ID: 1037018610

View in Genome Browser
Species Human (GRCh38)
Location 8:13940408-13940430
Sequence TCTGCTTTCTGCCCAGAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037018610_1037018612 -8 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018612 8:13940423-13940445 AAAGCAGAGTCTTTTAAAAAGGG No data
1037018610_1037018618 20 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018618 8:13940451-13940473 GTGTTAAAGGCATGGAGGGAAGG No data
1037018610_1037018617 16 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018617 8:13940447-13940469 CTTGGTGTTAAAGGCATGGAGGG No data
1037018610_1037018613 -2 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018613 8:13940429-13940451 GAGTCTTTTAAAAAGGGACTTGG No data
1037018610_1037018621 23 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018621 8:13940454-13940476 TTAAAGGCATGGAGGGAAGGGGG No data
1037018610_1037018616 15 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018616 8:13940446-13940468 ACTTGGTGTTAAAGGCATGGAGG No data
1037018610_1037018615 12 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018615 8:13940443-13940465 GGGACTTGGTGTTAAAGGCATGG No data
1037018610_1037018611 -9 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018611 8:13940422-13940444 GAAAGCAGAGTCTTTTAAAAAGG No data
1037018610_1037018620 22 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018620 8:13940453-13940475 GTTAAAGGCATGGAGGGAAGGGG No data
1037018610_1037018619 21 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018619 8:13940452-13940474 TGTTAAAGGCATGGAGGGAAGGG No data
1037018610_1037018614 7 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018614 8:13940438-13940460 AAAAAGGGACTTGGTGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037018610 Original CRISPR TCTGCTTTCTGCCCAGAAAG CGG (reversed) Intergenic
No off target data available for this crispr