ID: 1037018619

View in Genome Browser
Species Human (GRCh38)
Location 8:13940452-13940474
Sequence TGTTAAAGGCATGGAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037018610_1037018619 21 Left 1037018610 8:13940408-13940430 CCGCTTTCTGGGCAGAAAGCAGA No data
Right 1037018619 8:13940452-13940474 TGTTAAAGGCATGGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037018619 Original CRISPR TGTTAAAGGCATGGAGGGAA GGG Intergenic
No off target data available for this crispr