ID: 1037050201

View in Genome Browser
Species Human (GRCh38)
Location 8:14362738-14362760
Sequence GATTTCTGCATTTTCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9062
Summary {0: 1, 1: 29, 2: 2839, 3: 4197, 4: 1996}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050201_1037050204 5 Left 1037050201 8:14362738-14362760 CCTGAGATGAAAATGCAGAAATC 0: 1
1: 29
2: 2839
3: 4197
4: 1996
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data
1037050201_1037050205 18 Left 1037050201 8:14362738-14362760 CCTGAGATGAAAATGCAGAAATC 0: 1
1: 29
2: 2839
3: 4197
4: 1996
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050201 Original CRISPR GATTTCTGCATTTTCATCTC AGG (reversed) Intronic
Too many off-targets to display for this crispr