ID: 1037050200

View in Genome Browser
Species Human (GRCh38)
Location 8:14362732-14362754
Sequence TGCATTTTCATCTCAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4199
Summary {0: 1, 1: 0, 2: 31, 3: 2311, 4: 1856}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050200_1037050205 24 Left 1037050200 8:14362732-14362754 CCAGTGCCTGAGATGAAAATGCA 0: 1
1: 0
2: 31
3: 2311
4: 1856
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data
1037050200_1037050204 11 Left 1037050200 8:14362732-14362754 CCAGTGCCTGAGATGAAAATGCA 0: 1
1: 0
2: 31
3: 2311
4: 1856
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050200 Original CRISPR TGCATTTTCATCTCAGGCAC TGG (reversed) Intronic
Too many off-targets to display for this crispr