ID: 1036988357

View in Genome Browser
Species Human (GRCh38)
Location 8:13563214-13563236
Sequence CAAGTTGAAGTGTTAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036988357_1036988359 -4 Left 1036988357 8:13563214-13563236 CCTGATTCTAACACTTCAACTTG No data
Right 1036988359 8:13563233-13563255 CTTGCAAAAAGGCATTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036988357 Original CRISPR CAAGTTGAAGTGTTAGAATC AGG (reversed) Intergenic
No off target data available for this crispr