ID: 1036993078

View in Genome Browser
Species Human (GRCh38)
Location 8:13621437-13621459
Sequence CTGGCATATTTGCTGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036993078_1036993082 10 Left 1036993078 8:13621437-13621459 CCAACCAACAGCAAATATGCCAG No data
Right 1036993082 8:13621470-13621492 AGAGATCAGAGAAAAAACCTAGG No data
1036993078_1036993083 23 Left 1036993078 8:13621437-13621459 CCAACCAACAGCAAATATGCCAG No data
Right 1036993083 8:13621483-13621505 AAAACCTAGGCCAGAAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036993078 Original CRISPR CTGGCATATTTGCTGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr