ID: 1036988193

View in Genome Browser
Species Human (GRCh38)
Location 8:13560764-13560786
Sequence CTGTGGGGGGGGAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036988180_1036988193 15 Left 1036988180 8:13560726-13560748 CCATTTGAATAGGTGTTAATCTA No data
Right 1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036988193 Original CRISPR CTGTGGGGGGGGAGGGAAAA AGG Intergenic
No off target data available for this crispr