ID: 1036991729

View in Genome Browser
Species Human (GRCh38)
Location 8:13605645-13605667
Sequence CTCTCTGTACTCCAGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036991723_1036991729 -4 Left 1036991723 8:13605626-13605648 CCCTCCTCTTACCTCCACACTCT No data
Right 1036991729 8:13605645-13605667 CTCTCTGTACTCCAGGTACATGG No data
1036991724_1036991729 -5 Left 1036991724 8:13605627-13605649 CCTCCTCTTACCTCCACACTCTC No data
Right 1036991729 8:13605645-13605667 CTCTCTGTACTCCAGGTACATGG No data
1036991722_1036991729 -1 Left 1036991722 8:13605623-13605645 CCTCCCTCCTCTTACCTCCACAC No data
Right 1036991729 8:13605645-13605667 CTCTCTGTACTCCAGGTACATGG No data
1036991725_1036991729 -8 Left 1036991725 8:13605630-13605652 CCTCTTACCTCCACACTCTCTGT No data
Right 1036991729 8:13605645-13605667 CTCTCTGTACTCCAGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036991729 Original CRISPR CTCTCTGTACTCCAGGTACA TGG Intergenic
No off target data available for this crispr