ID: 1037003861

View in Genome Browser
Species Human (GRCh38)
Location 8:13752394-13752416
Sequence TTTCAGGTTATGGTGTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037003854_1037003861 19 Left 1037003854 8:13752352-13752374 CCAGCCGTCCAAAGGCTGGACAT No data
Right 1037003861 8:13752394-13752416 TTTCAGGTTATGGTGTTTCTAGG No data
1037003856_1037003861 11 Left 1037003856 8:13752360-13752382 CCAAAGGCTGGACATGCAGAAAG No data
Right 1037003861 8:13752394-13752416 TTTCAGGTTATGGTGTTTCTAGG No data
1037003853_1037003861 20 Left 1037003853 8:13752351-13752373 CCCAGCCGTCCAAAGGCTGGACA No data
Right 1037003861 8:13752394-13752416 TTTCAGGTTATGGTGTTTCTAGG No data
1037003852_1037003861 21 Left 1037003852 8:13752350-13752372 CCCCAGCCGTCCAAAGGCTGGAC No data
Right 1037003861 8:13752394-13752416 TTTCAGGTTATGGTGTTTCTAGG No data
1037003855_1037003861 15 Left 1037003855 8:13752356-13752378 CCGTCCAAAGGCTGGACATGCAG No data
Right 1037003861 8:13752394-13752416 TTTCAGGTTATGGTGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037003861 Original CRISPR TTTCAGGTTATGGTGTTTCT AGG Intergenic
No off target data available for this crispr