ID: 1037050199

View in Genome Browser
Species Human (GRCh38)
Location 8:14362719-14362741
Sequence CAGGCACTGGTTCACCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050199_1037050204 24 Left 1037050199 8:14362719-14362741 CCAGTGAGGTGAACCAGTGCCTG 0: 1
1: 0
2: 0
3: 21
4: 148
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050199 Original CRISPR CAGGCACTGGTTCACCTCAC TGG (reversed) Intronic
900591077 1:3460216-3460238 CAGGCTCTGGCTCGCCTGACAGG + Intronic
901241530 1:7696941-7696963 CATGCACTGGTTTAACTCACAGG - Intronic
907898355 1:58714546-58714568 CAGGGTCTTGTTCACCTCAGTGG - Intergenic
912272891 1:108228768-108228790 CAGGCCTTTGCTCACCTCACTGG + Intronic
912295329 1:108465554-108465576 CAGGCCTTTGCTCACCTCACTGG - Intronic
913513137 1:119580765-119580787 CAAGCCCTGATGCACCTCACAGG + Intergenic
913513659 1:119584471-119584493 CAGGCCCTGGGTGACCTCACCGG - Intergenic
913517284 1:119615389-119615411 CAGGCCCTGGGTGACCTCACCGG - Intergenic
913599046 1:120405222-120405244 CAGGCTCTTGCTCACCTCACTGG - Intergenic
914088333 1:144474398-144474420 CAGGCTCTTGCTCACCTCACTGG + Intergenic
914310278 1:146459812-146459834 CAGGCTCTTGCTCACCTCACTGG - Intergenic
914379559 1:147104372-147104394 CAGGCTCTTGCTCACCTCACTGG + Intergenic
914591831 1:149113327-149113349 CAGGCTCTTGCTCACCTCACTGG + Intergenic
915109276 1:153552890-153552912 CATGCACTGAGTCACCTCAGTGG + Intergenic
920013213 1:202885312-202885334 TAGGCCCTGGATCACCTCAAAGG + Intronic
920459419 1:206127846-206127868 TAGGCACTAGATCCCCTCACAGG - Intergenic
921446425 1:215252222-215252244 CTGGCAAATGTTCACCTCACAGG + Intergenic
921448175 1:215271055-215271077 CAGGCAGTGGCTCACCACCCTGG - Intergenic
923039196 1:230307790-230307812 CAGGCACTGCTTCCCCTGATGGG - Intergenic
923065785 1:230516070-230516092 CAGGGACTGATTCACTTCAGAGG - Intergenic
1067155437 10:43777296-43777318 AAGGCACTGGCTCACCTGCCTGG + Intergenic
1068239592 10:54288488-54288510 GAGGTACTGGTTCATCTCACTGG + Intronic
1068629258 10:59283260-59283282 CAGGCACTGTTTTCCCTCAGGGG + Intronic
1073620159 10:105038337-105038359 CAGGCAATGCATCAGCTCACAGG - Intronic
1075028093 10:119001821-119001843 CACTTACTGGCTCACCTCACTGG + Intergenic
1075984015 10:126767390-126767412 GAGGACCTGGTTCATCTCACTGG - Intergenic
1078336212 11:10465508-10465530 GAGGTACTGGTTCATCTCACTGG + Intronic
1079696023 11:23483804-23483826 GAGGTACTGGTTCATCTCATTGG + Intergenic
1082793511 11:57363843-57363865 CAGGGACTGGTTCTCTTCCCGGG - Intronic
1083740741 11:64710424-64710446 CATGCACTTGTTTGCCTCACTGG + Intronic
1084104977 11:66975286-66975308 GAGGCACTGGGCCACCTCAGAGG + Exonic
1087347458 11:96990032-96990054 TAGGTTCTGGTTCATCTCACAGG + Intergenic
1090415677 11:126538696-126538718 CAGTCACTGTTTCAGCTCTCAGG + Intronic
1091313063 11:134588380-134588402 CCAGCACAGGTTCACATCACAGG - Intergenic
1091791897 12:3276761-3276783 GAGACAGTGGTACACCTCACTGG - Intronic
1092718414 12:11416278-11416300 GAGGTACTGGTTCATCTCACTGG + Intronic
1096586975 12:52629183-52629205 CAAGCACTGTTTCAGCTCTCAGG - Intergenic
1097270722 12:57772376-57772398 CAGGCACCTGTGCACCCCACAGG + Exonic
1098704502 12:73671187-73671209 GAGGTACTGGTTCATCTCATTGG + Intergenic
1100517150 12:95339244-95339266 CAGGCTGTGGCTCACCCCACTGG + Intergenic
1101401821 12:104394588-104394610 GAGGTACCGGTTCATCTCACTGG - Intergenic
1102618005 12:114171661-114171683 CAGGCACAACTTCAGCTCACTGG - Intergenic
1104600042 12:130146769-130146791 CAGGCATTGGGTCAGATCACAGG + Intergenic
1105574471 13:21637306-21637328 CAAGCACTGCTTTACCTCAGTGG + Intergenic
1111756534 13:92403383-92403405 TAGGAACTGGTCCACATCACAGG + Intronic
1113972537 13:114200759-114200781 CGGGCTCTTGTGCACCTCACAGG + Intergenic
1122761038 14:104026756-104026778 CAGCCAGTGGTTCGCCTCTCTGG + Exonic
1123108318 14:105853199-105853221 CAGGCTCTGGTTCTGCTCACCGG + Intergenic
1126253614 15:46598297-46598319 CATGCACCAGTTCACCTAACAGG - Intergenic
1126887956 15:53172734-53172756 CAGGTTCTGGTGCTCCTCACAGG - Intergenic
1131056026 15:89375681-89375703 CAGACACTGGAGCCCCTCACTGG + Intergenic
1132057086 15:98660464-98660486 CAGGCACTGGGCCACCTCCTGGG - Intronic
1132699993 16:1218229-1218251 CAGGCAGTGCTTGTCCTCACGGG - Exonic
1133111463 16:3550425-3550447 CAGGCCCTGGTTCACCTTCAGGG + Exonic
1134440975 16:14299542-14299564 CGGGCACTGCTTCGCCTCTCTGG - Intergenic
1135949616 16:26901941-26901963 CAGGCCCTGGTCTACCTCTCTGG - Intergenic
1136087324 16:27894842-27894864 GAGGCACTGTTCCACCTCCCAGG + Intronic
1136289204 16:29261526-29261548 CCGGCTCTGGTTCCCCTCCCTGG - Intergenic
1136429054 16:30186473-30186495 CAGGCCCTGGTCCAGCTCCCAGG + Intronic
1141563695 16:84887100-84887122 CAGCCACTGGTTCACCAAGCTGG - Intronic
1141622057 16:85241592-85241614 CAGGCACTGGGAGACCACACCGG - Intergenic
1142094931 16:88234453-88234475 CCGGCTCTGGTTCCCCTCCCTGG - Intergenic
1142982211 17:3678841-3678863 CAGGCACCTGCTCACCGCACAGG + Intronic
1144465210 17:15491548-15491570 AAGGCACTGGTTCCCTTCAGGGG + Intronic
1144647020 17:16982027-16982049 CAAGCACTGGTGGAGCTCACAGG + Intergenic
1147959195 17:44155790-44155812 CAGGTGCTGGCTCACCTGACAGG - Intronic
1151813397 17:76458687-76458709 CAGCCACTGGAGCACCTCTCTGG + Intronic
1152103691 17:78316800-78316822 CAGGCACAGGGCCACCTCCCCGG - Intergenic
1153897609 18:9580873-9580895 AAGGCACTGGTCTACCTCACAGG + Intronic
1156243419 18:35274686-35274708 GATGCTTTGGTTCACCTCACTGG + Intronic
1159013713 18:63083785-63083807 CAGGCACTGGAGCAGCTCAGAGG + Intergenic
1159629739 18:70735965-70735987 GAGGTACTGGTTCATCTCACTGG + Intergenic
1162784959 19:13028878-13028900 AAGGCACTGGTTCACCTTCAGGG - Intronic
1163979631 19:20886943-20886965 CAGGCACTCATTCACCACAGTGG + Intergenic
1163979815 19:20888686-20888708 CAGCCACTCGTTCACCACAAGGG + Intergenic
1163980638 19:20896487-20896509 CAGCCACTCGTTCATCACACTGG + Intergenic
1163980825 19:20898355-20898377 CAGCCACTTGTTCACCACAGTGG + Intergenic
1163982134 19:20910907-20910929 CAGGCACTCATTCACCACAATGG + Intergenic
1166109434 19:40613398-40613420 CAGGCACTCGTTCACGTCTAGGG - Exonic
1166733104 19:45069614-45069636 CAGTCACTGTCCCACCTCACAGG + Intronic
1166772878 19:45294870-45294892 AAGGGATTGGTTCACATCACAGG + Intronic
1167540215 19:50081400-50081422 CAGTCACTTCTTCACCTCAAAGG + Intergenic
1168225260 19:54990072-54990094 CAGGGACTGGTTGACTTCAAGGG - Exonic
925284148 2:2705023-2705045 CAGCCACTGGGGCACCTCCCAGG + Intergenic
929719291 2:44351063-44351085 CAGGCACTTGCTCACCACGCTGG + Intronic
930859225 2:56052570-56052592 CAGCCACTGCCCCACCTCACTGG - Intergenic
931483979 2:62671676-62671698 ATGGCACTGCTTCACCTCCCTGG - Intergenic
932410676 2:71545562-71545584 CAGACAGAGGGTCACCTCACAGG + Intronic
944600408 2:201297580-201297602 CAAGGAATGCTTCACCTCACTGG - Intronic
946649838 2:221880198-221880220 CAGGCAGTGTTTCAGCTCTCAGG + Intergenic
948491179 2:238314264-238314286 CAGGCCCTGCCTCCCCTCACCGG - Intergenic
948778157 2:240300671-240300693 AAGGCTCTGGCTCACGTCACAGG - Intergenic
1170410164 20:16081387-16081409 CTGGCACTGGTCTCCCTCACAGG + Intergenic
1172206174 20:33164397-33164419 CAGGGTCTGGTTCCCCTCATGGG - Intronic
1172763300 20:37336811-37336833 CAGGCACTGGTGAATCTCAGAGG + Intergenic
1176305420 21:5120608-5120630 GAGGCAGTGGTTCACCTGCCAGG + Intronic
1177281314 21:18986405-18986427 CAGGAACTGTTTCAGCTCAGAGG + Intergenic
1179128135 21:38610832-38610854 AAGGAACTGCTTCACCGCACTGG + Intronic
1179851635 21:44141423-44141445 GAGGCAGTGGTTCACCTGCCAGG - Intronic
1181115566 22:20631016-20631038 CAGGCACAGGGACACCTCTCGGG + Intergenic
1181765137 22:25085972-25085994 CAGGCACTGTGTCACGTGACAGG - Intronic
1181951672 22:26558279-26558301 CAGGCACTGGGCCACAACACTGG + Intronic
1182092294 22:27604052-27604074 CTGGCACTGCCTCAGCTCACAGG + Intergenic
1183625026 22:38996595-38996617 CAGGCACTTGTTCATCTCTGAGG - Intergenic
1183693614 22:39405894-39405916 CAGACACTGGTTCACTACAGTGG - Intronic
1184422928 22:44392256-44392278 CGGGCACGGGTTCACCTAGCTGG + Intergenic
950095932 3:10330428-10330450 CAGGCACTGCTGCCCCTCCCAGG - Intronic
950976249 3:17248764-17248786 CAGGCACTGATCCTCCTCTCTGG + Intronic
954610522 3:51942498-51942520 CAGCCTCTGCTTCACCCCACTGG + Exonic
954680435 3:52343118-52343140 CAGGCTCTGCCTCATCTCACTGG - Intronic
960459398 3:117914636-117914658 CAGGCACTGGATCCAATCACTGG + Intergenic
961556215 3:127698179-127698201 CAGGCTGTGGTTCACATCAGGGG - Intronic
961656171 3:128443208-128443230 CAGGCCCAGGTTCACATCAAGGG + Intergenic
961971396 3:130972183-130972205 CAGGCCCTGGCTGACCTGACAGG + Intronic
962887386 3:139640056-139640078 CATGCACTGTCCCACCTCACTGG - Intronic
964183486 3:153914684-153914706 CAGGAACTGGTTTCCCTCTCAGG + Intergenic
965599617 3:170442071-170442093 CAGGGACTGAGTCACCTCCCTGG - Intronic
968478413 4:823571-823593 CGGCCACAGGTTCCCCTCACAGG + Intronic
968852279 4:3090923-3090945 GAGGCAGTGTTTCACCGCACTGG - Intronic
969544113 4:7812674-7812696 CAGGCACTGGCGCACGCCACTGG + Intronic
970275330 4:14393512-14393534 CTGGCACAGGTTCACCCCACAGG - Intergenic
973558670 4:52111774-52111796 CAGGCCCTAATTAACCTCACAGG - Intergenic
974566853 4:63589697-63589719 AGGTAACTGGTTCACCTCACTGG + Intergenic
976539979 4:86263023-86263045 CAGCCCCTGATTCACCACACAGG - Intronic
982803923 4:159738983-159739005 CAGGCAGTGGTTCTTCTGACAGG + Intergenic
982821288 4:159943275-159943297 CAGGTACTAGTTCACCTTAGTGG + Intergenic
984923452 4:184785954-184785976 GATGCACCAGTTCACCTCACAGG - Intronic
985921906 5:2984097-2984119 CAGGCACTGGGACAGGTCACGGG - Intergenic
986042595 5:4008151-4008173 AAGCCACTTGCTCACCTCACTGG - Intergenic
986125541 5:4879949-4879971 CAGGCCCTGGTCCACTTCCCAGG + Intergenic
990230349 5:53706203-53706225 AAGGTACTGGTTCATCTCACTGG - Intergenic
991538763 5:67703770-67703792 GAGGTACAGGTTCATCTCACTGG + Intergenic
1002857694 6:1052630-1052652 CTGACACTAGTTCATCTCACTGG + Intergenic
1005402392 6:25448288-25448310 CAGGCCATGGTGCGCCTCACAGG - Intronic
1007477527 6:42128860-42128882 CAGGCCCTGGCTTTCCTCACTGG - Intronic
1011207464 6:84915181-84915203 CAGGCACATTTCCACCTCACAGG + Intergenic
1017799048 6:157875607-157875629 CAGGCACTGCTTCTACTCGCAGG - Intronic
1018029553 6:159831328-159831350 CCAGCACTTGATCACCTCACAGG - Intergenic
1018036459 6:159886823-159886845 CTGGCACTGGTTTTCCTCAGGGG + Intergenic
1018678498 6:166243442-166243464 CAGGCACTAGCTCAGCTCAGGGG - Intergenic
1018805305 6:167254662-167254684 CAGGCAGAGGGTCACCTCAAGGG - Intergenic
1019432183 7:1004210-1004232 CTGGCCCGGGTGCACCTCACAGG - Intronic
1019990867 7:4689860-4689882 CAGGCGCTGGGTCACCTAAGGGG - Intronic
1020016674 7:4835527-4835549 CAGGCACTGGTTCTACAGACCGG + Intronic
1020375468 7:7479591-7479613 CAGGAACTGGTTGAACCCACAGG + Intronic
1021156311 7:17215313-17215335 GAGGTACTGGTTCATCTCACTGG + Intergenic
1029606170 7:101600752-101600774 CAGGGACTGGGCAACCTCACTGG + Intergenic
1031717391 7:125125567-125125589 GAGGTACCGGTTCATCTCACTGG - Intergenic
1035547604 8:495781-495803 CAATCACTGGGTCACCTCAAAGG - Intronic
1037050199 8:14362719-14362741 CAGGCACTGGTTCACCTCACTGG - Intronic
1037178932 8:15980664-15980686 CAGGCATTGCTACACTTCACTGG - Intergenic
1040612310 8:48997706-48997728 GAGGTACCGGTTCATCTCACTGG + Intergenic
1040757700 8:50800081-50800103 CAGCTACTGTTTCACCTCACTGG + Intergenic
1042689652 8:71484063-71484085 CAGGGGCTGGTTGACCTCACTGG + Intronic
1045016350 8:98004635-98004657 CAGGCACTGGCCCCTCTCACAGG - Intronic
1046653555 8:116868183-116868205 CAGGCATTGAGTCACCACACTGG + Intronic
1047341040 8:123980843-123980865 CCTGCTCTGGTTCACCTCATAGG - Intronic
1048215550 8:132490873-132490895 TAGGCACTGATTCTGCTCACAGG - Intergenic
1053281798 9:36825331-36825353 CAGGCTCTAGTGCACCGCACGGG - Intergenic
1056668018 9:88597413-88597435 GAGGTACTGGTTCATCTCATTGG + Intergenic
1057829239 9:98394323-98394345 CAGGCTCTTGCTCCCCTCACAGG + Intronic
1058082010 9:100710465-100710487 GAGGTACTGGTTCATCTCACTGG - Intergenic
1058498523 9:105587176-105587198 CAGGCACTGGTGCTGCTCATTGG - Intronic
1058653135 9:107195685-107195707 CAGGGGCTGGTTCAGCTCCCTGG - Intergenic
1062307979 9:135920351-135920373 CAGCCACAGGGTCACCTCCCAGG - Intergenic
1062312389 9:135945882-135945904 CACGCACTGGTTCAGCTGAAGGG + Exonic
1191192030 X:57677823-57677845 CAGGGACTGGTTGACTTCAAGGG + Intergenic
1192796747 X:74429792-74429814 CAGTCACTTGTTCAGGTCACTGG + Intronic
1192825686 X:74693374-74693396 GAGGTACTGGTTCATCTCACTGG - Intergenic
1193581945 X:83276136-83276158 CAAGCACTGTTTCAACTAACTGG + Intergenic