ID: 1037003855

View in Genome Browser
Species Human (GRCh38)
Location 8:13752356-13752378
Sequence CTGCATGTCCAGCCTTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037003855_1037003859 -1 Left 1037003855 8:13752356-13752378 CCGTCCAAAGGCTGGACATGCAG No data
Right 1037003859 8:13752378-13752400 GAAAGGTTGAGATAGGTTTCAGG No data
1037003855_1037003861 15 Left 1037003855 8:13752356-13752378 CCGTCCAAAGGCTGGACATGCAG No data
Right 1037003861 8:13752394-13752416 TTTCAGGTTATGGTGTTTCTAGG No data
1037003855_1037003858 -8 Left 1037003855 8:13752356-13752378 CCGTCCAAAGGCTGGACATGCAG No data
Right 1037003858 8:13752371-13752393 ACATGCAGAAAGGTTGAGATAGG No data
1037003855_1037003860 5 Left 1037003855 8:13752356-13752378 CCGTCCAAAGGCTGGACATGCAG No data
Right 1037003860 8:13752384-13752406 TTGAGATAGGTTTCAGGTTATGG No data
1037003855_1037003862 30 Left 1037003855 8:13752356-13752378 CCGTCCAAAGGCTGGACATGCAG No data
Right 1037003862 8:13752409-13752431 TTTCTAGGAGTAAGAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037003855 Original CRISPR CTGCATGTCCAGCCTTTGGA CGG (reversed) Intergenic
No off target data available for this crispr