ID: 1037050198

View in Genome Browser
Species Human (GRCh38)
Location 8:14362718-14362740
Sequence AGGCACTGGTTCACCTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 7, 3: 27, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050198_1037050204 25 Left 1037050198 8:14362718-14362740 CCCAGTGAGGTGAACCAGTGCCT 0: 1
1: 0
2: 7
3: 27
4: 175
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050198 Original CRISPR AGGCACTGGTTCACCTCACT GGG (reversed) Intronic
901422785 1:9162261-9162283 AGGCACTGGAGCATCTCCCTCGG + Intergenic
904329134 1:29746503-29746525 AGACACTGGGTCACCTAACAAGG - Intergenic
910915059 1:92279575-92279597 GGTACCTGGTTCACCTCACTGGG + Intronic
912272892 1:108228769-108228791 AGGCCTTTGCTCACCTCACTGGG + Intronic
912295328 1:108465553-108465575 AGGCCTTTGCTCACCTCACTGGG - Intronic
913363179 1:118004837-118004859 AGTACCTGGTTCATCTCACTGGG - Intronic
913599045 1:120405221-120405243 AGGCTCTTGCTCACCTCACTGGG - Intergenic
914088334 1:144474399-144474421 AGGCTCTTGCTCACCTCACTGGG + Intergenic
914310277 1:146459811-146459833 AGGCTCTTGCTCACCTCACTGGG - Intergenic
914379560 1:147104373-147104395 AGGCTCTTGCTCACCTCACTGGG + Intergenic
914591832 1:149113328-149113350 AGGCTCTTGCTCACCTCACTGGG + Intergenic
915044299 1:152999181-152999203 AGGCACTGATTTCCATCACTGGG + Intergenic
915109277 1:153552891-153552913 ATGCACTGAGTCACCTCAGTGGG + Intergenic
915303616 1:154965648-154965670 AGGCACTGCTGCAGCTCAATGGG - Exonic
917323831 1:173811785-173811807 GGTAACTGGTTCATCTCACTGGG + Intronic
917904050 1:179572090-179572112 GGTAACTGGTTCACCTCACCAGG - Intronic
920631773 1:207659624-207659646 AGTACCTGGTTCATCTCACTGGG + Intronic
920898987 1:210087541-210087563 AGGCTCTGACTCCCCTCACTGGG + Intronic
921419834 1:214933673-214933695 AGGCACCCTTTCACCCCACTGGG + Intergenic
921750263 1:218783922-218783944 AGTCAGTGGTTCACATCACTTGG + Intergenic
922715918 1:227871983-227872005 AGTGCCTGGTTCATCTCACTGGG + Intergenic
923504093 1:234590879-234590901 AGGCACTGGTTCAACTGATTTGG + Intergenic
1063377438 10:5562426-5562448 GGTCTCTGGTTCCCCTCACTGGG - Intergenic
1064186699 10:13168108-13168130 AGGCTCTGGCTCACACCACTGGG - Intronic
1067346289 10:45441287-45441309 AGGCACCAGGTCACCTGACTGGG + Intronic
1069062593 10:63909900-63909922 AGGCACTGGCACACCCCACATGG - Intergenic
1069259881 10:66382051-66382073 AGTACCTGGTTCATCTCACTGGG + Intronic
1075028094 10:119001822-119001844 ACTTACTGGCTCACCTCACTGGG + Intergenic
1075302111 10:121334161-121334183 AGGCATTGATTCAACTCACATGG + Intergenic
1075984014 10:126767389-126767411 AGGACCTGGTTCATCTCACTGGG - Intergenic
1075996605 10:126881964-126881986 AGGTACCGGTTCATCTCACTAGG + Intergenic
1078336213 11:10465509-10465531 AGGTACTGGTTCATCTCACTGGG + Intronic
1078981120 11:16536423-16536445 AGTACCTGGTTCATCTCACTGGG + Intronic
1079696024 11:23483805-23483827 AGGTACTGGTTCATCTCATTGGG + Intergenic
1080245865 11:30178524-30178546 AGGTACCGGTTCATGTCACTGGG + Intergenic
1081758401 11:45560518-45560540 CTTCACTTGTTCACCTCACTTGG + Intergenic
1081856951 11:46310031-46310053 AGGAACTGGTTCACCTCCAGAGG - Exonic
1084104978 11:66975287-66975309 AGGCACTGGGCCACCTCAGAGGG + Exonic
1084889443 11:72229460-72229482 AGGACCTTGTCCACCTCACTAGG - Exonic
1087347459 11:96990033-96990055 AGGTTCTGGTTCATCTCACAGGG + Intergenic
1088175331 11:107047264-107047286 AGGCATTGGCTCACCTAACAAGG - Intergenic
1089390442 11:118098281-118098303 AGGCACTGGCTCAGCTCTGTCGG - Intronic
1092718415 12:11416279-11416301 AGGTACTGGTTCATCTCACTGGG + Intronic
1092822074 12:12362067-12362089 AGGCCCTGGTTTACTTAACTTGG + Intronic
1093892536 12:24540009-24540031 AGGCACTAGTTCATAGCACTTGG - Intergenic
1095845204 12:46737081-46737103 GGGACCTGGTTCATCTCACTGGG + Intergenic
1096244023 12:49974460-49974482 TGGCACTGGGCCACCTCATTGGG + Exonic
1096533671 12:52257471-52257493 AGGGGCTGGTTCACCTCAACAGG - Intronic
1097994078 12:65868521-65868543 AGGCAATGAGTCACCTCACTTGG + Intronic
1098176085 12:67792654-67792676 AGTACCTGGTTCATCTCACTGGG - Intergenic
1098282322 12:68874169-68874191 AGTCACTTGTACACCCCACTGGG + Intronic
1098704503 12:73671188-73671210 AGGTACTGGTTCATCTCATTGGG + Intergenic
1101401820 12:104394587-104394609 AGGTACCGGTTCATCTCACTGGG - Intergenic
1101883128 12:108639409-108639431 AGGCACTGGTTTCCTTCACCAGG - Intergenic
1102412598 12:112733056-112733078 AGGCTCTGGGTCACCTCCCCTGG + Intronic
1102618004 12:114171660-114171682 AGGCACAACTTCAGCTCACTGGG - Intergenic
1108471801 13:50774290-50774312 AGTAGCTGGTTCATCTCACTGGG - Intronic
1108473404 13:50789775-50789797 GGGCAGTAATTCACCTCACTGGG - Intronic
1108796976 13:54043934-54043956 AGTACCTGGTTCATCTCACTGGG + Intergenic
1108865363 13:54917226-54917248 AGGTACTGGTTAATCTCATTGGG + Intergenic
1109650093 13:65313490-65313512 AGGCACTGCCTAATCTCACTGGG + Intergenic
1119585660 14:75832500-75832522 AGCCACAGGTCCACCTGACTTGG + Intronic
1119787966 14:77326989-77327011 AGACACAGGTTCACTTCTCTGGG - Intronic
1121298819 14:92852921-92852943 AGGACCGGGTTCATCTCACTGGG + Intergenic
1121357697 14:93229827-93229849 AGGGACTGGTTCACGACATTGGG + Intergenic
1122319385 14:100844638-100844660 AGGCCTTGGTTCACATCATTAGG + Intergenic
1124666609 15:31598296-31598318 AGGTACAGGTTCATCTCATTGGG + Intronic
1130441827 15:83962811-83962833 AGGTACTGGCTCATCTCATTGGG + Intronic
1130916783 15:88311360-88311382 AGTCACTTACTCACCTCACTAGG - Intergenic
1131029297 15:89173083-89173105 AGACATTTGTTCACCTCCCTTGG - Intronic
1132667689 16:1089610-1089632 TGGCACTGGGTGTCCTCACTTGG + Intergenic
1134244915 16:12532825-12532847 AGACACTGGCTCCCCTCGCTAGG - Intronic
1134440974 16:14299541-14299563 GGGCACTGCTTCGCCTCTCTGGG - Intergenic
1137721216 16:50628586-50628608 GGGCACCGATTCTCCTCACTAGG - Intronic
1139207554 16:65043910-65043932 AGGCTCTGCTTCACCTCTTTGGG + Intronic
1140233788 16:73140518-73140540 AGGCAAGGGTTAACCTGACTAGG + Intronic
1141386128 16:83623999-83624021 AGGCATTGGTACTCATCACTGGG + Intronic
1142611676 17:1111861-1111883 GGCCACTGGGTCTCCTCACTTGG + Intronic
1144179583 17:12739443-12739465 AGGCAGAGGTTCAGCTCACTAGG + Intronic
1147778196 17:42918917-42918939 AGGCACCATTTCACCTCTCTTGG - Intergenic
1152280901 17:79384396-79384418 AGGGGCTGGTCCACCTCCCTGGG + Intronic
1153897610 18:9580874-9580896 AGGCACTGGTCTACCTCACAGGG + Intronic
1159629740 18:70735966-70735988 AGGTACTGGTTCATCTCACTGGG + Intergenic
1162016168 19:7847695-7847717 AGTCACTGGTTCCCCTCTGTCGG + Intronic
1163978974 19:20880560-20880582 AGCCACTCATTCACCTCAGTGGG + Intergenic
1163979632 19:20886944-20886966 AGGCACTCATTCACCACAGTGGG + Intergenic
1163980826 19:20898356-20898378 AGCCACTTGTTCACCACAGTGGG + Intergenic
1163982135 19:20910908-20910930 AGGCACTCATTCACCACAATGGG + Intergenic
1167667448 19:50831131-50831153 GGGAACTGCTTCACCTCTCTGGG - Intronic
926693801 2:15756272-15756294 AGTGACTGCTCCACCTCACTGGG - Intergenic
928759207 2:34561340-34561362 AGGCCTGGGTTCATCTCACTGGG - Intergenic
930859224 2:56052569-56052591 AGCCACTGCCCCACCTCACTGGG - Intergenic
930860431 2:56065895-56065917 GGTCCCTGGTTCATCTCACTGGG - Intergenic
931030304 2:58168244-58168266 AGGTACCGGCTCACCTCATTGGG + Intronic
931352891 2:61507836-61507858 TGGCACTATTTCAGCTCACTAGG - Intronic
933880373 2:86663778-86663800 AGTACCTGGTTCATCTCACTGGG + Intronic
935350255 2:102146473-102146495 AAGCAATGGCTCACCTCACTAGG - Intronic
937135911 2:119553164-119553186 AGGCACCGTTTCACCTCTGTAGG + Intronic
938723884 2:134090107-134090129 AGGGACTAGTTCACCTCTTTAGG + Intergenic
939019986 2:136947007-136947029 GGTAACTGGTTCATCTCACTGGG - Intronic
941646479 2:168046558-168046580 AGTCACTTGCTCACCTCCCTAGG + Intronic
942503152 2:176613587-176613609 TGGCAATGGTTCAGCTCTCTTGG + Intergenic
943716731 2:191160664-191160686 AGGTACAGGTTCATCTCATTGGG + Intergenic
944033930 2:195269730-195269752 AGTATCTGGTTCATCTCACTGGG - Intergenic
946890847 2:224274558-224274580 AAGCACAGGTGCATCTCACTAGG + Intergenic
1169571396 20:6910096-6910118 AGGGTCTGGTTAAGCTCACTTGG - Intergenic
1170270775 20:14524901-14524923 AAGAACTCGTTCACCACACTAGG + Intronic
1170646171 20:18197742-18197764 AAGCACTGGTTTAGCTCTCTGGG - Intergenic
1172791412 20:37508169-37508191 AGGCACTGTTTCACACTACTGGG - Intronic
1173344916 20:42190455-42190477 AGGCTCTAGCTCACCTCCCTGGG - Intronic
1174331338 20:49821262-49821284 AGAAACTGGTTCAACTCTCTTGG + Intronic
1175036768 20:56006655-56006677 AGGCACTAGTTCACCTTGTTTGG - Intergenic
1175908958 20:62395558-62395580 AGCCACTGTTTCTCCTCCCTTGG + Intronic
1176305421 21:5120609-5120631 AGGCAGTGGTTCACCTGCCAGGG + Intronic
1179851634 21:44141422-44141444 AGGCAGTGGTTCACCTGCCAGGG - Intronic
1180799307 22:18624390-18624412 AGGCACTGGCCCACCTCTCTAGG + Intergenic
1181222411 22:21370876-21370898 AGGCACTGGCCCACCTCTCTAGG - Intergenic
1181638171 22:24183862-24183884 AGGCACTGGCCCACCTCTCTAGG - Intronic
1182349069 22:29688528-29688550 TGGGCCTGATTCACCTCACTGGG - Intronic
1184422929 22:44392257-44392279 GGGCACGGGTTCACCTAGCTGGG + Intergenic
950482839 3:13255203-13255225 AGGCAGTGGCTCCCCTCCCTTGG - Intergenic
950573323 3:13815465-13815487 AGGCACTGGTTCATCTCCTCAGG + Intergenic
951454226 3:22872598-22872620 AGGCACTGTTTCAGCCCAGTGGG - Intergenic
956569860 3:70681683-70681705 AGGTACTGGGTTATCTCACTGGG - Intergenic
962887385 3:139640055-139640077 ATGCACTGTCCCACCTCACTGGG - Intronic
962914151 3:139883465-139883487 AGTACCTGGTTCATCTCACTGGG - Intergenic
963005372 3:140722158-140722180 AGGCTTTGGTTCACCTCATTTGG - Intergenic
964269969 3:154945254-154945276 AGTACCTGGTTCATCTCACTGGG + Intergenic
964479917 3:157130191-157130213 AGACACTCGTTCCCCTCCCTTGG - Intergenic
965324677 3:167289412-167289434 TGGGACTGGTTCATCTCATTGGG + Intronic
966291097 3:178360905-178360927 AGTACCTGGTTCATCTCACTGGG + Intergenic
966351747 3:179038681-179038703 GGTACCTGGTTCACCTCACTGGG + Intronic
967681686 3:192371024-192371046 TGACACTGGTCAACCTCACTGGG + Intronic
970275329 4:14393511-14393533 TGGCACAGGTTCACCCCACAGGG - Intergenic
972119621 4:35683218-35683240 AGGTCCGGGTTCATCTCACTAGG - Intergenic
973883491 4:55297249-55297271 GGTAACTGGTTCATCTCACTGGG + Intergenic
974566854 4:63589698-63589720 GGTAACTGGTTCACCTCACTGGG + Intergenic
976669414 4:87635997-87636019 ATTCCCTGGTTCATCTCACTGGG + Intergenic
979421298 4:120508902-120508924 GGTACCTGGTTCACCTCACTGGG + Intergenic
980583993 4:134789343-134789365 GGTAACTGGTTCATCTCACTGGG + Intergenic
981850922 4:149229498-149229520 AGTGCCTGGTTCATCTCACTGGG + Intergenic
982561877 4:156938050-156938072 AAGTACTGTTTCACCTCATTTGG - Intronic
985497001 5:214409-214431 AGGGACTGGTTGAGTTCACTGGG - Intronic
985729957 5:1541588-1541610 AGGCTCTGGTTCATAACACTTGG + Intergenic
985738568 5:1600549-1600571 AGGGACTGGTTGAGTTCACTGGG + Intergenic
989674006 5:43952984-43953006 AGTAACGGGTTCATCTCACTGGG + Intergenic
990230348 5:53706202-53706224 AGGTACTGGTTCATCTCACTGGG - Intergenic
990744390 5:58943810-58943832 AGTCACTGGTTCAGGACACTGGG + Intergenic
991538764 5:67703771-67703793 AGGTACAGGTTCATCTCACTGGG + Intergenic
991545737 5:67780104-67780126 AGGTACCAGTTCATCTCACTAGG + Intergenic
993307665 5:86291192-86291214 AGGCCTTTGCTCACCTCACTGGG - Intergenic
993984614 5:94583142-94583164 AGTACCTGGTTCATCTCACTGGG + Intronic
994160841 5:96555337-96555359 AGGTACGTGTTCATCTCACTGGG + Intronic
1000500316 5:162040223-162040245 AGGCACCTGTTAACCTCAATTGG + Intergenic
1002413220 5:179101163-179101185 AGGTACGGGTTCATCTCACTAGG + Intergenic
1002569855 5:180134158-180134180 GGGCACTGCCTCTCCTCACTGGG - Intronic
1004988075 6:21105428-21105450 TGGCAGTGGTTCAAATCACTTGG - Intronic
1005747081 6:28848539-28848561 GGTAACTGGTTCATCTCACTGGG + Intergenic
1007389233 6:41540734-41540756 AGGCACTGGGTCTGCTCTCTTGG + Intergenic
1007477526 6:42128859-42128881 AGGCCCTGGCTTTCCTCACTGGG - Intronic
1008436914 6:51486432-51486454 AGTACCTGGTTCATCTCACTGGG - Intergenic
1008725783 6:54417118-54417140 TGGCACTAGTTTACCTCTCTGGG - Intergenic
1009370435 6:62893965-62893987 AGGCACTGGATCAGCTGACATGG + Intergenic
1010264794 6:73853772-73853794 ATCTACTGGTTCTCCTCACTGGG - Intergenic
1012209344 6:96500329-96500351 AGCACCTGGTTCATCTCACTGGG - Intergenic
1012539828 6:100349518-100349540 AGGCACTTGCTCACCACAGTAGG + Intergenic
1012933185 6:105338513-105338535 AAGTACCGGTTCATCTCACTGGG + Intronic
1013305814 6:108846524-108846546 AGACTCTGCCTCACCTCACTTGG - Intergenic
1014216383 6:118756132-118756154 GGGCACAGGTCCACCTCTCTGGG + Intergenic
1014293732 6:119592213-119592235 AGGCACTTTTTCACTTCAATTGG + Intergenic
1015386884 6:132634921-132634943 GGTAACTGGTTCATCTCACTGGG + Intergenic
1016942472 6:149494418-149494440 AGGCACTGATCCACCTCAAGTGG - Intergenic
1018094611 6:160374353-160374375 AGGCACCAGCTCATCTCACTGGG - Intronic
1018215083 6:161518655-161518677 GAGCCGTGGTTCACCTCACTAGG - Intronic
1019523088 7:1469279-1469301 CGGCACTGGCTCACCCCACCCGG + Intergenic
1019639769 7:2097140-2097162 AGGCACAGGCTCACCCTACTCGG + Intronic
1021156312 7:17215314-17215336 AGGTACTGGTTCATCTCACTGGG + Intergenic
1027446173 7:78275293-78275315 AGTACCTGGTTCATCTCACTGGG - Intronic
1028078789 7:86548298-86548320 GGTCCCTGGTTCATCTCACTGGG - Intergenic
1028692110 7:93664066-93664088 GGTACCTGGTTCACCTCACTGGG - Intronic
1030292989 7:107890763-107890785 GGGCACTGTTTAACCTCTCTGGG + Intergenic
1031717390 7:125125566-125125588 AGGTACCGGTTCATCTCACTGGG - Intergenic
1036553677 8:9838461-9838483 AGTACCCGGTTCACCTCACTGGG + Intergenic
1037050198 8:14362718-14362740 AGGCACTGGTTCACCTCACTGGG - Intronic
1039145098 8:34438389-34438411 AGTACCTGGTTCATCTCACTGGG + Intergenic
1040612311 8:48997707-48997729 AGGTACCGGTTCATCTCACTGGG + Intergenic
1042842862 8:73141618-73141640 AGGCACAGCTTCACTTCCCTAGG + Intergenic
1044449234 8:92314189-92314211 GGTATCTGGTTCACCTCACTGGG - Intergenic
1044960819 8:97529055-97529077 AGGTACAGGTGCATCTCACTGGG - Intergenic
1045199575 8:99967018-99967040 AGGTACTTGTTCATCTCATTGGG + Intronic
1045933567 8:107654271-107654293 GGTAACTGGTTCATCTCACTGGG - Intergenic
1045939188 8:107717974-107717996 AGGTACCTGTTCATCTCACTAGG - Intergenic
1048885956 8:138910007-138910029 AGGGACTGGTTCACCTATCTTGG + Intronic
1051913058 9:22177123-22177145 AGGTATGGGTTCATCTCACTGGG + Intergenic
1055568263 9:77590579-77590601 AGACACTGGTTCACATGGCTTGG - Intronic
1056668019 9:88597414-88597436 AGGTACTGGTTCATCTCATTGGG + Intergenic
1058082009 9:100710464-100710486 AGGTACTGGTTCATCTCACTGGG - Intergenic
1058221809 9:102312779-102312801 ACTCACAGGTTCACATCACTGGG - Intergenic
1058471198 9:105280997-105281019 AGTCACAGGTTCACCTCGGTGGG - Intronic
1058536010 9:105960953-105960975 AGCCTCTAGTTCACCTCAATTGG - Intergenic
1187437967 X:19289910-19289932 AGCCACTGTCACACCTCACTTGG + Intergenic
1188944289 X:36278614-36278636 AGTACCTGGTTCATCTCACTGGG - Intronic
1189659975 X:43286337-43286359 AGGCACTGCTTGAGCTCACATGG - Intergenic
1192727459 X:73768015-73768037 GGTAACTGGTTCATCTCACTGGG + Intergenic
1192796748 X:74429793-74429815 AGTCACTTGTTCAGGTCACTGGG + Intronic
1192825685 X:74693373-74693395 AGGTACTGGTTCATCTCACTGGG - Intergenic
1193685335 X:84571273-84571295 AGTAACTGGCTCATCTCACTGGG + Intergenic
1194644378 X:96440820-96440842 AGGCACTGATTCTCCTCTTTAGG + Intergenic
1195426554 X:104739063-104739085 ACTCACTGGTTCTCCTCCCTTGG - Intronic
1201333531 Y:12853558-12853580 AGTACCTGGTTCATCTCACTGGG - Intronic