ID: 1037012294

View in Genome Browser
Species Human (GRCh38)
Location 8:13858716-13858738
Sequence CAGTAGATTAGTAGTTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037012291_1037012294 20 Left 1037012291 8:13858673-13858695 CCATTTATGTAAAATATCCAAAA No data
Right 1037012294 8:13858716-13858738 CAGTAGATTAGTAGTTGCCAAGG No data
1037012292_1037012294 3 Left 1037012292 8:13858690-13858712 CCAAAATGAGCAAGTTTATAGCC No data
Right 1037012294 8:13858716-13858738 CAGTAGATTAGTAGTTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037012294 Original CRISPR CAGTAGATTAGTAGTTGCCA AGG Intergenic
No off target data available for this crispr