ID: 1037032388

View in Genome Browser
Species Human (GRCh38)
Location 8:14125184-14125206
Sequence AAGAATCACTATTGTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037032386_1037032388 -10 Left 1037032386 8:14125171-14125193 CCTCATGCATAGTAAGAATCACT 0: 1
1: 0
2: 9
3: 291
4: 501
Right 1037032388 8:14125184-14125206 AAGAATCACTATTGTTGGCCAGG No data
1037032385_1037032388 -6 Left 1037032385 8:14125167-14125189 CCATCCTCATGCATAGTAAGAAT 0: 1
1: 4
2: 332
3: 6071
4: 12819
Right 1037032388 8:14125184-14125206 AAGAATCACTATTGTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037032388 Original CRISPR AAGAATCACTATTGTTGGCC AGG Intronic
No off target data available for this crispr