ID: 1037032388 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:14125184-14125206 |
Sequence | AAGAATCACTATTGTTGGCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037032386_1037032388 | -10 | Left | 1037032386 | 8:14125171-14125193 | CCTCATGCATAGTAAGAATCACT | 0: 1 1: 0 2: 9 3: 291 4: 501 |
||
Right | 1037032388 | 8:14125184-14125206 | AAGAATCACTATTGTTGGCCAGG | No data | ||||
1037032385_1037032388 | -6 | Left | 1037032385 | 8:14125167-14125189 | CCATCCTCATGCATAGTAAGAAT | 0: 1 1: 4 2: 332 3: 6071 4: 12819 |
||
Right | 1037032388 | 8:14125184-14125206 | AAGAATCACTATTGTTGGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037032388 | Original CRISPR | AAGAATCACTATTGTTGGCC AGG | Intronic | ||
No off target data available for this crispr |