ID: 1036998581

View in Genome Browser
Species Human (GRCh38)
Location 8:13689431-13689453
Sequence GTCTGCTTGTCAAAGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036998578_1036998581 6 Left 1036998578 8:13689402-13689424 CCTCTCTGTGGTTAATGAGTTAT No data
Right 1036998581 8:13689431-13689453 GTCTGCTTGTCAAAGAGTCTGGG No data
1036998574_1036998581 27 Left 1036998574 8:13689381-13689403 CCCTCATGAATGGTTTGCTGCCC 0: 2
1: 23
2: 237
3: 721
4: 1506
Right 1036998581 8:13689431-13689453 GTCTGCTTGTCAAAGAGTCTGGG No data
1036998577_1036998581 7 Left 1036998577 8:13689401-13689423 CCCTCTCTGTGGTTAATGAGTTA No data
Right 1036998581 8:13689431-13689453 GTCTGCTTGTCAAAGAGTCTGGG No data
1036998575_1036998581 26 Left 1036998575 8:13689382-13689404 CCTCATGAATGGTTTGCTGCCCT 0: 2
1: 21
2: 252
3: 669
4: 1525
Right 1036998581 8:13689431-13689453 GTCTGCTTGTCAAAGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036998581 Original CRISPR GTCTGCTTGTCAAAGAGTCT GGG Intergenic
No off target data available for this crispr