ID: 1036999907

View in Genome Browser
Species Human (GRCh38)
Location 8:13705664-13705686
Sequence CCCCAGGTCCAGGTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036999898_1036999907 -3 Left 1036999898 8:13705644-13705666 CCTTGCTTTCCTCTACCCCACCC No data
Right 1036999907 8:13705664-13705686 CCCCAGGTCCAGGTTTCCCTGGG No data
1036999897_1036999907 11 Left 1036999897 8:13705630-13705652 CCAGTGTTTAACAGCCTTGCTTT No data
Right 1036999907 8:13705664-13705686 CCCCAGGTCCAGGTTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036999907 Original CRISPR CCCCAGGTCCAGGTTTCCCT GGG Intergenic
No off target data available for this crispr