ID: 1037041245

View in Genome Browser
Species Human (GRCh38)
Location 8:14237606-14237628
Sequence AATCACATGGGGCAGTTAAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037041245_1037041250 22 Left 1037041245 8:14237606-14237628 CCGGTTAACTGCCCCATGTGATT 0: 1
1: 0
2: 2
3: 4
4: 96
Right 1037041250 8:14237651-14237673 CTGTCAGACTGTAAGACCAGCGG 0: 1
1: 0
2: 1
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037041245 Original CRISPR AATCACATGGGGCAGTTAAC CGG (reversed) Exonic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
907099208 1:51812693-51812715 AATCATGTGGGGCACTTGACTGG - Intronic
909940140 1:81602131-81602153 AAACACATGAAGCAGTTAATTGG + Intronic
918432208 1:184473100-184473122 AAAGCCATGGGGCAGTTAATTGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919416020 1:197310789-197310811 AATTACATAGGGCAGTTTAGGGG + Intronic
923040394 1:230315557-230315579 AAACACATGGGCCAGTTTAGGGG - Intergenic
923270110 1:232347835-232347857 AAACACATGGTGCAGTTGAAGGG + Intergenic
1063577600 10:7275695-7275717 AATCACATGGCTAAGTTAAGGGG + Intronic
1066352223 10:34646750-34646772 AATCACTTGGGGCAGGGAAGTGG - Intronic
1067398459 10:45947310-45947332 AATTTCATGGGTCAGTTAATAGG + Intergenic
1067866771 10:49916393-49916415 AATTTCATGGGTCAGTTAATAGG + Intronic
1068275273 10:54787122-54787144 AATCACATAATGCAGTTAATTGG + Intronic
1070437068 10:76403791-76403813 AGTCACATGGTGCAGTGAAAGGG + Intronic
1070729322 10:78814359-78814381 GATGACATGGGGCTGTTAAAAGG + Intergenic
1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG + Exonic
1076121879 10:127942984-127943006 AATCACGTGGGCCAGGAAACCGG + Intronic
1080164258 11:29217985-29218007 AAGCACATGGGGCAGTGTACAGG + Intergenic
1085521375 11:77140724-77140746 GATTATATGGGGCAGTTTACGGG + Intronic
1085990100 11:81831056-81831078 CATCACAGGGGGCTGTAAACTGG + Intergenic
1086045437 11:82526486-82526508 AATAACATAGGCCAGTTAGCTGG + Intergenic
1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG + Intronic
1089400767 11:118163301-118163323 AATGGCTTGGTGCAGTTAACGGG - Exonic
1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG + Intergenic
1091312233 11:134582826-134582848 AGTCACATGGGGCTGTTTTCAGG - Intergenic
1094047244 12:26180554-26180576 AAGCACAGGGGACAGTTAAGGGG - Intronic
1102928666 12:116845942-116845964 AAGAACATTTGGCAGTTAACTGG - Intronic
1105214207 13:18274822-18274844 AGTAACTTGGGGCAGTTACCAGG - Intergenic
1105993663 13:25649274-25649296 ATTCACATGGGGCAGCTGGCTGG + Intronic
1108721419 13:53136695-53136717 AATCACATGGGTGAGCTAAGAGG - Intergenic
1110611493 13:77492805-77492827 AGTCATATGGGGAAGTTAAATGG - Intergenic
1118747037 14:68781692-68781714 AATGGCATGGGCCACTTAACAGG - Intergenic
1120031888 14:79651050-79651072 AATCACGTGGTTCAATTAACTGG + Intronic
1128467713 15:67926792-67926814 AATGACATGTGGCATTTAAGGGG + Intergenic
1130182552 15:81645277-81645299 AAATACATGGAGAAGTTAACAGG - Intergenic
1138200877 16:55087489-55087511 AATAACCTGGGAAAGTTAACAGG + Intergenic
1138472497 16:57249290-57249312 AATCCCAGGGGGCTGTTAAGAGG - Intronic
1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG + Intergenic
1143514613 17:7413590-7413612 GATCACATGTGGCAGTGATCAGG + Intronic
1151790809 17:76304682-76304704 GCTCACATGGGACAGATAACTGG - Intronic
1156224548 18:35091224-35091246 AATCTCATGTGACAGTTCACAGG + Intronic
1159463603 18:68751003-68751025 AGTCACATGGTGCAGCTAAGGGG + Intronic
1164665742 19:30034809-30034831 AATCAAAAGGGGTATTTAACAGG - Intergenic
926323559 2:11765545-11765567 AATTACGTGGGGCAGTTAGCCGG + Exonic
929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG + Intronic
934300112 2:91771928-91771950 AGTAACTTGGGGCAGTTACCAGG + Intergenic
939807016 2:146786515-146786537 AGTCACATGTGGGAGTGAACAGG - Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
945285153 2:208074792-208074814 AATCACGCTGGGCAGTTGACAGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1170594248 20:17793400-17793422 AATCACAAGGGGCAGTGAGAGGG + Intergenic
1176387606 21:6146605-6146627 AATCACATGAGCCAGTTCCCTGG - Intergenic
1177770702 21:25512491-25512513 AAACATGTGGGGCAGTTCACAGG + Intergenic
1179528999 21:42005214-42005236 AAAATCATGGGGCTGTTAACAGG - Intronic
1179735866 21:43391643-43391665 AATCACATGAGCCAGTTCCCTGG + Intergenic
1180348877 22:11781203-11781225 AATCACCTGGGGCAGTGATGCGG + Intergenic
1181010827 22:20039658-20039680 CATCACGTGGGGCTGTAAACAGG - Intronic
1181698465 22:24607058-24607080 AGTAACTTGGGGCAGTTACCAGG + Intronic
950889680 3:16392494-16392516 GAACACATGGGGCAGCTGACTGG - Intronic
959931697 3:111991506-111991528 AATCTTATGGGGCAGTTCACAGG - Exonic
961655301 3:128438517-128438539 AATGACAAGGAGCAGTTCACAGG - Intergenic
964448681 3:156788013-156788035 AACCACATGGAGCAGATAAATGG - Intergenic
964601614 3:158507167-158507189 AATCACATGTGGGAGCTAAAAGG + Intronic
967233666 3:187364992-187365014 AATAACATGGGGCTTTCAACTGG + Intergenic
970111020 4:12638402-12638424 AAGCACATGGGGTAGTCAATGGG - Intergenic
971919650 4:32921014-32921036 AGACACAATGGGCAGTTAACAGG - Intergenic
975360401 4:73462966-73462988 CATCAGATGGGGCTGCTAACTGG - Intergenic
976403855 4:84639217-84639239 AATTACCTGGGGGTGTTAACTGG - Intronic
977347520 4:95836078-95836100 AATAACATGGTACAGTTAAGAGG + Intergenic
977822024 4:101483447-101483469 AATCTGATGGGGAAGTTGACAGG - Intronic
980291450 4:130851237-130851259 AAGCACAGAGGGCAGTGAACAGG - Intergenic
981356153 4:143791576-143791598 AATCTTATGGGGCAGTGAAAAGG - Intergenic
981367677 4:143922215-143922237 AATCTTATGGGGCAGTGAAAAGG - Intergenic
981377475 4:144032460-144032482 AATCTTATGGGGCAGTGAAAAGG - Intergenic
981650448 4:147051504-147051526 AATCACAAGGGTCAGTAAATGGG + Intergenic
986823235 5:11492188-11492210 TACCACATGGGGCAGGTAAACGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1008328410 6:50215592-50215614 AATTGCATCAGGCAGTTAACAGG - Intergenic
1011002849 6:82610502-82610524 AATCACATGTTGCATTTAGCTGG - Intergenic
1014734185 6:125072940-125072962 AATCTCATGGTGCAGTTATAAGG + Intronic
1020446079 7:8269315-8269337 AATGTCATGGGGCAGACAACTGG - Intergenic
1021362636 7:19734509-19734531 AATCACAAGGGTCATTTAAGAGG + Intronic
1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG + Exonic
1025816191 7:64914449-64914471 AATCACATGAGGCACTTATTAGG - Intronic
1026467694 7:70668684-70668706 TATCACGTTAGGCAGTTAACAGG + Intronic
1030052236 7:105548254-105548276 AATCACTTGGGCCACTTCACAGG - Intronic
1033684666 7:143627379-143627401 AATCCCTTGGGGCAATTAAGAGG - Intronic
1033687842 7:143706598-143706620 AATCCCTTGGGGCAATTAAGAGG - Intronic
1033699945 7:143830244-143830266 AATCCCTTGGGGCAATTAAGAGG + Intergenic
1034687456 7:152985477-152985499 AATCAGATGGTGCAGTAAACAGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037392776 8:18411997-18412019 AATGACATAGGCAAGTTAACAGG - Intergenic
1039916998 8:41867482-41867504 CATCACTTGGGGCTGTTATCAGG - Intronic
1044410630 8:91878698-91878720 AAACACATAGGTCAGTTACCAGG + Intergenic
1044850117 8:96419625-96419647 AATCACATGGGGAAGCTTTCAGG - Intergenic
1047890865 8:129307204-129307226 AATCACTTTGAGCAGTTAAATGG + Intergenic
1056608277 9:88105800-88105822 AAGCACATGGGGCATTTTCCAGG - Intergenic
1060113244 9:120921311-120921333 AAAGAAATGGGGCAATTAACAGG + Intronic
1187088525 X:16068036-16068058 AATCACATAGGCCAGTTTCCAGG - Intergenic
1187096852 X:16157762-16157784 AGTCACATGGGGAAGTTGAGTGG + Intergenic
1193950458 X:87790969-87790991 AAATACATGGAGCAATTAACCGG - Intergenic
1196695309 X:118605340-118605362 ACTCACATGGTGCAGTTGATAGG - Exonic
1202036870 Y:20645083-20645105 AATCACTTGGGGCAATTAGTTGG + Intergenic