 16:89059683-89059705 AAAAATACAAAAAGTAGGCCAGG + Intergenic
1142301492 16:89261151-89261173 AAAAAAAAGAAAAGTCGGCCGGG + Intergenic
1142326033 16:89415247-89415269 AAAAAAAAGAATAGCTGGCCAGG - Intronic
1142391362 16:89802696-89802718 AAAAAAAAGAATAGCTGGCCGGG - Intronic
1142417529 16:89950682-89950704 AAAAATAACAGTAATAGGCCAGG + Intronic
1142446844 16:90145503-90145525 AAAAATAAAAATAATTGGCCAGG - Intergenic
1142460644 17:89822-89844 AAAAATAAAAATAATTGGCCAGG + Intergenic
1142581184 17:943940-943962 AAAAATAACAATATTTGGCCGGG + Intronic
1142833142 17:2564232-2564254 AATAATAATAATAATAGGCCTGG - Intergenic
1142861428 17:2764425-2764447 AAAAATAAAAATAGAAGGCCAGG + Intergenic
1142868641 17:2806690-2806712 AAAAATAATAATAATAGACCAGG - Intronic
1143176982 17:4961160-4961182 GAGATTAAGAATAATAGACCAGG + Intronic
1144887515 17:18473463-18473485 AAGAACAAGCACTGTAGGCCGGG - Intergenic
1145040642 17:19575693-19575715 AACAGTAAGAGTAATAGGCCAGG - Intronic
1145144702 17:20470832-20470854 AAGAACAAGCACTGTAGGCCGGG + Intergenic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145743718 17:27297462-27297484 AAAAAAAAAAAGAGTAGGCCGGG - Intronic
1146181660 17:30702391-30702413 AAGAATAAATAAAATAGGCCAGG - Intergenic
1146201691 17:30863958-30863980 AAAAATACAAAAAGTAGGCCGGG - Intronic
1146212272 17:30951948-30951970 AAAAATGAAAATATTAGGCCAGG - Intronic
1146303004 17:31705948-31705970 AAGAATAAGATTACCAGGCATGG + Intergenic
1146362084 17:32185403-32185425 AAAAAAAAGGAGAGTAGGCCAGG - Intronic
1146403998 17:32521786-32521808 AAAAATAAAAAAATTAGGCCAGG + Intronic
1146710128 17:35033845-35033867 AAAAATAATAATAATAGGCCAGG + Intronic
1146827644 17:36037300-36037322 TAAAATAAGAATTATAGGCCGGG + Intergenic
1146900680 17:36584796-36584818 AGGAATAAAAAAATTAGGCCTGG + Intronic
1146949743 17:36897666-36897688 TATAATAATAATAATAGGCCGGG + Intergenic
1147229628 17:39007845-39007867 AAAAATACAAAAAGTAGGCCGGG + Intergenic
1147257204 17:39188745-39188767 AATAATAATAATAGCAGGCCGGG + Intronic
1147263232 17:39220765-39220787 AAAAATAAAAATGATAGGCCGGG - Intronic
1147268564 17:39250253-39250275 AAAAAAAAAAAAAGTAGGCCAGG - Intergenic
1147289189 17:39428052-39428074 AAAAATAATAATAATAGGCCGGG + Intronic
1147292413 17:39454525-39454547 CATAATAATAATAATAGGCCTGG + Intergenic
1147330095 17:39693790-39693812 AATAATAATAATAATAGGGCTGG + Intronic
1147379664 17:40046448-40046470 AAAAATAAGAAGAAAAGGCCGGG + Intronic
1147404281 17:40199893-40199915 AAGAAAAAGAAAAAAAGGCCGGG + Intergenic
1147411262 17:40254310-40254332 ATTAATAAGATTAGGAGGCCAGG - Intronic
1147413194 17:40269021-40269043 AAAAATAAAAAAACTAGGCCGGG + Intronic
1147440840 17:40446318-40446340 AAAAAAAAAAAAAGTAGGCCGGG + Intronic
1147556568 17:41483063-41483085 AAAAGTAGGAATAGTAGGCTGGG - Intergenic
1147693746 17:42335620-42335642 AAGAATAGAGATATTAGGCCAGG + Intronic
1147747992 17:42707552-42707574 AAAAATAAAAAAATTAGGCCAGG - Intronic
1147833178 17:43311501-43311523 AAAAATAGTAATAATAGGCCGGG - Intergenic
1147888530 17:43700802-43700824 AAGAATATAATTATTAGGCCAGG + Intergenic
1147964015 17:44183754-44183776 AAAAATACAAAAAGTAGGCCAGG + Intergenic
1148098498 17:45071953-45071975 ATGAATAAGAAAATTAGGGCTGG + Intronic
1148562515 17:48614038-48614060 AAGAAGAAGAAAAGTAAGGCAGG + Intronic
1148602178 17:48902677-48902699 AATAATAATAATAATATGCCTGG + Intergenic
1148612836 17:48975916-48975938 AAGAAAAAGAAAAGAAAGCCAGG + Intergenic
1148661480 17:49336919-49336941 ACCATTAAGAAAAGTAGGCCGGG - Intronic
1148717355 17:49725175-49725197 AAGAATGGGAATAGTTGGCCGGG - Intronic
1148901491 17:50881768-50881790 AAAAAGAAAAAAAGTAGGCCAGG + Intergenic
1148919998 17:51022651-51022673 AATAATAATAACAATAGGCCGGG + Intronic
1149033121 17:52105535-52105557 AAGAATAAGGATTTGAGGCCAGG - Intronic
1149411327 17:56410388-56410410 AAAAATAATAATAATAGGCCTGG - Intronic
1149480911 17:57002418-57002440 AAAAATATGAAAATTAGGCCAGG + Intronic
1149502575 17:57165374-57165396 AGGAAGAAGAATGGTAGGCAGGG + Intergenic
1149664169 17:58354261-58354283 GAGAATAAGAATAGTGGGGAGGG - Exonic
1149697576 17:58628415-58628437 AAGAATACAAAAATTAGGCCGGG + Intronic
1149707871 17:58712051-58712073 TAAAATAAGAATAATTGGCCGGG + Intronic
1149719404 17:58827921-58827943 AATAATAATAATAATTGGCCAGG + Intronic
1149730036 17:58936228-58936250 AAGAAAAAGAATACTAAGTCAGG + Intronic
1149785506 17:59431282-59431304 TAGAATAAGAGCAGTAGGCAAGG - Intergenic
1149830123 17:59864655-59864677 AAAAATAAAAATATTAGGCATGG - Intronic
1149853802 17:60060538-60060560 GAGAATAAGAATTAGAGGCCTGG + Intronic
1150062625 17:62082042-62082064 AGAAATAAAAATAGTTGGCCGGG - Intergenic
1150076224 17:62194313-62194335 AAGAATAGGGATTGTGGGCCAGG - Intergenic
1150153880 17:62834319-62834341 AAAAATAAAAATTATAGGCCAGG - Intergenic
1150665438 17:67131715-67131737 AATAATAATAATAGTAGTGCTGG - Intronic
1150948742 17:69777604-69777626 AAGAAGAAAAAGAGTAGGCCTGG - Intergenic
1151013025 17:70523444-70523466 GAAAATAAAAATATTAGGCCAGG + Intergenic
1151302235 17:73235253-73235275 AAGAATAAAAAACTTAGGCCAGG - Intronic
1151365266 17:73612621-73612643 AATAATAGTAACAGTAGGCCAGG + Intronic
1151399961 17:73849596-73849618 ATGACTAAGAAAAGAAGGCCGGG + Intergenic
1151528268 17:74686386-74686408 AAAAATAATAATAATAGGCCGGG - Intronic
1151578957 17:74967243-74967265 AATAATAATAATAATAGGCCAGG + Intronic
1151609691 17:75164529-75164551 AAAAAAAAAAAAAGTAGGCCGGG + Intronic
1151861882 17:76770331-76770353 TAGAATAGCAATAATAGGCCGGG - Intronic
1151980514 17:77505784-77505806 AAAAAAAAAAAAAGTAGGCCGGG + Intergenic
1152043520 17:77920555-77920577 AAAAATACAAAAAGTAGGCCGGG + Intergenic
1152437032 17:80282691-80282713 AAAAATAGTAATAATAGGCCGGG - Intronic
1152541061 17:80975870-80975892 AATAATAATAATAATAAGCCAGG + Intergenic
1152764921 17:82131133-82131155 AAGAAAAATAAATGTAGGCCAGG + Intronic
1152827149 17:82473886-82473908 AAGGAAAAGAAAAATAGGCCAGG + Intronic
1152833116 17:82511136-82511158 AATAATAATAATAATAGGCTGGG - Intergenic
1203171061 17_GL000205v2_random:148199-148221 AAGCATAAGGCTAGAAGGCCTGG + Intergenic
1153261039 18:3224958-3224980 AATAATACTAATAATAGGCCGGG - Intergenic
1153297339 18:3560123-3560145 AAGAATGAGAAAAATGGGCCAGG + Intronic
1153339154 18:3956641-3956663 AAGAAAAGGAAAAATAGGCCGGG - Intronic
1153625632 18:7019975-7019997 AAGAATTACTATAATAGGCCGGG - Intronic
1153731450 18:8017241-8017263 TAGTATAAAAATATTAGGCCAGG + Intronic
1153871421 18:9324113-9324135 AAAAATAAGAATTGTTGGCAAGG + Intergenic
1154243307 18:12672273-12672295 AAAAATACGAAAATTAGGCCGGG - Intronic
1154466776 18:14652673-14652695 AAGAAATAAAATAATAGGCCGGG + Intergenic
1154955132 18:21246015-21246037 AAGAATAGGCATTATAGGCCAGG - Intronic
1154992131 18:21607318-21607340 AAAAAAAAAAATAATAGGCCGGG - Intergenic
1155051409 18:22151077-22151099 CAAAATAATAATAATAGGCCGGG - Intergenic
1155217214 18:23653864-23653886 AAAAATAAGAATAATAGGCCAGG - Intronic
1155472984 18:26209920-26209942 CAAAATAATAATAATAGGCCAGG - Intergenic
1155483861 18:26319194-26319216 AAAAATAATAATAATAGGCCAGG + Intronic
1155931852 18:31716805-31716827 AGAAATAAAATTAGTAGGCCGGG + Intergenic
1156168314 18:34450775-34450797 AAGAATACCAGTAGTAGGCTGGG - Intergenic
1156216010 18:34998620-34998642 AAAAATAAAAAAATTAGGCCAGG - Intronic
1156261954 18:35452884-35452906 AAAAAAAGGAATAATAGGCCGGG + Intronic
1156317183 18:35980935-35980957 ATAAATAATAATTGTAGGCCAGG - Intergenic
1156556573 18:38075219-38075241 AAGAATAAGAATGATTTGCCTGG - Intergenic
1156716065 18:40011989-40012011 AAAAATAAAAATAAGAGGCCAGG - Intergenic
1156864380 18:41872738-41872760 AAGTTTGAGAATCGTAGGCCAGG + Intergenic
1156987107 18:43361418-43361440 AAGAATAAGGAGGGTAGGCCGGG + Intergenic
1157429081 18:47608583-47608605 ATGAATAAGTAATGTAGGCCAGG - Intergenic
1157707147 18:49816694-49816716 TAGAAAAAGAATAATGGGCCAGG - Intronic
1157798597 18:50599712-50599734 AAAAATAATAAAAGCAGGCCAGG - Intronic
1158006868 18:52682462-52682484 GTGAAGAAGAATAGTGGGCCTGG + Intronic
1158516425 18:58134294-58134316 CAAATTAAGAATATTAGGCCAGG - Intronic
1159255946 18:65945826-65945848 AAAAATAATAAAAATAGGCCAGG - Intergenic
1159270191 18:66138841-66138863 AAGGATAAGAATAGTATCCTGGG - Intergenic
1159832377 18:73293297-73293319 AAGAATAACAATAGTACTGCCGG - Intergenic
1159839885 18:73386950-73386972 ACGAAAAAGAAGAATAGGCCAGG + Intergenic
1159935691 18:74365692-74365714 AAGAATAAGAATCCGGGGCCGGG + Intergenic
1160178761 18:76616885-76616907 AAAAATAAGAAAAATAGGCCGGG + Intergenic
1160367719 18:78342795-78342817 AAGAATAAGAAAAATAGGCCAGG + Intergenic
1160372084 18:78381974-78381996 AAAAATAACAGTGGTAGGCCAGG + Intergenic
1160650362 19:222328-222350 AAAAATAAAAATAATTGGCCAGG + Intergenic
1160712861 19:560832-560854 AAAAAAAAGAAAACTAGGCCGGG - Intergenic
1160742139 19:691522-691544 AAAGAAAAGAAAAGTAGGCCGGG + Intronic
1160802886 19:978562-978584 AAAAATAATAATAAAAGGCCGGG + Intergenic
1160954343 19:1683393-1683415 AATAATAATAATAATAGGCAGGG + Intergenic
1160962158 19:1727089-1727111 AAAAATAATAATAATAGGCCAGG + Intergenic
1161105594 19:2442294-2442316 AATAATAAAAAAATTAGGCCAGG + Intronic
1161263921 19:3354195-3354217 AAAAAAAAGATTTGTAGGCCAGG - Intergenic
1161336047 19:3714018-3714040 AATAGTAATAATAATAGGCCGGG - Intronic
1161385957 19:3993051-3993073 CAGAATAAGAAATGTTGGCCAGG - Intergenic
1161402503 19:4073898-4073920 TAAAATAATAATAATAGGCCGGG + Intergenic
1161440606 19:4289539-4289561 AATAATAATAATAAGAGGCCAGG - Intronic
1161471923 19:4461898-4461920 AAAAATAAAAATAACAGGCCAGG + Intergenic
1161512884 19:4681557-4681579 AATAATAATAATAATAGGCCAGG - Intronic
1161544943 19:4874856-4874878 AATAATAATAAAAATAGGCCAGG - Intergenic
1161616796 19:5275363-5275385 AAGAAAAAGAAAAGAAGGCTGGG - Intronic
1161624221 19:5316686-5316708 AAAAATACGAAAATTAGGCCAGG - Intronic
1161624435 19:5317874-5317896 AAAAATATGAAAATTAGGCCAGG + Intronic
1161710041 19:5842590-5842612 AATAACAATAATAATAGGCCAGG - Intergenic
1161720932 19:5902258-5902280 AAAAATAAAAATAATAGGCCGGG - Intronic
1161803837 19:6430781-6430803 AAGAAAAGGAAAAGAAGGCCAGG - Intronic
1161867098 19:6841071-6841093 AAGAATACAAAAATTAGGCCCGG - Intronic
1161962656 19:7531191-7531213 AAAAATAATAATAATAGGCTGGG - Intronic
1162114350 19:8419519-8419541 AAAAATAAAAATAATTGGCCGGG + Intronic
1162114559 19:8420956-8420978 AAAAATGAGAAAATTAGGCCAGG - Intronic
1162125298 19:8496427-8496449 AAAAATAAAAATATAAGGCCGGG + Intronic
1162426760 19:10601904-10601926 ATTAATAATAATAATAGGCCGGG - Intergenic
1162431160 19:10629571-10629593 AGTAATAATAATAATAGGCCGGG - Intronic
1162511053 19:11118740-11118762 AAAAATACAAAAAGTAGGCCAGG + Intronic
1162534591 19:11255298-11255320 AAAAAAAAAAAAAGTAGGCCGGG - Intronic
1162543747 19:11315260-11315282 AATAATAATAATAATAGGCCAGG + Intronic
1162571226 19:11474635-11474657 AAATAAAAGAATAATAGGCCAGG - Intronic
1162581186 19:11531495-11531517 TAAAATAATAATAATAGGCCGGG - Intergenic
1162645816 19:12049474-12049496 AAAAAAAAGAATAACAGGCCGGG + Intronic
1162648519 19:12067314-12067336 AAAAATAAGAAAATTAGGCCGGG + Intronic
1162759390 19:12879806-12879828 AAAAATACAAAAAGTAGGCCAGG + Intronic
1162855448 19:13464841-13464863 AAAAATAGGAAAAGTTGGCCGGG - Intronic
1162890150 19:13726899-13726921 AAAAATAATAATAATAGGGCCGG + Intergenic
1163004690 19:14389771-14389793 AAGAGAAAGAAAAGTAGGCCCGG + Intronic
1163100225 19:15091362-15091384 AAAAATACGAAAATTAGGCCGGG + Intergenic
1163309900 19:16507785-16507807 AATAATAATAATAATAGGCCAGG - Intronic
1163352675 19:16788272-16788294 AATAATAATAATAAAAGGCCAGG + Intronic
1163424361 19:17232986-17233008 AAAAATAAGAATAATTAGCCAGG + Intronic
1163480272 19:17551388-17551410 AAAAAAAAGAAATGTAGGCCGGG - Intronic
1163482596 19:17566816-17566838 AAAAAGTAAAATAGTAGGCCAGG + Intronic
1163512766 19:17745829-17745851 AATAATAATAATAATAGGCCGGG + Intergenic
1163512813 19:17746132-17746154 AATAATAATAATAATAGACCAGG + Intergenic
1163733489 19:18964007-18964029 CAAAATAATAATAATAGGCCAGG + Intergenic
1163759282 19:19125968-19125990 AAAAATACAAAAAGTAGGCCGGG + Intronic
1163985946 19:20951716-20951738 AAGAATAAGAACATTAGGCTGGG + Intergenic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164646649 19:29863234-29863256 AAAAATAGTAATAATAGGCCAGG + Intergenic
1164655692 19:29919847-29919869 AACAATATGAATAATTGGCCGGG + Intergenic
1164658029 19:29938969-29938991 AAAAAAAAAAATGGTAGGCCAGG - Intronic
1164826033 19:31285485-31285507 AAAAAAAGGAAAAGTAGGCCAGG + Intronic
1164901496 19:31929908-31929930 AAGAACAAGAATAGTAGCCTAGG - Intergenic
1165000046 19:32753496-32753518 AAAAAAAAGAATAAGAGGCCAGG - Intronic
1165243474 19:34484294-34484316 AAGAATGAGCAGAGGAGGCCAGG + Intronic
1165245658 19:34497156-34497178 AAGATTCAGAAAAGAAGGCCTGG - Intronic
1165312403 19:35036726-35036748 AATAATAATAATAATAGGCTGGG - Intronic
1165330109 19:35136765-35136787 AAGGACAATAATAATAGGCCAGG + Intronic
1165415664 19:35691917-35691939 AATAATAATAATAATAGGCCAGG + Intergenic
1165457361 19:35920725-35920747 AATAATAATAATAATAGGCCAGG - Intergenic
1165474523 19:36022758-36022780 AAAAATAAAAATAAAAGGCCAGG + Intronic
1165688682 19:37845110-37845132 AAGAAAAAGAAAAAAAGGCCGGG + Intergenic
1165706065 19:37977134-37977156 AAAAATAATAATGGTAGGCTAGG - Intronic
1165804006 19:38569300-38569322 AAGATTAAAAATATTCGGCCAGG - Intronic
1165857151 19:38886276-38886298 AAGATTTAGAATAGTGGGCAAGG - Intronic
1165899480 19:39162254-39162276 AAAAATAAGAATAACAGGCTGGG - Intronic
1165905725 19:39193553-39193575 AAAAACAATAATAATAGGCCGGG - Intergenic
1165911864 19:39234032-39234054 AAAAAAAATAATAGTAGGCCAGG + Intergenic
1165938773 19:39404661-39404683 AAGAAAAAAAAAAGGAGGCCCGG + Intergenic
1165951967 19:39479251-39479273 AAAATTAATAATAATAGGCCGGG - Intergenic
1166064614 19:40349963-40349985 AAAAATAATAATAATAGGCCAGG + Intronic
1166192580 19:41184958-41184980 AAAAAAAAAAAAAGTAGGCCGGG + Intergenic
1166350177 19:42194223-42194245 AAAAATAATAATAATAAGCCAGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166545142 19:43629910-43629932 AATAATAATAATAATTGGCCAGG - Intronic
1166844773 19:45720426-45720448 AAAAATACAAATATTAGGCCAGG - Intronic
1166860409 19:45807185-45807207 AAAAATAATAATAATATGCCAGG - Intronic
1166948097 19:46409333-46409355 AAAAATAAGAAACTTAGGCCAGG + Intergenic
1166987096 19:46667404-46667426 AAGAATAAGAATCTGGGGCCCGG + Intergenic
1167129824 19:47577154-47577176 AAGAAAAAGAAAAGAAGGCCAGG - Intergenic
1167164349 19:47788297-47788319 AAAAAAAAGAAAAGCAGGCCGGG - Intergenic
1167253122 19:48411668-48411690 AATAAGAAGAATAGTTGGTCAGG + Intronic
1167255048 19:48422315-48422337 AAGAATTATACTAGTAAGCCGGG + Intronic
1167303157 19:48691320-48691342 AAGAAAAAAAATTGTAGGCCGGG - Intergenic
1167354631 19:48995688-48995710 AAAAATAAGAAAATTAGGCCGGG + Intronic
1167388529 19:49179051-49179073 AAAAATAATAATAATAGGCCGGG - Intronic
1167407593 19:49324032-49324054 AAAAATAATAATAATAGGCTGGG + Intronic
1167412436 19:49352833-49352855 ATTAATAAGAAAAGGAGGCCAGG - Intronic
1167445019 19:49532667-49532689 AATAATAACAATAATAGGCCGGG - Intronic
1167445717 19:49536279-49536301 AAAAAAAAAAAAAGTAGGCCGGG - Intronic
1167481918 19:49737910-49737932 AAGAAACAGAAAAATAGGCCGGG - Intergenic
1167589386 19:50395204-50395226 AAGAATAAATAGTGTAGGCCGGG + Intronic
1167589397 19:50395298-50395320 AAGAATAAATAGTGTAGGCCGGG + Intronic
1167610206 19:50503807-50503829 AATAATAATAATAATAGGCCAGG - Intergenic
1167620755 19:50559137-50559159 AAGAAAAAGAAAAGAGGGCCGGG + Intronic
1167864486 19:52313431-52313453 AAAAAAAAGAATTATAGGCCAGG - Intronic
1167895234 19:52575262-52575284 AAAAATACAAAAAGTAGGCCAGG - Intronic
1168009612 19:53520034-53520056 AATAATAATAATAATAAGCCCGG - Intergenic
1168043809 19:53779741-53779763 AAAAATAAGAAAATTAGGCATGG + Intergenic
1168055297 19:53860642-53860664 AATAATAATAATAATAGACCGGG - Intergenic
1168071574 19:53955890-53955912 AAGAATATTAATAGACGGCCGGG + Intergenic
1168074877 19:53975241-53975263 AAAAATAAGCAAAATAGGCCAGG - Intronic
1168105570 19:54163954-54163976 AAGAAGAAGAAGAAGAGGCCGGG - Intronic
1168265115 19:55219026-55219048 AAAAATAAAAAAATTAGGCCAGG - Intergenic
1168282938 19:55315334-55315356 GATAATAATAATAATAGGCCGGG + Intronic
1168436342 19:56320622-56320644 AATAATAATAATAATAAGCCAGG + Intronic
925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG + Intronic
925622027 2:5803606-5803628 AACAATGAGAAGAGGAGGCCTGG + Intergenic
926048678 2:9729154-9729176 GAGAATCAGATTAGGAGGCCTGG + Intergenic
926191647 2:10732675-10732697 AAGAAAAAGAAATGAAGGCCAGG + Intronic
926262145 2:11274959-11274981 AAGAATAATAAGAACAGGCCGGG + Intronic
926301486 2:11607074-11607096 AAAAATAATAATAATAGGCAAGG - Intronic
926588185 2:14711975-14711997 ACCAAAAAGAAGAGTAGGCCTGG + Intergenic
926739346 2:16098140-16098162 AAAAATAAGAATGCTAGGCCAGG - Intergenic
926950197 2:18234467-18234489 AAGAGTCAGAATAGAAAGCCGGG - Intronic
927018862 2:18997088-18997110 AAGAATATGAAGAGGGGGCCAGG + Intergenic
927229519 2:20808364-20808386 AAGAATAACAAGACAAGGCCGGG + Intronic
927512897 2:23655540-23655562 AAGAACAAGAATGGCTGGCCAGG - Intronic
927563620 2:24091933-24091955 ATGAAAAAGAATAGTAGGGTTGG + Intronic
927590015 2:24347389-24347411 AAAAATACAAATTGTAGGCCAGG + Intronic
927985988 2:27410749-27410771 AAAAAAAACAATAGTAGGCGGGG - Intergenic
928013658 2:27634049-27634071 AAGAATAACAAAAGTTGGCAAGG - Intronic
928335344 2:30393275-30393297 AATAATAATAATAATAGGCTGGG + Intergenic
928349676 2:30538352-30538374 ATGAAAAAGAAAATTAGGCCAGG + Intronic
928514100 2:32028974-32028996 AAGAATAATAATAATAGGCCGGG + Intronic
928549173 2:32355084-32355106 AAAAATAGGAATACTTGGCCGGG - Intergenic
928628309 2:33164053-33164075 AAGATTAAGAATAATGGGCCGGG + Intronic
928681850 2:33710842-33710864 AAGAAAAAGAATTAGAGGCCAGG + Intergenic
928885208 2:36140796-36140818 AAAAATCATCATAGTAGGCCAGG + Intergenic
929139162 2:38652083-38652105 AAGAAAAAGAAAAAGAGGCCAGG + Intergenic
929224198 2:39496135-39496157 AAAAATAAGAAAAGTTAGCCAGG - Intergenic
929320187 2:40533695-40533717 AAGAATAAGAATACTATGTTAGG - Intronic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
929523857 2:42681223-42681245 AAGACAAAGAATAGATGGCCAGG - Intronic
929566160 2:42986410-42986432 AAAAAAAAGAAAGGTAGGCCTGG + Intergenic
929621912 2:43363924-43363946 AAAAATAAAAAAATTAGGCCAGG + Intronic
929739136 2:44584757-44584779 ATTAAAAAAAATAGTAGGCCGGG + Intronic
929842828 2:45487945-45487967 AGTAATAAAAATAATAGGCCGGG - Intronic
929895610 2:45958212-45958234 AAGAAAAAGAAAATTGGGCCAGG + Intronic
930362159 2:50394825-50394847 AGGAAAAAGAGTAGGAGGCCAGG - Intronic
930671691 2:54158335-54158357 AAAAATAAGAAAAGCAGGCCGGG - Intronic
930801890 2:55451388-55451410 AAGAACATGAATTCTAGGCCGGG - Intergenic
930897354 2:56461914-56461936 AAGAACACCAAGAGTAGGCCCGG + Intergenic
931187332 2:59966073-59966095 AAAAAAAAGATGAGTAGGCCGGG + Intergenic
931272492 2:60715242-60715264 CAAAATAATAATAATAGGCCGGG + Intergenic
931280883 2:60790791-60790813 AAGAATTAGCTTAGAAGGCCAGG + Intronic
931391613 2:61849488-61849510 AAAAATAAAAAAATTAGGCCAGG + Intronic
931537167 2:63291836-63291858 AAGAAAAAGAAAAGAAGGCCGGG + Intronic
931582782 2:63795368-63795390 AAGAATAAGAATGTTGAGCCAGG + Intronic
931935242 2:67189393-67189415 AAAAAAAAGAATAGTAGGATGGG - Intergenic
932577275 2:72969688-72969710 AAAAAAAAAAAAAGTAGGCCGGG - Intronic
932652922 2:73579353-73579375 AAGAAAAAAAAAAGAAGGCCAGG - Intronic
932765837 2:74469248-74469270 TAAAATAAAAAAAGTAGGCCGGG - Intergenic
933281637 2:80338282-80338304 AAGAAAAAGAAAAAAAGGCCAGG - Intronic
934285614 2:91648115-91648137 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
934919020 2:98326997-98327019 AAAAAAAAAAAAAGTAGGCCAGG + Intergenic
935004286 2:99055906-99055928 GAAAATAACAATAGTCGGCCAGG + Intronic
935417194 2:102831459-102831481 AAGAAGAAGAGTGGTGGGCCAGG + Intronic
935808810 2:106775200-106775222 AAAAATAAGAAAAATAGGCATGG + Intergenic
936364529 2:111840745-111840767 TAAAATAAGAAAAGAAGGCCAGG + Intronic
936468939 2:112780740-112780762 AATAATAATAATCATAGGCCGGG + Intronic
936473563 2:112820021-112820043 AAAAATAAAAAAATTAGGCCAGG - Intergenic
936611994 2:114010648-114010670 AAAAATAAAAAGATTAGGCCAGG + Intergenic
936816406 2:116466373-116466395 AAAAATATCAATAGTTGGCCTGG - Intergenic
936851259 2:116900730-116900752 AAGAAAAAGAAAAAAAGGCCAGG - Intergenic
937423053 2:121774529-121774551 CAGAAAAAGAAAAGTGGGCCGGG + Intergenic
938450893 2:131418752-131418774 AAGTATAAGAATAGCCAGCCAGG - Intergenic
938830801 2:135048830-135048852 AAAAATAAAAAAATTAGGCCAGG + Intergenic
939154249 2:138505459-138505481 AAGAAAAAAAATTATAGGCCAGG + Intronic
939510942 2:143103749-143103771 AAGAACCAGAAAAGTAGGCTGGG - Intronic
939582240 2:143964451-143964473 AATTATAAGAAGATTAGGCCAGG - Intronic
939635515 2:144577285-144577307 AAGAATAAGAATAGTCACTCTGG - Intergenic
939965336 2:148605024-148605046 GAGAATAAGAATCCTGGGCCGGG - Intergenic
940153898 2:150632825-150632847 CAGATTAAGAAAAGTAGGTCAGG + Intergenic
940835524 2:158516954-158516976 AAAAATAAGAAAAGTAGGCCGGG - Intronic
940865512 2:158813848-158813870 AAGAAAAAGGAAAGGAGGCCGGG - Intronic
941171325 2:162140840-162140862 AAGAAGAAGAAATGTAGGCAAGG - Intergenic
941707493 2:168675287-168675309 AAAAATAACAACAATAGGCCGGG + Intronic
942230555 2:173857691-173857713 AAAAATTAGAATTCTAGGCCAGG + Intergenic
942611181 2:177744053-177744075 AAGAAAGGGAATAGTAGGGCTGG + Intronic
942984386 2:182121795-182121817 AAGAATAAGTAGGGTAGGCCGGG - Intronic
943289198 2:186046805-186046827 AAAAATAATAATAGTTGGCCAGG - Intergenic
943312495 2:186344345-186344367 AAGAATATTAAAAGTTGGCCAGG + Intergenic
943676843 2:190724021-190724043 AATTATAAGAATTCTAGGCCAGG + Intergenic
944087685 2:195868377-195868399 AAAAAGATGAATAATAGGCCAGG - Intronic
944246973 2:197541194-197541216 AAGAAAAAGTACAGTAGGCCAGG - Intronic
944723735 2:202449014-202449036 AAGAGTTAAAATAGCAGGCCTGG + Intronic
944823591 2:203457477-203457499 AAAAATTAAAATATTAGGCCAGG - Intronic
944871834 2:203919918-203919940 AAGAATACGACTTGTTGGCCAGG + Intergenic
945079008 2:206070113-206070135 AAGAATACAAAAATTAGGCCAGG + Intronic
945092858 2:206192136-206192158 AAAAATACAAAAAGTAGGCCTGG - Intronic
945113120 2:206383121-206383143 AATAAAAAGAAAAGGAGGCCGGG - Intergenic
945129417 2:206552961-206552983 AATAATAGTAATAATAGGCCAGG - Intronic
945674325 2:212837125-212837147 AAAAATAATAATAGCAGGCTGGG - Intergenic
945897655 2:215502904-215502926 AATAATAACAAAAATAGGCCAGG + Intergenic
946237975 2:218336774-218336796 AAAAAAAAGAATTGAAGGCCAGG - Intronic
946240264 2:218349622-218349644 AAGAATAAGAAATTGAGGCCAGG - Intergenic
946442711 2:219710375-219710397 AAAAATAATAATAATAGGCCGGG - Intergenic
946734716 2:222742879-222742901 AATAATAATAATAATAGGCTGGG - Intergenic
946747046 2:222856603-222856625 ATGAAGAAGAAGAGTTGGCCGGG + Intergenic
946909726 2:224447606-224447628 AATAATAAAAAAAGAAGGCCGGG - Intergenic
946946001 2:224823279-224823301 AAGACTAAGGTTAGAAGGCCGGG - Intronic
947220450 2:227786819-227786841 AAGAATGGGAATAATAGGCATGG + Intergenic
947588005 2:231368916-231368938 AATAATTAGAAAAATAGGCCGGG - Intronic
947604162 2:231473141-231473163 AAAATTAAAAATAGAAGGCCAGG + Intronic
947616468 2:231560433-231560455 AATAATAATAATAATGGGCCAGG + Intergenic
947830534 2:233138054-233138076 AATAAAAAGCAAAGTAGGCCGGG + Intronic
948929878 2:241125303-241125325 AAAAATAAAAAAAATAGGCCGGG + Intronic
1169560223 20:6791940-6791962 AAGAAAAATAATTGTAGGCTGGG + Intergenic
1169735412 20:8832670-8832692 AAGAATCAGAATCGAAAGCCTGG + Intronic
1169768417 20:9174438-9174460 AAAAAAAAGAAGAATAGGCCAGG - Intronic
1169914711 20:10673734-10673756 CAGAATAATAAAAGGAGGCCGGG - Exonic
1170143147 20:13145068-13145090 AAGAATACACATAGTAGGCCAGG - Intronic
1170585575 20:17731769-17731791 AAAAAAAAAAAAAGTAGGCCAGG + Intronic
1170826196 20:19798144-19798166 AAGATTAAGTAGAATAGGCCGGG - Intergenic
1171749564 20:29035679-29035701 AAGAAAGAGAAAAGCAGGCCGGG + Intergenic
1171948364 20:31398533-31398555 AAAAATACAAATATTAGGCCAGG - Intergenic
1172038959 20:32030540-32030562 AATAATAACAAAAATAGGCCTGG + Intronic
1172148606 20:32775015-32775037 AAAAATAAAAAAATTAGGCCAGG - Intronic
1172150079 20:32784196-32784218 AAGAATACAAAAATTAGGCCAGG - Intronic
1172251839 20:33485126-33485148 TATATTAAGAATATTAGGCCAGG - Intergenic
1172261828 20:33573774-33573796 AATAATAATAATAATAGGGCCGG - Intronic
1172353875 20:34265652-34265674 AAAAATAAGTAAAGTTGGCCGGG + Intronic
1172389256 20:34555438-34555460 AAAAATGAGAAAATTAGGCCAGG - Intronic
1172542289 20:35728080-35728102 AAAAATAAGAATTGTAGGCCAGG - Intronic
1172549553 20:35788389-35788411 AAAAATAAAAAAAATAGGCCAGG - Intronic
1172636147 20:36411282-36411304 AAGAATTTGAATTGAAGGCCAGG - Intronic
1173645486 20:44630725-44630747 AAGCAGAAAAATAGGAGGCCGGG + Intronic
1173767170 20:45623163-45623185 AAGAAAAACAAAATTAGGCCAGG + Intronic
1173912283 20:46679259-46679281 AGGAATAAGAAGGGTAGGCCGGG + Intronic
1173966972 20:47119910-47119932 AAAAATAAGTAAAATAGGCCGGG + Intronic
1174000911 20:47374018-47374040 AATAATAATAATAATAGGCCAGG - Intergenic
1174219623 20:48943497-48943519 AAGTACAAGAATGGTGGGCCAGG - Intronic
1174262742 20:49308484-49308506 AAAAATAATAATAATAGGCCGGG - Intergenic
1174369122 20:50074445-50074467 AAATATAATAATAATAGGCCTGG - Intergenic
1174466443 20:50721254-50721276 AAAAAAAAGAAGAGCAGGCCGGG - Intergenic
1174505057 20:51012086-51012108 AAGATAAATAATAATAGGCCGGG - Intronic
1175118055 20:56697385-56697407 AAAAATAATAATAATAGGCCTGG - Intergenic
1176199035 20:63851768-63851790 AAAAATACGAAAATTAGGCCGGG + Intergenic
1176315672 21:5240324-5240346 AAGAAAGAGAAAAGCAGGCCGGG - Intergenic
1176327046 21:5510030-5510052 AAGCATAAGGCTAGAAGGCCTGG + Intergenic
1176400711 21:6310921-6310943 AAGCATAAGGCTAGAAGGCCTGG - Intergenic
1176436446 21:6678183-6678205 AAGCATAAGGCTAGAAGGCCTGG + Intergenic
1176460708 21:7005253-7005275 AAGCATAAGGCTAGAAGGCCTGG + Intergenic
1176484269 21:7387031-7387053 AAGCATAAGGCTAGAAGGCCTGG + Intergenic
1176807741 21:13505000-13505022 AAGAAATAAAATAATAGGCCAGG - Intergenic
1177046963 21:16182945-16182967 AAGAAGAAGAATAGGAGGAAGGG - Intergenic
1177048586 21:16202548-16202570 AATATTAAGAATTGGAGGCCGGG - Intergenic
1177107594 21:16979043-16979065 AAGTAGAAGAATAGTAGGTATGG - Intergenic
1177118598 21:17114714-17114736 AAGAACACAAAAAGTAGGCCAGG + Intergenic
1177356268 21:20012265-20012287 AATAATGAAAATTGTAGGCCGGG + Intergenic
1177451825 21:21278515-21278537 AAGAATAAGAAAAGTAGCCAAGG - Intronic
1177946044 21:27471056-27471078 AAGAATGAGAAAAGTACGCCGGG + Intergenic
1178517599 21:33262065-33262087 GGGCATAAGAATAGTAAGCCTGG + Intronic
1178839838 21:36129984-36130006 AAAAATAAAAATAGGCGGCCGGG + Intergenic
1178924850 21:36766316-36766338 AATTTTAAGAAAAGTAGGCCAGG - Intronic
1179020105 21:37632075-37632097 AAGTATCAGAAAAGGAGGCCCGG + Intronic
1179176299 21:39010562-39010584 AAGACTCAGGATAGTAGCCCTGG - Intergenic
1179220591 21:39403606-39403628 AAAAATAAAAATAGTAGACCGGG - Intronic
1179834445 21:44020418-44020440 AAAAATAAGAAAAATGGGCCAGG - Intronic
1179875395 21:44264438-44264460 AAGAAAAAGAAAAACAGGCCGGG - Intergenic
1180644942 22:17331208-17331230 AAAAATAATAATAATAGGCCAGG + Intergenic
1180795141 22:18599958-18599980 CAAAATAATAATAATAGGCCGGG + Intergenic
1180941564 22:19662651-19662673 AAAGATAAGAATTTTAGGCCAGG - Intergenic
1180974469 22:19839900-19839922 AATAATAATAATAATAAGCCAGG + Intronic
1181103908 22:20560556-20560578 ATAAATAATAATAATAGGCCAGG - Intronic
1181139041 22:20790363-20790385 AAAAATAAAATAAGTAGGCCAGG + Intronic
1181226598 22:21395359-21395381 CAAAATAATAATAATAGGCCGGG - Intergenic
1181252051 22:21539479-21539501 CAAAATAATAATAATAGGCCGGG + Intergenic
1181724181 22:24799919-24799941 GTGAATAAGAAAAATAGGCCAGG - Intergenic
1181727066 22:24818849-24818871 AAAAATAACAATAATTGGCCGGG + Intronic
1181970053 22:26683091-26683113 AAGAAAAAAAAAAGAAGGCCAGG - Intergenic
1181997530 22:26894413-26894435 AATAATAATAATAATAGGCTGGG - Intergenic
1182125686 22:27814208-27814230 TTTAATAAGAACAGTAGGCCAGG + Intergenic
1182288718 22:29263336-29263358 AAAAATAAAAAAATTAGGCCAGG - Intronic
1182340207 22:29614280-29614302 AAAAATACAAAAAGTAGGCCGGG + Intronic
1182850529 22:33470183-33470205 AAGAGTAAACATAGTAGGCCAGG - Intronic
1182977119 22:34633940-34633962 AAGAATAATAATAGCCGGCCGGG + Intergenic
1182997947 22:34831709-34831731 AAGAAAAAGCACAGTGGGCCGGG + Intergenic
1183204223 22:36407455-36407477 AATAATAATAATAATAGGCTGGG + Intergenic
1183455877 22:37922931-37922953 AAAAATAATAATAATAGGCTGGG - Intronic
1183537082 22:38409368-38409390 AATAATAATAACTGTAGGCCAGG - Intergenic
1183558251 22:38548576-38548598 AAGAAGAAAAAAATTAGGCCAGG + Intronic
1183677549 22:39308027-39308049 AAAAATACAAATATTAGGCCGGG + Intergenic
1183691411 22:39390933-39390955 AATAATAATAATAATAGGCCAGG + Intergenic
1183911442 22:41082461-41082483 AATAATAACAAAAGAAGGCCAGG + Intergenic
1183993197 22:41612747-41612769 AAAAAAAAAAAAAGTAGGCCTGG - Intronic
1184105151 22:42363114-42363136 AACAATAATAATAATAGGACCGG - Intergenic
1184150467 22:42635397-42635419 AACAATACGAAAATTAGGCCAGG - Intronic
1185353419 22:50350548-50350570 AATAATAAGAAAATTAGGCTGGG + Intronic
1185362446 22:50416624-50416646 AAGAAAAAAAAGTGTAGGCCAGG - Intronic
1185404170 22:50636884-50636906 AAGAAAAGGAGGAGTAGGCCCGG + Intergenic
949553904 3:5135750-5135772 AATAATAATAATAATAGGCCAGG - Intronic
949553951 3:5136081-5136103 AATAATAATAATAATAGGCCAGG - Intronic
949680330 3:6506172-6506194 AAGAATAAAATTGATAGGCCAGG + Intergenic
949688535 3:6607449-6607471 AAAAAAAAGCATAATAGGCCAGG - Intergenic
949835961 3:8270498-8270520 AACAATAAAAATAAAAGGCCAGG + Intergenic
950071778 3:10158443-10158465 AAAAAAAAGAAAAGGAGGCCGGG - Intergenic
950074390 3:10177094-10177116 AAAAATAAACAAAGTAGGCCGGG - Intronic
950394529 3:12723752-12723774 AAGACTAAAAAGAGTAGCCCAGG + Intergenic
950485520 3:13271498-13271520 AAGAATAATAATTGGAGGCTGGG + Intergenic
950733186 3:14980456-14980478 AAGAGTAAGAATTTTAGGCTGGG - Intronic
950796995 3:15518239-15518261 TTCAAAAAGAATAGTAGGCCAGG - Intronic
951885460 3:27519926-27519948 AAGAAAAAAAATAGAAGGCTGGG + Intergenic
952014675 3:28942262-28942284 AACAATAATAATAGCAGGCCAGG - Intergenic
952397625 3:32934934-32934956 AATAATAATGATAATAGGCCGGG + Intergenic
952611798 3:35218885-35218907 AAGAATAAGAGTAGCAGGAAAGG - Intergenic
952633370 3:35497264-35497286 AAGAATAAGAAAAATAGGCCAGG + Intergenic
952703989 3:36358168-36358190 AAAAAAAAGAATCATAGGCCAGG - Intergenic
952802520 3:37309258-37309280 AAAAATAACAATTATAGGCCGGG + Intronic
952812043 3:37412669-37412691 CAGAATAAGAAAAATAGGCCAGG + Intronic
953323846 3:41996050-41996072 AATAATAATAATAATAGGGCTGG - Intergenic
953710096 3:45262795-45262817 AATAATAATAATAATAGGCCAGG + Intergenic
953944229 3:47132069-47132091 AAGAATATGCAAACTAGGCCAGG - Intronic
953994035 3:47505865-47505887 AAAAATAAAAAAATTAGGCCGGG - Intronic
954012617 3:47655399-47655421 AAAAAAAATAATAATAGGCCAGG + Intronic
954068790 3:48127947-48127969 AAAAAAAAGATAAGTAGGCCTGG + Intergenic
954069754 3:48134353-48134375 AGTAATAATAATAATAGGCCGGG - Intergenic
954255793 3:49404950-49404972 AATAATAAAAAAAGTAGGCCAGG + Intronic
954260485 3:49435178-49435200 AAAAATAAGAATATAAAGCCGGG + Intergenic
954260677 3:49436452-49436474 AAGAATAAGATAACTAGGCCAGG + Intergenic
954311026 3:49767281-49767303 AAAAATAATAATAATTGGCCAGG + Intronic
954454419 3:50589898-50589920 AAAAATAATAATAATAGGCCAGG + Intergenic
954739438 3:52736289-52736311 AAAAATAATTATAGCAGGCCGGG + Intronic
954776120 3:53020102-53020124 AAGAAAAAAAAAAGTAGGCCGGG + Intronic
954970849 3:54650658-54650680 AAAAATACAAAAAGTAGGCCTGG - Intronic
955226819 3:57067154-57067176 AAGAATAACATTTGTCGGCCAGG + Intronic
955287151 3:57653448-57653470 AAAAATATTAGTAGTAGGCCGGG + Intronic
955320890 3:57973444-57973466 AATAATAAAAATATTAGGCTGGG + Intergenic
955885838 3:63597208-63597230 AAGAATAATAATTGTGGCCCTGG - Intronic
956443959 3:69307632-69307654 AAGAAAAGAAATAGTAGGCCGGG - Intronic
957245258 3:77708478-77708500 AAGAAAAAGAATCCTAGGGCAGG + Intergenic
957450621 3:80377290-80377312 AAAAAGAAGTACAGTAGGCCAGG - Intergenic
957789911 3:84927415-84927437 AGGAATAAGAATAATAGGATGGG + Intergenic
957825291 3:85434310-85434332 AAAAATGAAAATAGTAAGCCAGG - Intronic
957833287 3:85551275-85551297 AAGAAAATGAATACTAGGCAGGG - Intronic
957839671 3:85652110-85652132 AAAAATAAGTTTAGTTGGCCAGG - Intronic
958117687 3:89242730-89242752 AAGAAAGAAAATACTAGGCCAGG - Intronic
958265216 3:91430160-91430182 GAAAATAGGAGTAGTAGGCCAGG - Intergenic
958890635 3:99778726-99778748 AAGAATGAAAACAGTAGGCATGG + Intronic
958927765 3:100177821-100177843 AACAATAATAATAATAGGCCAGG + Intronic
959089548 3:101887386-101887408 AAGAAATAGAAAAGTAGGCTGGG - Intergenic
959538045 3:107509398-107509420 AAAAATAAGAAGAATAGGGCTGG - Intergenic
959708324 3:109359671-109359693 AAGAATAAGGTTCCTAGGCCGGG - Intergenic
960324431 3:116277664-116277686 AAAAATAAGAAGAGCAGGCCGGG - Intronic
960394380 3:117118324-117118346 AAGAAGAAAAACAATAGGCCCGG - Intronic
960399384 3:117177576-117177598 AAAAAAAAAAATAGCAGGCCGGG - Intergenic
960444644 3:117732990-117733012 AAAATTAATAATAATAGGCCAGG - Intergenic
960945958 3:122966851-122966873 AATAATAATAGTAATAGGCCGGG - Intronic
961732298 3:128974824-128974846 AAAAAAAAGAAGAGAAGGCCAGG + Intronic
962225189 3:133600223-133600245 AAAAAAAAGAATTGCAGGCCAGG - Intronic
962244538 3:133781021-133781043 AAAAATAATAATAATAGGCAGGG + Intergenic
962571117 3:136714431-136714453 AAAAATAAGAAAATTAGGCCGGG + Intronic
962584738 3:136830576-136830598 AAAAATACAAAAAGTAGGCCAGG - Intronic
962736059 3:138326728-138326750 ATTAAGAACAATAGTAGGCCAGG - Intronic
962859162 3:139381725-139381747 AAAGATAAGAAAAGTACGCCTGG + Intronic
962950418 3:140213489-140213511 AAGAATCAGCAGAGAAGGCCTGG - Intronic
963137995 3:141924967-141924989 AATAATAATGATAATAGGCCGGG + Intronic
963263515 3:143216348-143216370 AAGAATATGACTAGTCAGCCTGG + Intergenic
963588635 3:147227805-147227827 AATAATAATAATAATAGGCCCGG - Intergenic
963611087 3:147469609-147469631 AAAAATAAGAATAGAAGGAGGGG - Intronic
963698243 3:148590235-148590257 AAGAAAAATAAAAGTAAGCCAGG + Intergenic
963705883 3:148687722-148687744 AGAAATAACCATAGTAGGCCAGG - Intergenic
963881220 3:150531091-150531113 ATGATTAAAAATAATAGGCCGGG - Intergenic
964044546 3:152307282-152307304 ATAAATATGAATAGTAGGCTGGG - Intronic
964224173 3:154378241-154378263 AATAATAATAATAATAAGCCAGG - Intronic
964348741 3:155781780-155781802 AAAAAAAAAAATAGTGGGCCGGG + Intronic
964351933 3:155811714-155811736 AAGAAAAGGAAAAGAAGGCCGGG + Intergenic
964451747 3:156819349-156819371 TAAAATAAGTATAGTAGCCCTGG - Intergenic
965032342 3:163388577-163388599 AAGAATATGAAAAATAGGGCAGG - Intergenic
965388375 3:168073512-168073534 AAGGATTAGAATAGTGGGCATGG + Intronic
965466536 3:169036901-169036923 AAGAATAAAAATACTTGGCCAGG - Intergenic
965580973 3:170267376-170267398 AAGAAAAGCAGTAGTAGGCCGGG + Intronic
965899619 3:173622551-173622573 AAGAAGAAGAAAAATAGTCCCGG + Intronic
965985728 3:174750727-174750749 ATTAAGAAGAATAATAGGCCGGG - Intronic
966206874 3:177413774-177413796 TAGAAAAAGAAAAGTTGGCCGGG - Intergenic
966510134 3:180753033-180753055 AATAATAATAATAATAGGCTGGG - Intronic
966598506 3:181750137-181750159 AATAATAAGAGTAGTTGGCTGGG - Intergenic
966662727 3:182432270-182432292 AAAATTAAGAAAAGCAGGCCAGG + Intergenic
966805590 3:183805101-183805123 AAGAATAAGAAGGGTTGGGCCGG + Intronic
967032380 3:185620027-185620049 AAGAAAAAGAAAAAAAGGCCAGG - Intronic
967091868 3:186141496-186141518 AATAATAAAAATAATAGGCCGGG - Intronic
967207501 3:187137515-187137537 AAGAAAAAGAAAAATTGGCCGGG + Intronic
967305492 3:188054913-188054935 AAGAATGAAAATATGAGGCCAGG + Intergenic
967704194 3:192630851-192630873 AAGAAAAAAAAAAGTGGGCCGGG - Intronic
968142329 3:196268632-196268654 AAAAATAAAAATAGTAAGCCAGG + Intronic
968367484 3:198197801-198197823 AAAAATAAAAATAATTGGCCAGG - Intergenic
968763334 4:2454294-2454316 AAAAATACAAAAAGTAGGCCGGG - Intronic
968777010 4:2548364-2548386 AAAAATAGGCAAAGTAGGCCGGG - Intronic
968846712 4:3047014-3047036 AAGAATAGTTATACTAGGCCGGG + Intergenic
968879089 4:3289497-3289519 AAAAATAAAAATTGTAGGCCAGG - Intergenic
969249965 4:5960858-5960880 AATAATAATGATAGTCGGCCTGG + Intronic
969354619 4:6618143-6618165 AAAAATAAAAAAACTAGGCCAGG - Intronic
969684104 4:8659956-8659978 AAAAATATGAAAATTAGGCCGGG - Intergenic
969695764 4:8733432-8733454 AAGAAAAAGAATACAAGGCCGGG + Intergenic
969962057 4:10954694-10954716 AAGAATAATAAAACTTGGCCCGG - Intergenic
969972277 4:11060264-11060286 AAGAACACCAATAGTAGGCCAGG - Intergenic
970158640 4:13167099-13167121 AAGACTAACAATGGGAGGCCAGG + Intergenic
970277653 4:14419038-14419060 AAAAAAAAAAAAAGTAGGCCAGG - Intergenic
970349879 4:15191801-15191823 AAAAATATGCATAGGAGGCCGGG + Intergenic
970398745 4:15697692-15697714 GAAAATAGGAATATTAGGCCAGG + Intronic
970552630 4:17198421-17198443 ACAAATAAGAATAGTCGGCCAGG + Intergenic
970598660 4:17623103-17623125 AAGAAAAATAAACGTAGGCCGGG + Intronic
970674703 4:18435751-18435773 AAGAATGAGAATAGTATGTGGGG + Intergenic
970945321 4:21684270-21684292 TAGAATAAGAAAAGTAGTCATGG - Intronic
970959357 4:21855019-21855041 AAGAATAAGAAGAGTTGGCAGGG - Intronic
971072306 4:23108819-23108841 AAGAATAAGAATATTTATCCTGG - Intergenic
971275454 4:25192269-25192291 AAGAAGAAGAAGATAAGGCCAGG - Intronic
971473626 4:27052250-27052272 AAGAATGAGACAAGTAGGCTGGG - Intergenic
972200892 4:36713666-36713688 AAGAAGAAGAACAGCAGGCTGGG - Intergenic
972282023 4:37611741-37611763 AAGAAAAAGAAAAGTTTGCCAGG + Intronic
972388871 4:38593707-38593729 AGAATTAAGAGTAGTAGGCCAGG - Intergenic
972409600 4:38780105-38780127 AAGAATGAGTTTGGTAGGCCTGG + Intronic
972717652 4:41663878-41663900 AATAATAATAATAGTTAGCCAGG + Intronic
973326172 4:48864547-48864569 AATAATAATAACAATAGGCCAGG - Intergenic
973657309 4:53062074-53062096 AATAATAGTAATAATAGGCCGGG + Intronic
973752035 4:54030826-54030848 AAGAATTAGCATTTTAGGCCAGG - Intronic
973940488 4:55905137-55905159 AATAATAAGTAAAGTAAGCCGGG + Intergenic
974656303 4:64827044-64827066 AAAAATACAAATAGTTGGCCAGG - Intergenic
974701474 4:65453983-65454005 AATAATATGAATTGTGGGCCAGG + Intronic
975122411 4:70743365-70743387 AATAATAATGATAATAGGCCAGG - Intronic
975135691 4:70871945-70871967 AAAAAAAATAATAATAGGCCAGG + Intergenic
975303609 4:72821521-72821543 AAGAATAAAAACAACAGGCCAGG + Intergenic
976097015 4:81518940-81518962 AGGAATAAGAATAGAAGACAAGG + Intronic
976184967 4:82434422-82434444 AAAAATACAAAAAGTAGGCCAGG + Intronic
976268958 4:83211341-83211363 AAAAAAAAGAAAAGTAGGACTGG - Intergenic
976415525 4:84769715-84769737 AAAAATAATAAAAGCAGGCCGGG - Intronic
976602041 4:86946677-86946699 AAGAATAAAGAGAGTGGGCCGGG - Intronic
976630329 4:87229725-87229747 AAAAAAAAAAAAAGTAGGCCAGG - Intronic
976724357 4:88200805-88200827 AAGAATAAGAAAAATAGGCTGGG - Intronic
976843943 4:89465179-89465201 ATGAATAAAAATATTCGGCCAGG + Intergenic
977055936 4:92190565-92190587 AAGACTAAGAAAAAAAGGCCAGG - Intergenic
977602002 4:98943553-98943575 AAAAAAAAAAAAAGTAGGCCGGG - Intergenic
978148170 4:105402256-105402278 AAGAAAAAAAAAATTAGGCCTGG + Intronic
978328873 4:107590008-107590030 AAGAATAAGAAGGTAAGGCCTGG - Intergenic
978701433 4:111651251-111651273 AACAATAAGAAACGTAGGACTGG + Intergenic
978794540 4:112696053-112696075 AAAAATAATAATAATAGGTCGGG + Intergenic
978880592 4:113697537-113697559 AAGAAAATATATAGTAGGCCAGG - Intronic
979168917 4:117574223-117574245 AAGATTAATAAAAGTAGGACTGG + Intergenic
979255901 4:118607507-118607529 AAAAATAAAAATAATTGGCCAGG - Intergenic
979332444 4:119433033-119433055 AAAAATAAAAATAATTGGCCAGG + Intergenic
979623844 4:122825501-122825523 AAAAATAAAAACAGTATGCCTGG + Intergenic
979711411 4:123784172-123784194 ATGAATAAAAATAGCAGCCCAGG + Intergenic
979933023 4:126655931-126655953 AAAAAAAAGAACAGGAGGCCAGG - Intergenic
979936092 4:126698324-126698346 AAGAATAAGTATATTAGACAAGG + Intergenic
980063147 4:128153641-128153663 AATAATAAGAGAAGTAGGCCAGG - Intronic
980467051 4:133200091-133200113 TAGAATAAAAATAAAAGGCCGGG - Intronic
980736784 4:136900447-136900469 ATGAAGATGAATAGTTGGCCAGG + Intergenic
980809786 4:137861195-137861217 AAGAATCAGGATAATTGGCCAGG + Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
981007012 4:139885626-139885648 AACAAAAAAAAAAGTAGGCCGGG + Intronic
981524533 4:145696735-145696757 ACAAATAAAAATTGTAGGCCGGG + Intronic
981610804 4:146591636-146591658 AATAATAATAATAATAAGCCAGG - Intergenic
981828615 4:148974086-148974108 AAGAAAAAGAATTGTCGACCGGG - Intergenic
982005678 4:151060786-151060808 AAAAATAAAAAAATTAGGCCAGG - Intergenic
982230388 4:153203594-153203616 AAAAAAAAAAATAGTAGACCAGG + Intronic
982356906 4:154480919-154480941 TATAATTAGAATATTAGGCCAGG - Intronic
982361880 4:154527370-154527392 AAGAAAAAGAAAATTAAGCCAGG + Intergenic
982384559 4:154786631-154786653 AAAAAAAAAAACAGTAGGCCAGG + Intronic
982511903 4:156292964-156292986 AAGAACAAGCACATTAGGCCAGG - Intergenic
982740515 4:159052929-159052951 AATAATAATAATAGTCGACCAGG - Intergenic
982757171 4:159234755-159234777 AAAAATAATAATAATAGGCTGGG - Intronic
983158318 4:164379688-164379710 AAGAATAACAAATGTTGGCCGGG + Intronic
983226920 4:165094194-165094216 AAAAATACGAAAATTAGGCCAGG - Intronic
983511513 4:168613948-168613970 AAGAATAACACTATTAGGTCTGG - Intronic
983652986 4:170052087-170052109 AGTAATAAGCATAATAGGCCGGG - Intergenic
983687045 4:170422651-170422673 AAGGGTAAAAATAGTAGGGCTGG + Intergenic
984010413 4:174364463-174364485 AACATTAAAAATAGTGGGCCGGG + Intergenic
984395565 4:179194184-179194206 AAAAATAAGAAAAATAGGCCGGG - Intergenic
984743237 4:183187573-183187595 AATAATAATAATAATAGGCATGG + Intronic
984796998 4:183671023-183671045 AAAAATACAAATATTAGGCCAGG - Intronic
984803414 4:183734667-183734689 AAAAATAATAATAATAGGTCTGG - Intergenic
984885431 4:184445356-184445378 GAAAATAAGAACAATAGGCCAGG + Intronic
984936568 4:184894950-184894972 AAGTAGAAGAAAAGGAGGCCGGG - Intergenic
984974069 4:185214933-185214955 AAGAACTAGAATAATGGGCCTGG + Intronic
985263588 4:188137770-188137792 AAAAATATGAAAATTAGGCCGGG - Intergenic
985431442 4:189885225-189885247 AAGAAAGAGAAAAGCAGGCCGGG + Intergenic
985782661 5:1879284-1879306 ACGTATAAAAATAGTAGGCCGGG - Intronic
986647377 5:9930598-9930620 AAGAAGAGGAAGAGTTGGCCGGG - Intergenic
986910119 5:12545291-12545313 AAAAACAAAAATAATAGGCCGGG - Intergenic
987018667 5:13847427-13847449 AAAAAAAAGAAAAATAGGCCAGG + Intronic
987417606 5:17680329-17680351 AAAAATAAGCATTGTTGGCCGGG - Intergenic
988521801 5:31952762-31952784 AAAAATAAGAATAGCAGCCCAGG + Intronic
988559693 5:32269320-32269342 AATAATAATAATAATAGGCTGGG - Intronic
989334082 5:40293997-40294019 TAGAATGAGAAAAATAGGCCGGG - Intergenic
989571139 5:42947207-42947229 AAGAATAAAAAAATTAGGCTGGG + Intergenic
989686241 5:44090457-44090479 AAGAAGAAGAATAGTGGGGAGGG - Intergenic
990369789 5:55105675-55105697 ATTAATAAAAAGAGTAGGCCGGG + Intronic
990389094 5:55300376-55300398 AATAATAATAATAATAGGCCAGG + Intronic
990574118 5:57108433-57108455 GAGATTAAGAATTTTAGGCCAGG + Intergenic
990581074 5:57168136-57168158 TATAATTAGAAAAGTAGGCCAGG + Intergenic
990782949 5:59386655-59386677 AAGAAAAAGAAAAGAAGGGCAGG + Intronic
992097736 5:73378739-73378761 AAGACTTAGAATAGTAGGAAGGG - Intergenic
992635653 5:78723712-78723734 AAGAATCAGAAATCTAGGCCAGG + Intronic
992718977 5:79540697-79540719 AAGAAAAAAAATTGTAGGCTAGG + Intergenic
992719899 5:79550533-79550555 AAGATTAAAAAAATTAGGCCGGG + Intergenic
992735207 5:79712506-79712528 AAGAAGAAAAAAAATAGGCCGGG - Intronic
992756249 5:79909114-79909136 AATAATAATAATAATAAGCCAGG - Intergenic
992806670 5:80344531-80344553 AAGAATAACACTATTATGCCAGG - Intergenic
992880937 5:81109359-81109381 AAAAATTAAAATAATAGGCCAGG + Intronic
992933760 5:81679302-81679324 AAGAATAAGAAAAGTAGTCTGGG - Intronic
992935348 5:81697611-81697633 AAGATTAAGAATATTTGGGCTGG - Intronic
993719175 5:91305205-91305227 GAAAATGAGAATAATAGGCCAGG - Intergenic
994116958 5:96071570-96071592 AAGATTAAGAACAATAGGCCTGG - Intergenic
994581545 5:101648818-101648840 AAGAATAATAAGAACAGGCCGGG + Intergenic
994993654 5:107031242-107031264 AATAATAATAATAATAGGCCAGG - Intergenic
995119738 5:108522970-108522992 AAAAAGAACAAAAGTAGGCCAGG - Intergenic
995211495 5:109544745-109544767 AATAATAATAATAATAGGCCAGG - Intergenic
995419404 5:111946563-111946585 AAGAATAAGAATAGGAGGGGAGG - Intronic
995933413 5:117480232-117480254 AATAATAATAATAATAGGCTGGG + Intergenic
996406477 5:123110545-123110567 AAAAAAAAAAAAAGTAGGCCGGG - Intronic
996431630 5:123385898-123385920 AAAAAATATAATAGTAGGCCTGG - Intronic
996433588 5:123408909-123408931 TATAAAAAGAATAATAGGCCGGG + Intronic
996654201 5:125917813-125917835 AAGAAAAACAATAGTAGCACTGG + Intergenic
996695843 5:126393977-126393999 AAAACTAGGAATATTAGGCCAGG + Intronic
997111574 5:131080346-131080368 AAGAATAAGAAAAACAGGCTGGG - Intergenic
997275690 5:132586244-132586266 AACAATAAGATTAGAAGGCAGGG - Intronic
997319368 5:132964509-132964531 AAGAAAAACATTAGTGGGCCGGG - Intergenic
997324415 5:133008242-133008264 AAGAATCAGAAAATCAGGCCGGG + Intronic
997333409 5:133084763-133084785 ATAAAAAAGAATAGTAGGCTGGG - Intronic
997478053 5:134159840-134159862 AAAAATACGAAAATTAGGCCGGG - Intronic
997541348 5:134665530-134665552 AAAAATAAAAATAGGGGGCCAGG - Intronic
997961074 5:138322294-138322316 AATAATAATAATTATAGGCCGGG - Intronic
998066286 5:139161719-139161741 AAGAATTAGAATTGCTGGCCAGG + Intronic
998123240 5:139596749-139596771 AATAATAATAATAATAGGCCAGG + Intronic
998247802 5:140524806-140524828 AATATTAAGAATATTGGGCCGGG + Intronic
998297437 5:140985230-140985252 AAGAGTAAGAAGATTAGGCCAGG - Intronic
998464535 5:142332917-142332939 AACAATAATAACAGTAGGCCGGG - Intergenic
998470500 5:142380180-142380202 AAGAAAAAGAAAACAAGGCCAGG + Intergenic
998481703 5:142468368-142468390 GACTATAAGAATAATAGGCCAGG - Intergenic
999301752 5:150495360-150495382 AAAAATAAAATTATTAGGCCGGG - Intronic
999415993 5:151396394-151396416 AATAATAATAAGAGAAGGCCGGG - Intergenic
999440016 5:151593706-151593728 AATAATAATAATAATAGGCTGGG + Intergenic
999783492 5:154870051-154870073 AAAAATAAAATAAGTAGGCCGGG - Intronic
999865373 5:155695157-155695179 AAGAGTAAGACTGGAAGGCCGGG - Intergenic
999953329 5:156673404-156673426 ATGAATAGGAACCGTAGGCCAGG - Intronic
1000489064 5:161886472-161886494 ATTAATAATAAGAGTAGGCCTGG + Intronic
1000802961 5:165751644-165751666 AAGAATAAAAATAGTGGGCCAGG - Intergenic
1000925125 5:167184844-167184866 AAGACTAAGAATAGAATTCCAGG - Intergenic
1000961170 5:167603003-167603025 AAGAATAAGAATTGTAAGATGGG + Intronic
1001267018 5:170281014-170281036 AATAATAATAATAATAGGCAAGG + Intronic
1001305056 5:170566386-170566408 AATAATACGGATAGTTGGCCGGG - Intronic
1001480837 5:172088228-172088250 AAAAATATGAGTATTAGGCCGGG + Intronic
1001781582 5:174373609-174373631 AAAAGTAAGCATAGTAGGCCGGG + Intergenic
1001921459 5:175603401-175603423 TAGAATAAGAATTCTTGGCCAGG + Intergenic
1002015604 5:176319528-176319550 AAAAATAATAATAATAGGCTGGG + Intronic
1002032867 5:176443657-176443679 AAAAAAAAGAAAAGAAGGCCAGG + Intergenic
1002139143 5:177128110-177128132 AAAAATACAAAAAGTAGGCCAGG - Intergenic
1002219183 5:177665608-177665630 ATGAATAAGAAATGTTGGCCGGG + Intergenic
1002286015 5:178163211-178163233 AAGAAAAAGAAGAGTGAGCCTGG + Intergenic
1002474800 5:179458586-179458608 ATTAATAATAATAATAGGCCAGG - Intergenic
1002590268 5:180286437-180286459 AAGAATTACAGTAGGAGGCCAGG - Intronic
1002726708 5:181303028-181303050 AAAAATAAAAATAATTGGCCAGG - Intergenic
1003777999 6:9390885-9390907 AAGAATAATACTAATAGGGCGGG + Intergenic
1004104459 6:12653069-12653091 AAGAATAAGCATGCTTGGCCTGG - Intergenic
1004255159 6:14057134-14057156 AAGAAAAAGAAAAATTGGCCAGG + Intergenic
1004362062 6:14979897-14979919 AAGAATGTGAATTGTGGGCCAGG - Intergenic
1004408731 6:15360476-15360498 AAAAATAAGATAAATAGGCCGGG - Intronic
1004440926 6:15652916-15652938 AAGAATATGAAAATAAGGCCTGG - Intronic
1004557225 6:16710881-16710903 AAAAATAATAATAATAGGCTGGG - Intronic
1004605339 6:17189493-17189515 AGAAATAAGAAGAGGAGGCCAGG + Intergenic
1004606734 6:17201800-17201822 AAGAAAAACAGAAGTAGGCCAGG - Intergenic
1004921496 6:20380443-20380465 AAGAATGAGACTAGCGGGCCAGG + Intergenic
1005619137 6:27603787-27603809 AATAATAATAATAATAGGCCGGG - Intergenic
1005971594 6:30766082-30766104 AATAATAATAATAATAGGCCGGG - Intergenic
1006002202 6:30973989-30974011 AAGAAGAAGAAGAAGAGGCCGGG + Intergenic
1006106964 6:31722559-31722581 AAGAATAGAAATAGTAGGCCGGG + Intronic
1006540501 6:34736207-34736229 AATAATAATAATTATAGGCCTGG + Intergenic
1006551476 6:34827015-34827037 AAGAAAGAGAAAAATAGGCCGGG + Intronic
1006559371 6:34896667-34896689 AAAAATAAAAAAACTAGGCCAGG + Intronic
1006888914 6:37406545-37406567 AAAAATATGCAAAGTAGGCCAGG - Intergenic
1006946695 6:37789316-37789338 AAGAAAAAAATTTGTAGGCCAGG + Intergenic
1007315079 6:40981097-40981119 AAGAATAAGGATGGAATGCCTGG - Intergenic
1007404259 6:41624634-41624656 AAAAAAAAGAATAATAGGGCAGG - Intergenic
1007404310 6:41624930-41624952 AATAAAAAGAATAATAGGCCAGG - Intergenic
1007468816 6:42074829-42074851 AAAAAAAAAAAAAGTAGGCCAGG - Intronic
1007575058 6:42920023-42920045 AAAAATAATAATAATAGGCCGGG + Intronic
1008047918 6:46870453-46870475 AAGAATAAGATTTTTAGGCCAGG - Intronic
1008255615 6:49296107-49296129 AAAAATAACAAAAGAAGGCCGGG - Intergenic
1008990163 6:57592497-57592519 GAAAATAGGAGTAGTAGGCCAGG + Intronic
1009178738 6:60491036-60491058 GAAAATAGGAGTAGTAGGCCAGG + Intergenic
1010437016 6:75843462-75843484 TAGAAAAAGAATAGATGGCCGGG + Intronic
1010790446 6:80058053-80058075 AAGATGAAGAATAGTATGCCAGG + Intergenic
1011213301 6:84977371-84977393 AAGAATAATAAATGTAGGGCTGG + Intergenic
1011429864 6:87273809-87273831 AAGAATTGGAATAGTAGGAATGG + Intergenic
1012172585 6:96037482-96037504 AAGCATAAGAATATTTGGCCTGG + Intronic
1013131497 6:107237542-107237564 AAGTATAAAAATAAGAGGCCAGG - Intronic
1013136704 6:107289393-107289415 AAGAAAAAGAAATGGAGGCCAGG + Intronic
1013278031 6:108605411-108605433 ATGAAAAAAAATAGTAGGACTGG - Intronic
1013683895 6:112556186-112556208 AATAATAATAATAGTAGGCCAGG - Intergenic
1014265756 6:119275599-119275621 AAAAATAAAAAAATTAGGCCGGG - Intronic
1014426306 6:121311432-121311454 AAAAATTATAATAGTAGGCTGGG + Intronic
1014805999 6:125830391-125830413 AAATATAAGAATATTAGGCCAGG + Intronic
1014820088 6:125979456-125979478 AATAATAGGTAAAGTAGGCCGGG + Exonic
1015161382 6:130156041-130156063 AAGAAAAAGGAAAGGAGGCCAGG + Intronic
1015919689 6:138254440-138254462 AATAATAATAATAATAGGCCGGG + Intronic
1016317899 6:142809887-142809909 AAAAATTAGAATATTGGGCCGGG - Intronic
1016348750 6:143144770-143144792 AAGAATAAACATAATATGCCAGG - Intronic
1016349238 6:143149229-143149251 CAGAATAAGAGTAGGAGGCTGGG + Intronic
1016441043 6:144083931-144083953 AACAAAAAAAGTAGTAGGCCAGG - Intergenic
1016882275 6:148922766-148922788 AATAATAATAAAAGAAGGCCAGG - Intronic
1017087578 6:150728600-150728622 TAAAATAAAAAAAGTAGGCCGGG + Intronic
1017699415 6:157053927-157053949 AAAAATAAAAACATTAGGCCGGG + Intronic
1017921698 6:158878601-158878623 AAGAAAAAGGAAACTAGGCCTGG - Intronic
1018016647 6:159718673-159718695 TAGAAAAAGAAAAGTAGGCTAGG + Intronic
1018415406 6:163597778-163597800 AAGAAAAAGAATAGTAAGAGAGG + Intergenic
1019726413 7:2605323-2605345 AAGAATCCCTATAGTAGGCCGGG + Intronic
1019737881 7:2659479-2659501 AAGAAAAAGAAAAGGAGGCAGGG - Intronic
1020068062 7:5204969-5204991 AAAAAAAAGACTAATAGGCCGGG - Intronic
1020196227 7:6041544-6041566 AAGAAAAAAAAAAGTCGGCCGGG + Intronic
1020276377 7:6627162-6627184 AAAAATAATAAAAGTAAGCCAGG - Intergenic
1020501465 7:8927024-8927046 AACAAAAAAAATAGTAAGCCAGG - Intergenic
1020878613 7:13730019-13730041 AAAAATACAAAAAGTAGGCCGGG + Intergenic
1020889921 7:13866456-13866478 TATAAAAAGAAGAGTAGGCCAGG - Intergenic
1021030778 7:15731954-15731976 ATGAATATGAATAGTGGTCCCGG - Intergenic
1021210001 7:17837639-17837661 AAAAATGAGCATTGTAGGCCTGG - Intronic
1021220436 7:17969690-17969712 AAGAATTCGAGTAGTTGGCCAGG + Intergenic
1021488423 7:21192293-21192315 TAAAATTAGAATAATAGGCCAGG + Intergenic
1021721031 7:23504174-23504196 AAAAAAAAAAAAAGTAGGCCGGG + Intergenic
1022164506 7:27744098-27744120 AAAAATAAAGATACTAGGCCGGG - Intronic
1022220704 7:28310996-28311018 AAGAATAAATATTTTAGGCCAGG + Intronic
1022371967 7:29780463-29780485 AATAGTAAGAATAGCTGGCCAGG - Intergenic
1022408318 7:30114189-30114211 AAAAAAAAGAAAAGTAGGGCAGG - Intronic
1022685855 7:32595725-32595747 AATAATAGTAATAGCAGGCCGGG - Intergenic
1022689571 7:32634468-32634490 AATAAAAAAAATAGTAGGCAGGG + Intergenic
1023385544 7:39653321-39653343 AAAAACAATAATAATAGGCCGGG - Intronic
1023465532 7:40450221-40450243 AAAAAAAAGTCTAGTAGGCCGGG - Intronic
1023546597 7:41324513-41324535 AAGATTGAAAATATTAGGCCAGG + Intergenic
1023796348 7:43795808-43795830 AAGAAAAAAAAGAGTCGGCCGGG + Intronic
1023801724 7:43840618-43840640 AAAAATAATAATAATAGGCCAGG - Intergenic
1024068974 7:45769691-45769713 AAAAATACGAAAATTAGGCCAGG - Intergenic
1024071599 7:45790654-45790676 AAAAATAAAAATAATTGGCCAGG - Intergenic
1024269365 7:47630569-47630591 AATAAAAAGTATAATAGGCCGGG - Intergenic
1024501080 7:50106939-50106961 AAAAATACAAATATTAGGCCAGG + Intronic
1024815238 7:53261435-53261457 AAGAATGGAAATAATAGGCCGGG + Intergenic
1025085358 7:56019144-56019166 AAAAAAAATAATAATAGGCCGGG + Intronic
1025095909 7:56095159-56095181 AATAATAAAAATAAAAGGCCAGG - Intergenic
1025104680 7:56161324-56161346 AAGAATAAGTTTTCTAGGCCAGG - Intergenic
1025166640 7:56718323-56718345 AAGAAAAAGAAAATAAGGCCGGG + Intergenic
1025823097 7:64989776-64989798 AAGAAGAAGAAGAATAAGCCAGG + Intronic
1025900822 7:65743305-65743327 AAAAATAAAAATAAAAGGCCAGG + Intergenic
1026138584 7:67685216-67685238 GAAAATAATAATAGGAGGCCGGG - Intergenic
1026246025 7:68620543-68620565 AAAAAATAGATTAGTAGGCCTGG + Intergenic
1026303024 7:69115459-69115481 AAGAAAAAGAACAGTGGTCCTGG - Intergenic
1026348485 7:69495290-69495312 AAAAATACGAAAATTAGGCCGGG + Intergenic
1026350674 7:69512635-69512657 AAAAATAATAATAATAGGGCCGG + Intergenic
1026539376 7:71267011-71267033 AAGACCAAGAAAAGTATGCCAGG - Intronic
1026642749 7:72141302-72141324 AAGAAAAAGAAAAAAAGGCCAGG + Intronic
1026697032 7:72604166-72604188 AAAAATAATAATAATTGGCCAGG + Intronic
1026707949 7:72711628-72711650 AATAATAATAATAATAAGCCAGG - Intronic
1026740067 7:72973598-72973620 AAAAATAATAATAATTGGCCAGG + Intergenic
1026743975 7:72997041-72997063 AAAAATTAGAAAATTAGGCCGGG - Intergenic
1026797377 7:73375087-73375109 AAAAATAAGAATAATTGGCCAGG + Intergenic
1026802224 7:73407513-73407535 AAGAAAAAGGAAAGGAGGCCGGG + Intergenic
1026821616 7:73553376-73553398 AAGAAAAAGAAAACTAGGCCAGG + Intronic
1026939982 7:74282087-74282109 AAAAATAAGAAAATTAGGCCGGG - Intergenic
1027030082 7:74881736-74881758 AAAAATTAGAAAATTAGGCCGGG - Intergenic
1027099762 7:75368041-75368063 AAAAATTAGAAAATTAGGCCGGG + Intergenic
1027103666 7:75391472-75391494 AAAAATAATAATAATTGGCCAGG - Intergenic
1027175034 7:75897888-75897910 AATAACAAAAATAGTAGGCCAGG + Intergenic
1027262382 7:76474167-76474189 AAGAAAAAAAAAAGTAGGCCAGG - Intronic
1027313763 7:76972266-76972288 AAGAAAAAAAAAAGTAAGCCAGG - Intergenic
1027384692 7:77648197-77648219 AAAAATAAGAAAATTAGGCCAGG + Intergenic
1027590796 7:80116447-80116469 AAGAACATGAATAGTGGGCCAGG + Intergenic
1028559022 7:92153358-92153380 AAAAATAAGCATAAGAGGCCGGG - Intronic
1028564838 7:92218376-92218398 AAAAAAAAAAAAAGTAGGCCAGG - Intronic
1028601178 7:92602021-92602043 AAGAATAATAATAATTAGCCAGG + Intergenic
1028620650 7:92823960-92823982 AAGAAAAACAAAAGAAGGCCAGG - Intronic
1029130330 7:98325380-98325402 AATAATAATAATTGGAGGCCAGG + Intronic
1029172816 7:98642890-98642912 AAAAAAAAAAATAGTTGGCCAGG + Intergenic
1029584979 7:101464704-101464726 AAAAATAAGAATTAGAGGCCGGG - Intronic
1029645963 7:101856018-101856040 AAAAATAAGAAAAATTGGCCAGG + Intronic
1030026683 7:105331004-105331026 AAGAAAAAAAAAAGAAGGCCGGG + Intronic
1030103718 7:105969099-105969121 AAAAATAAAAAAAGTGGGCCGGG + Intronic
1030244795 7:107371292-107371314 AAATATAAAAATAATAGGCCAGG + Intronic
1030391512 7:108933897-108933919 AAGAACAAGCAGAGTGGGCCGGG + Intergenic
1030748843 7:113204273-113204295 AAAAAGGAGAATAGTAGGCAAGG + Intergenic
1030998659 7:116389068-116389090 AAGAATAAGAAAATCAGGCCAGG + Intronic
1031268948 7:119620457-119620479 AAGAAAACAAATAGTTGGCCAGG + Intergenic
1031600403 7:123700731-123700753 AAGAGGTAGAATAGTTGGCCGGG - Intronic
1031624866 7:123980823-123980845 AAAAATAAGAATGATAGGCCAGG + Intergenic
1031771783 7:125852782-125852804 AAGAATAATAATATTAGAACCGG + Intergenic
1032048224 7:128628232-128628254 AAAAATAAAAATAATTGGCCAGG - Intergenic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1032112228 7:129085967-129085989 AAAAATAATAATAATAGGCTGGG - Intergenic
1032247286 7:130223717-130223739 AAGAATTTGGATAATAGGCCAGG - Intergenic
1032600413 7:133287606-133287628 CTTAATAAGTATAGTAGGCCAGG - Intronic
1032852454 7:135806681-135806703 AAAAATAAATATAGGAGGCCAGG + Intergenic
1032860039 7:135868113-135868135 AAAAATTATAAAAGTAGGCCTGG + Intergenic
1033006196 7:137566967-137566989 TAGAATTAGAATATCAGGCCAGG + Intronic
1033122341 7:138677197-138677219 AAGAAAAAGAGCAGGAGGCCGGG - Intronic
1033338979 7:140477615-140477637 AAGAATACAAAAATTAGGCCGGG - Intronic
1033339429 7:140480097-140480119 AATAATAATAATAATAGGCCAGG + Intergenic
1034095708 7:148405878-148405900 AAAAATTACAATGGTAGGCCAGG - Intronic
1034142345 7:148833160-148833182 AAGAATAAGAAAACTTGGGCCGG + Intronic
1034180737 7:149135656-149135678 TAGAATAATAATAATAGTCCGGG + Intronic
1034183480 7:149156561-149156583 AAGAACAGTAATTGTAGGCCAGG + Intronic
1034218424 7:149425464-149425486 AAAAATAAGAAAATTAGGCTTGG + Intergenic
1034252849 7:149706278-149706300 AAAAACAATAATAATAGGCCAGG - Intergenic
1034327327 7:150248365-150248387 AAAAAAAAAAAGAGTAGGCCGGG + Intronic
1034525533 7:151658189-151658211 ATAAATAAGAATAATAGGGCTGG + Intronic
1034531986 7:151701546-151701568 AAGAATAAGGATTGCCGGCCGGG + Intronic
1034604698 7:152301207-152301229 AAAAAAAAGAAAAGTTGGCCGGG + Intronic
1034609961 7:152357227-152357249 AAAAATAACAACAATAGGCCAGG + Intronic
1034720942 7:153292136-153292158 AAGAAAAAGAATAGGAGGCCAGG + Intergenic
1034765882 7:153721084-153721106 AAAAAAAAAAAGAGTAGGCCGGG - Intergenic
1035197340 7:157232645-157232667 AAGAATGCGAATAACAGGCCAGG - Intronic
1035209147 7:157314915-157314937 AAGAAAAAGAAAATCAGGCCGGG - Intergenic
1035810547 8:2487477-2487499 AAGAAAAAGAAAAAGAGGCCGGG + Intergenic
1035942965 8:3925075-3925097 AAGAATAAGAGAAGTGGGGCAGG - Intronic
1035977204 8:4325581-4325603 AAGAATTATTATAGTAGGCAGGG + Intronic
1036098030 8:5746450-5746472 AAGATTAATAATACAAGGCCAGG + Intergenic
1036153817 8:6323664-6323686 AAAAATAAAAAAAATAGGCCGGG - Intergenic
1036660063 8:10702128-10702150 AAGGATAAGCAGAGGAGGCCTGG + Intronic
1036963829 8:13274636-13274658 AAGAATAAGAATGTTATCCCTGG - Intronic
1036980318 8:13462699-13462721 AAGAATAAGAATAGTAGGCCGGG - Intronic
1037117433 8:15243516-15243538 AATAATAATAATAGTGGGCCGGG + Intergenic
1037190844 8:16123138-16123160 AAGAATTTGAATAGAGGGCCGGG - Intronic
1037641762 8:20750892-20750914 AATAATAATAATAATAGGCGTGG - Intergenic
1038005537 8:23426828-23426850 AAGAATAAGGTGATTAGGCCCGG + Intronic
1038036319 8:23689773-23689795 AAGAAAAAGAGAAGTAAGCCAGG - Intergenic
1038268975 8:26060058-26060080 AAGAATAATAACAATATGCCTGG + Intergenic
1038290958 8:26249582-26249604 AAAAAAAAGTATAATAGGCCAGG + Intergenic
1038337975 8:26660882-26660904 AAGAATAAATAAAATAGGCCGGG + Intergenic
1038423927 8:27452410-27452432 AAGATTAAGAAAATTAGGCCTGG + Intronic
1038551158 8:28469906-28469928 AATAATAATAATAATAGGCCGGG + Intronic
1038558832 8:28550785-28550807 AAGAAAATGAAGAATAGGCCAGG - Intronic
1038683206 8:29689340-29689362 AAGAATAAGAAAAATATGCCAGG - Intergenic
1039194482 8:35015579-35015601 AAGAATAAGAATTGTAGTGGAGG - Intergenic
1039267657 8:35843202-35843224 AAAAATAATAATACTATGCCTGG + Intergenic
1039816026 8:41095162-41095184 AAAAATTAGAAAAGGAGGCCAGG - Intergenic
1039833947 8:41240880-41240902 AAGAATAAGAAAAATAGGCCAGG + Intergenic
1039995530 8:42528960-42528982 AATAATAATAATAATAGGCCGGG - Intronic
1040044704 8:42950978-42951000 AAAATTAGGAATAGTCGGCCGGG - Intronic
1040419859 8:47228703-47228725 AAGAATAAGAAAAATAGTGCCGG - Intergenic
1042141480 8:65683423-65683445 AACAATAAGAAAACAAGGCCAGG - Intronic
1042177750 8:66053922-66053944 AAAAAAAAGGGTAGTAGGCCAGG - Intronic
1042244178 8:66694254-66694276 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1042277985 8:67025707-67025729 TAGAAAAAGGACAGTAGGCCGGG + Intronic
1042831427 8:73033432-73033454 AAGAAAAGGAAATGTAGGCCAGG + Intronic
1042836088 8:73080217-73080239 AAAAATAATAATAAAAGGCCGGG + Intronic
1042848608 8:73192916-73192938 AAGTAAAAGAATGATAGGCCAGG + Intergenic
1042877662 8:73454717-73454739 AAGAATAAGAGTATTAGGCAAGG + Intronic
1043303442 8:78763232-78763254 AAGAATAAGAAAAACAGGCTGGG - Intronic
1044094811 8:88050024-88050046 CAAAATAATAATAATAGGCCAGG + Intronic
1044565203 8:93655060-93655082 CAGAATAAGAATGTAAGGCCAGG - Intergenic
1044646865 8:94452790-94452812 AAAATTAAGGATAGTAGGCTGGG - Intronic
1044651211 8:94497695-94497717 TAAAATAAGAAAAATAGGCCGGG - Intronic
1044657536 8:94564330-94564352 AATAATAATAATAATAGGCCAGG + Intergenic
1044971011 8:97619730-97619752 AAAAATAACAATAATAAGCCTGG - Intergenic
1045001341 8:97880876-97880898 AAGAATAAGATTTTCAGGCCGGG - Intronic
1045033031 8:98155576-98155598 GAAAATAATAATAATAGGCCAGG - Intronic
1045442207 8:102225525-102225547 AAGAATTAGAAAGATAGGCCGGG - Intronic
1045681192 8:104662056-104662078 AAGAAAAAGCAAAGCAGGCCAGG - Intronic
1045730664 8:105236318-105236340 AAGGATAAGAATAATATACCAGG - Intronic
1046113450 8:109755040-109755062 AAGAATAGAAATAAAAGGCCAGG - Intergenic
1046633672 8:116647393-116647415 AAGAATAGTAACAATAGGCCAGG - Intronic
1046803993 8:118460151-118460173 AAGAAAAAGAATAGTAGGAGAGG - Intronic
1046923703 8:119763853-119763875 AAAAATAATAATAATAGGCTGGG + Intronic
1047057181 8:121178782-121178804 AAGAAAAGGGATAGTAGGCTAGG + Intergenic
1047279194 8:123430480-123430502 AATAATACAAATATTAGGCCGGG + Intronic
1047304440 8:123641598-123641620 AAGGAGAAGAATAGGGGGCCGGG + Intergenic
1047317860 8:123750919-123750941 AAAAAAAAGAAAAGGAGGCCAGG - Intergenic
1047593246 8:126349641-126349663 TAAAAAAAGAATAGTCGGCCAGG + Intergenic
1047593729 8:126354547-126354569 AAGATTCAGAGTACTAGGCCAGG - Intergenic
1047734469 8:127753181-127753203 AATAATAAGAATAGTAGGCTGGG + Intergenic
1047751159 8:127881750-127881772 AAAAATAATAATAATAGGCCGGG - Intergenic
1047993080 8:130306964-130306986 CAGAATGAGAAGAGTTGGCCAGG - Intronic
1048220327 8:132534990-132535012 AAGAATATAAGTAATAGGCCAGG - Intergenic
1048233845 8:132671023-132671045 AAGAATCAGAAAAAAAGGCCAGG + Intronic
1048832548 8:138490845-138490867 AAGAGAAAGAAAAATAGGCCAGG + Intronic
1048921686 8:139237223-139237245 AAAAAAAAGAATTATAGGCCAGG - Intergenic
1049108578 8:140628788-140628810 AACAATAATAATAATAGGCCGGG + Intronic
1049609539 8:143547747-143547769 AATAATAATAACATTAGGCCAGG + Intergenic
1049877871 8:145038057-145038079 AAGAATAAGCAAAGTATACCAGG + Intergenic
1049888792 9:47852-47874 AATAATAATAACAGGAGGCCGGG + Intergenic
1050737697 9:8782889-8782911 ATGAAAAAGAAGTGTAGGCCAGG - Intronic
1050814754 9:9796205-9796227 AAGAAGAAGAAAAGGAGGCTGGG + Intronic
1051154217 9:14122951-14122973 AAAAATAAGAAAAGCAGGCCAGG + Intronic
1051275446 9:15393940-15393962 AAAAAAAAAAAAAGTAGGCCAGG - Intergenic
1052258351 9:26485610-26485632 AAGAATAAAAACTGTAGGCCTGG - Intergenic
1052291532 9:26846980-26847002 AAGAAGAAGAAAAATTGGCCGGG - Intronic
1052478991 9:28997526-28997548 AATAATAAAAATAGTTGGCCGGG + Intergenic
1052518915 9:29518143-29518165 AAAAATATGTATAGTTGGCCAGG - Intergenic
1052689010 9:31791404-31791426 AAAAATAATAATAGTAGACAAGG - Intergenic
1052699031 9:31915470-31915492 AAGAATGTGACTAGTAGGCCGGG + Intergenic
1052779564 9:32766819-32766841 AAGAATAAGAAGTGGACGCCAGG + Intergenic
1053089360 9:35259919-35259941 AATAATAAGAACTGTAGGCTGGG + Intronic
1053132220 9:35622497-35622519 AAAAATAATAACAGCAGGCCAGG + Intronic
1053248677 9:36556490-36556512 AAAAATAATAATAATAGGCCAGG - Intergenic
1053392178 9:37743902-37743924 AAGAAAAAAAAAAGTCGGCCAGG + Intronic
1053491328 9:38506470-38506492 AAGAAGAAAACTTGTAGGCCAGG + Intergenic
1054842931 9:69762027-69762049 AAGAATTAGTAAAGTCGGCCGGG + Intergenic
1055159257 9:73105091-73105113 AAGAATTAGAAGGTTAGGCCTGG - Intergenic
1055296971 9:74843511-74843533 AATAATAAGAGTTGAAGGCCAGG + Intronic
1055397163 9:75888511-75888533 AAAAATAATAATAATAGGGCCGG + Intergenic
1055397218 9:75888839-75888861 AATAATAATAATAATAGGACGGG + Intergenic
1055898744 9:81210680-81210702 AGCAATAAGAAATGTAGGCCAGG + Intergenic
1055952335 9:81741927-81741949 AAAAATTAAAATAATAGGCCGGG + Intergenic
1055952598 9:81744231-81744253 AAAAATAAAAAAAATAGGCCGGG - Intergenic
1056191546 9:84189084-84189106 AATAATAATAATAATAAGCCAGG + Intergenic
1056432731 9:86544587-86544609 AAGAAGAATAATAGTATCCCTGG - Intergenic
1056528722 9:87468252-87468274 AAGAATATTCATAATAGGCCAGG + Intergenic
1056665143 9:88575897-88575919 AAAAATAAAAAAATTAGGCCAGG + Intronic
1056811625 9:89769474-89769496 AAAAAAAAGAATAGGAGGCCGGG - Intergenic
1056943315 9:90973558-90973580 AAAAATATGAAAATTAGGCCAGG - Intergenic
1057236396 9:93365363-93365385 AAGAACAAGAAAAGTAGGAGGGG + Intergenic
1057244126 9:93439954-93439976 AAAACTAAGAATTCTAGGCCGGG + Intergenic
1057591147 9:96374537-96374559 AAAAAAAAAAAAAGTAGGCCAGG + Intronic
1057625880 9:96676320-96676342 AAAAATAAGAAAAGTTAGCCAGG + Intergenic
1057859964 9:98633325-98633347 AAGAATAAGAAGAACAGGCCAGG + Intronic
1057947632 9:99343626-99343648 AAGAGTCAGAATATGAGGCCGGG + Intergenic
1058042552 9:100319507-100319529 AAAAATAAGACTTGTAGGCTGGG + Intronic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058403577 9:104645205-104645227 AAGAATAGAAAATGTAGGCCGGG + Intergenic
1058444344 9:105041102-105041124 AAAAATAAGAAGAAAAGGCCAGG + Intergenic
1058666895 9:107326932-107326954 AAGAAATAGAAAAGTTGGCCGGG - Intronic
1058715688 9:107720206-107720228 AAAAGTCAGAATAGCAGGCCGGG - Intergenic
1058783677 9:108364984-108365006 AAGAAAAAGAAGTTTAGGCCGGG + Intergenic
1059019429 9:110558209-110558231 GAAAATAAGAATAATTGGCCCGG + Intronic
1059138828 9:111833061-111833083 AGGAAAAAGAAAAATAGGCCGGG - Intergenic
1059142760 9:111869780-111869802 AAGAATACAAAAATTAGGCCGGG - Intergenic
1059156046 9:111989029-111989051 AAAAATAAGGATATGAGGCCAGG - Intergenic
1060191457 9:121596023-121596045 ACAAATAAAAATATTAGGCCAGG + Intronic
1060412571 9:123409794-123409816 AAGAATAAGAACCGTTGGCCGGG + Intronic
1060617647 9:125032910-125032932 TAGAATAATATTAGTAGGCTGGG - Intronic
1060979077 9:127782365-127782387 AATAATAATAATAATTGGCCGGG - Intergenic
1061063597 9:128263711-128263733 AAAAATAAAAAAATTAGGCCAGG - Intronic
1061126597 9:128680670-128680692 AAAAATAATAATAATAGGCTGGG - Intergenic
1061281464 9:129600005-129600027 AAGAATACAAAAATTAGGCCAGG + Intergenic
1061383282 9:130272534-130272556 AAGAAGAAGAAGAAGAGGCCAGG - Intergenic
1061827058 9:133265049-133265071 AAAAATAAAAATAGAGGGCCAGG - Intronic
1062263555 9:135675877-135675899 AATAATAATAATAATAGGCCGGG + Intergenic
1062751825 9:138260506-138260528 AAAAATAAAAATAATTGGCCAGG - Intergenic
1185526453 X:784142-784164 AATAATAATAATAGTTAGCCAGG - Intergenic
1185526478 X:784314-784336 AATAATAATAATAGTTAGCCAGG - Intergenic
1185535686 X:860005-860027 AAGAAGAAGAAGAAAAGGCCGGG - Intergenic
1185689752 X:2144674-2144696 ACTAATAAGAACAGGAGGCCGGG + Intergenic
1185706901 X:2274332-2274354 AATAATAATATTAGTAGGGCTGG - Intronic
1185861016 X:3579398-3579420 TAGAAAAAGAACAATAGGCCAGG + Intergenic
1186017375 X:5213344-5213366 AATAATAATATTAGTAGGCTAGG + Intergenic
1186414563 X:9371975-9371997 TAAAATAAGAAAATTAGGCCAGG + Intergenic
1186421091 X:9427066-9427088 AAAAATAAAAACAATAGGCCAGG + Intergenic
1186547244 X:10463020-10463042 AAGAATAAGAATAGGCTGCTGGG + Intronic
1186746382 X:12574293-12574315 TAAAATAACAATAATAGGCCAGG - Intronic
1187019487 X:15365426-15365448 AAGAATAACCATTGTTGGCCAGG - Intronic
1187147483 X:16650804-16650826 AAAAATAAGCATCTTAGGCCAGG - Intronic
1187367573 X:18677196-18677218 AAAAATACAAAAAGTAGGCCAGG - Intronic
1187395114 X:18912615-18912637 AAAAAAAAAAATGGTAGGCCAGG + Intronic
1187503654 X:19861079-19861101 AAAAATAAAAACAGCAGGCCAGG + Intronic
1187710563 X:22049407-22049429 TATAATAAGAAAAGTTGGCCAGG - Intronic
1187762161 X:22599260-22599282 AACAATAAGAAAATAAGGCCAGG - Intergenic
1187884428 X:23875966-23875988 AAAAATAAAAATATTAGGCTGGG + Intronic
1188372523 X:29386321-29386343 AAAAATAAAAAGTGTAGGCCAGG - Intronic
1188568689 X:31556070-31556092 AAAAATAATAATAATTGGCCGGG + Intronic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1189047866 X:37612235-37612257 AATAATAAAAACAATAGGCCAGG - Intronic
1189959733 X:46312891-46312913 AATAATAACAATAATAGGCTGGG - Intergenic
1190086171 X:47397182-47397204 AAGATAAAGAAGAGTAGGCCTGG - Intronic
1190095294 X:47474883-47474905 AAAAAAAAAAAGAGTAGGCCGGG + Intronic
1190127456 X:47719510-47719532 AAAAATAATAGTAATAGGCCGGG + Intergenic
1190273992 X:48888536-48888558 AATAATAATAATAATAGGCCAGG + Intergenic
1190844659 X:54181348-54181370 AAGAAAAAGAAAAGTAGTACAGG - Intronic
1190867740 X:54398922-54398944 AAAAAAAAAAAAAGTAGGCCAGG - Intergenic
1191857265 X:65637105-65637127 AAAGAAAAGAATATTAGGCCGGG + Intronic
1192245838 X:69370765-69370787 TAGAATAAGAAATTTAGGCCGGG - Intergenic
1192411568 X:70937714-70937736 AAATGTAAGAATATTAGGCCAGG - Intergenic
1192675724 X:73193924-73193946 AAAAATTAGAATATTAGGCAGGG + Intergenic
1192745369 X:73933225-73933247 GAAAGTAAGAATAGTAGGCTGGG + Intergenic
1193109827 X:77717419-77717441 AAGAAAACGAATTTTAGGCCAGG + Intronic
1193185245 X:78503793-78503815 AAAAATTAGAATAGTATACCTGG + Intergenic
1193617895 X:83712539-83712561 AATAATAATAATAATTGGCCGGG + Intergenic
1193828519 X:86257701-86257723 AAGAGCAAGAGTTGTAGGCCAGG - Intronic
1194050908 X:89067888-89067910 AAGAATATAAATTTTAGGCCAGG + Intergenic
1194220083 X:91179065-91179087 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1194284168 X:91989265-91989287 AAGAAGAAGAAAAGAAGGCCGGG + Intronic
1194759915 X:97784042-97784064 AAGATTTAGAATATTAAGCCAGG + Intergenic
1195007514 X:100701004-100701026 AAGACAAAGAAAAGTATGCCAGG + Intronic
1195021348 X:100831919-100831941 AATAATAGCAATAATAGGCCGGG + Intronic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1195159869 X:102160793-102160815 AATAATAATAATAATAAGCCGGG + Intergenic
1195165984 X:102220988-102221010 AAAAAATATAATAGTAGGCCGGG - Intronic
1195192875 X:102466100-102466122 AAAAAATATAATAGTAGGCCGGG + Intronic
1195242072 X:102961707-102961729 AAGGAGAAGAAAAGTGGGCCAGG - Intergenic
1195262922 X:103151636-103151658 AAAAATAATAATAATAGGCTGGG - Intergenic
1195483453 X:105374651-105374673 GAGTATAAGAATTCTAGGCCAGG + Intronic
1195690341 X:107619101-107619123 AAGAAAAAGAAAAGACGGCCGGG - Intergenic
1195797985 X:108673744-108673766 AATAATAATAATAATAGGCCAGG + Intronic
1195931695 X:110084206-110084228 AAAATCAAGAATAGTTGGCCAGG + Intronic
1196174436 X:112625534-112625556 AAGAATAAGAAGTGTTGGTCAGG + Intergenic
1196218416 X:113082755-113082777 TAGGATAAGAGTAGTTGGCCAGG - Intergenic
1196589690 X:117472121-117472143 AACAAAAAGTATATTAGGCCGGG + Intergenic
1196972724 X:121126848-121126870 AAGAAAAAGAAAAGAAGGCCAGG - Intergenic
1197738052 X:129867336-129867358 TAAAATAAAAATATTAGGCCGGG + Intergenic
1197847771 X:130821768-130821790 AAGAATAAGTAGGGCAGGCCAGG + Intronic
1198205724 X:134462475-134462497 AAAAATACAAATATTAGGCCGGG - Intronic
1198277532 X:135110729-135110751 AAGAAAAAGAAAAGAAGGGCAGG - Intergenic
1198682479 X:139197694-139197716 AGAAATAAAAATAGGAGGCCAGG + Intronic
1198853288 X:140988723-140988745 AATAATAATAATAATAAGCCGGG - Intergenic
1199106157 X:143871367-143871389 AGGCCTAAGAATAGCAGGCCGGG + Intergenic
1199518344 X:148704820-148704842 AATAATAAAAATAATAGGCCGGG - Intronic
1199537559 X:148920316-148920338 AAGAATTGGAATAGTATGTCAGG - Intronic
1200136403 X:153877010-153877032 AAAAATAAAAATAAAAGGCCAGG + Intronic
1200233386 X:154457220-154457242 AAGAATAGGAAAAGTTAGCCAGG + Intergenic
1200556593 Y:4642825-4642847 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1200601735 Y:5213822-5213844 AAGAAGAAGAAAAGAAGGCCAGG + Intronic
1200780923 Y:7214913-7214935 GATAATAATAATAGTAGGCTGGG + Intergenic
1201069230 Y:10129245-10129267 AAGAAGAAGAAAAATGGGCCAGG + Intergenic
1201517962 Y:14838759-14838781 GAGAATAAGAATATCAGGCTTGG - Intronic
1201548070 Y:15188645-15188667 AAAAAAAAGAATACTGGGCCGGG + Intergenic