ID: 1037003860

View in Genome Browser
Species Human (GRCh38)
Location 8:13752384-13752406
Sequence TTGAGATAGGTTTCAGGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037003854_1037003860 9 Left 1037003854 8:13752352-13752374 CCAGCCGTCCAAAGGCTGGACAT No data
Right 1037003860 8:13752384-13752406 TTGAGATAGGTTTCAGGTTATGG No data
1037003853_1037003860 10 Left 1037003853 8:13752351-13752373 CCCAGCCGTCCAAAGGCTGGACA No data
Right 1037003860 8:13752384-13752406 TTGAGATAGGTTTCAGGTTATGG No data
1037003856_1037003860 1 Left 1037003856 8:13752360-13752382 CCAAAGGCTGGACATGCAGAAAG No data
Right 1037003860 8:13752384-13752406 TTGAGATAGGTTTCAGGTTATGG No data
1037003855_1037003860 5 Left 1037003855 8:13752356-13752378 CCGTCCAAAGGCTGGACATGCAG No data
Right 1037003860 8:13752384-13752406 TTGAGATAGGTTTCAGGTTATGG No data
1037003852_1037003860 11 Left 1037003852 8:13752350-13752372 CCCCAGCCGTCCAAAGGCTGGAC No data
Right 1037003860 8:13752384-13752406 TTGAGATAGGTTTCAGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037003860 Original CRISPR TTGAGATAGGTTTCAGGTTA TGG Intergenic
No off target data available for this crispr