ID: 1037003856

View in Genome Browser
Species Human (GRCh38)
Location 8:13752360-13752382
Sequence CTTTCTGCATGTCCAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037003856_1037003861 11 Left 1037003856 8:13752360-13752382 CCAAAGGCTGGACATGCAGAAAG No data
Right 1037003861 8:13752394-13752416 TTTCAGGTTATGGTGTTTCTAGG No data
1037003856_1037003860 1 Left 1037003856 8:13752360-13752382 CCAAAGGCTGGACATGCAGAAAG No data
Right 1037003860 8:13752384-13752406 TTGAGATAGGTTTCAGGTTATGG No data
1037003856_1037003862 26 Left 1037003856 8:13752360-13752382 CCAAAGGCTGGACATGCAGAAAG No data
Right 1037003862 8:13752409-13752431 TTTCTAGGAGTAAGAGAGATTGG No data
1037003856_1037003859 -5 Left 1037003856 8:13752360-13752382 CCAAAGGCTGGACATGCAGAAAG No data
Right 1037003859 8:13752378-13752400 GAAAGGTTGAGATAGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037003856 Original CRISPR CTTTCTGCATGTCCAGCCTT TGG (reversed) Intergenic
No off target data available for this crispr