ID: 1037050197

View in Genome Browser
Species Human (GRCh38)
Location 8:14362713-14362735
Sequence CTGGTTCACCTCACTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2476
Summary {0: 7, 1: 308, 2: 666, 3: 710, 4: 785}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050197_1037050204 30 Left 1037050197 8:14362713-14362735 CCAGTCCCAGTGAGGTGAACCAG 0: 7
1: 308
2: 666
3: 710
4: 785
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050197 Original CRISPR CTGGTTCACCTCACTGGGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr