ID: 1037050202

View in Genome Browser
Species Human (GRCh38)
Location 8:14362762-14362784
Sequence ATGAGATAGACACAGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 17, 3: 98, 4: 533}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050202_1037050206 10 Left 1037050202 8:14362762-14362784 CCCATCTTCTGTGTCTATCTCAT 0: 1
1: 0
2: 17
3: 98
4: 533
Right 1037050206 8:14362795-14362817 AGACCGGAGCTGTTCCTATTTGG 0: 1668
1: 3281
2: 1708
3: 550
4: 245
1037050202_1037050205 -6 Left 1037050202 8:14362762-14362784 CCCATCTTCTGTGTCTATCTCAT 0: 1
1: 0
2: 17
3: 98
4: 533
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data
1037050202_1037050208 19 Left 1037050202 8:14362762-14362784 CCCATCTTCTGTGTCTATCTCAT 0: 1
1: 0
2: 17
3: 98
4: 533
Right 1037050208 8:14362804-14362826 CTGTTCCTATTTGGCCATCTTGG 0: 1017
1: 3367
2: 1743
3: 827
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050202 Original CRISPR ATGAGATAGACACAGAAGAT GGG (reversed) Intronic
900850317 1:5137242-5137264 GGGAGAAAGACACAGAAAATGGG - Intergenic
902125163 1:14203174-14203196 ATGAGATAGACAGTGAAAAATGG + Intergenic
902966434 1:20007792-20007814 GTGAGACCAACACAGAAGATGGG - Intergenic
903127657 1:21258730-21258752 CTGACATAGACAGAGAAGAAGGG + Exonic
903912169 1:26735652-26735674 ATGAGAAAGACACAGGGGATGGG - Intronic
907004043 1:50892418-50892440 GTGTGAGCGACACAGAAGATGGG - Intronic
907646827 1:56252715-56252737 TGGAGAGAGACAAAGAAGATGGG + Intergenic
907847985 1:58227181-58227203 CTGAAATACACACAGAAGAAAGG + Intronic
908328473 1:63046819-63046841 ATGAGAAAGATACAGACAATTGG + Intergenic
908449862 1:64242444-64242466 ATGAGATAAACACAAAAAATAGG - Intronic
908486080 1:64595157-64595179 ATGACACAGACACAAAAGAGAGG - Intronic
909072685 1:71015572-71015594 TGGAAAAAGACACAGAAGATGGG - Intronic
909376280 1:74945891-74945913 ATAAGATAAACACAAAAAATAGG + Intergenic
909457168 1:75862352-75862374 GCGAGATTGACGCAGAAGATGGG - Intronic
909571671 1:77119468-77119490 ATGAGATAGCCAAATAAAATTGG - Intronic
909707760 1:78607743-78607765 GCGAGATCGACACAGAAGACAGG + Intergenic
910400331 1:86831657-86831679 AAGAGAGAGACAGAGAAGATAGG + Intergenic
910535310 1:88290901-88290923 AAGAGGTAGACAGAAAAGATTGG - Intergenic
911034073 1:93520539-93520561 ATGAGATAAGTACAGAAGTTGGG - Intronic
911121976 1:94305432-94305454 ATGAGAGAATGACAGAAGATGGG + Intergenic
911218058 1:95216921-95216943 GTGAGACTGACACAGAAGATGGG - Intronic
911304657 1:96218225-96218247 ATGCTTTAGACACAAAAGATGGG - Intergenic
912424341 1:109573401-109573423 ATGATATAAACACTGAACATGGG - Intronic
912609761 1:111031031-111031053 ATGAGGTAGCCAAAGAAAATAGG + Intergenic
913363183 1:118004882-118004904 GTGTGATCGACACAGAAGATGGG - Intronic
913526396 1:119697454-119697476 GTGTGATAGACCCAGAAGATGGG - Intronic
913607345 1:120478211-120478233 GTGAGATAGACGCAGAACACAGG + Intergenic
914209089 1:145561928-145561950 GTGAGATAGATGCAGAAGACAGG - Intergenic
914268008 1:146054294-146054316 GTGAGATAGACGCAGAAGACAGG - Intergenic
914369088 1:147006565-147006587 GTGAGATAGACGCAGAAGACAGG + Intergenic
914583849 1:149043623-149043645 GTGAGATAGACGCAGAAGACAGG - Intronic
914820626 1:151099712-151099734 ATGTGATATACACAGAATTTTGG + Intronic
914868305 1:151451709-151451731 ATGAGATAAATCCAGAAGGTGGG + Intronic
915077415 1:153320503-153320525 GTGAGATTGACGCAGAAGATGGG - Intergenic
915651502 1:157315309-157315331 GCGAGACTGACACAGAAGATGGG + Intergenic
915806958 1:158864380-158864402 TAGAGATTGACACAGAAGATTGG + Intergenic
916244982 1:162678428-162678450 AAGAGATAGACACATCAGGTAGG - Intronic
916273989 1:162974099-162974121 TTGCAATAGACCCAGAAGATAGG + Intergenic
916501514 1:165391476-165391498 ATGAGAGAAACAAAGAAGAATGG + Intergenic
916600778 1:166291393-166291415 ATGACATAGAAACATAAGAGAGG + Intergenic
916858952 1:168781925-168781947 AGGAGATAGGCAGAGAAAATTGG - Intergenic
916905639 1:169279766-169279788 GTGTGAGTGACACAGAAGATGGG - Intronic
917303644 1:173605179-173605201 TTGAGATAGACACAAAACACAGG + Intergenic
917464391 1:175262321-175262343 GTAAGATTGACACAGAAGATGGG - Intergenic
917514732 1:175698045-175698067 ATGAGAGAAACACAGAGGGTAGG - Intronic
917585074 1:176417536-176417558 GTGAGATCGACACAGAAGGTGGG - Intergenic
919059483 1:192613669-192613691 ATGTGATCAACAAAGAAGATAGG - Intergenic
919063984 1:192669028-192669050 GTGAGATCGACGCAGAAGATGGG - Intergenic
919638254 1:200024870-200024892 AAGAGAGAGAGAGAGAAGATGGG + Intergenic
920428602 1:205899356-205899378 GCGAGATCGACACAGAAGATGGG + Intergenic
920650890 1:207836592-207836614 ATGAGAGAGAAAAAGGAGATGGG - Intergenic
921169287 1:212532062-212532084 ATGAGATATTCACAGAGGAATGG - Intergenic
921607984 1:217177521-217177543 ATGAGAAAGAGAAAGAAAATGGG - Intergenic
923139611 1:231150212-231150234 AAGGGATAGAAACAGAAAATAGG - Intergenic
923375312 1:233356098-233356120 ATGAAATGGGCACAGAAGCTAGG - Intronic
923691013 1:236192731-236192753 GCGAGATCGACACAGAAGGTGGG - Intronic
923853328 1:237820272-237820294 GTGAGATTGACGCAGAAGGTGGG + Intronic
923930983 1:238696608-238696630 AAGAGATAGAGATAGAAGAGAGG + Intergenic
924167190 1:241296209-241296231 ATAAGACAGAAAGAGAAGATAGG + Intronic
924354840 1:243161437-243161459 ATGTGATAAAAATAGAAGATTGG - Intronic
924603152 1:245509252-245509274 ATGAGAAATACAAACAAGATGGG + Intronic
924824860 1:247528693-247528715 AGGAGACAGGCACAGAAGTTTGG + Intronic
1063642036 10:7839566-7839588 ATGAATGATACACAGAAGATGGG - Intronic
1064374037 10:14779677-14779699 ATGAGAGATACAGAGAAGAATGG - Intergenic
1065119453 10:22514439-22514461 GCAAGATTGACACAGAAGATGGG - Intergenic
1065156969 10:22880705-22880727 ACAAGATCAACACAGAAGATGGG + Intergenic
1065427315 10:25619232-25619254 GTGAGATCAACACAGAAGGTGGG + Intergenic
1065624298 10:27614835-27614857 ATGGGAGAGAGACAGGAGATGGG - Intergenic
1065651642 10:27899059-27899081 GTGAGATCGACACAGAAAGTGGG + Intronic
1065680304 10:28223707-28223729 ATCAGAAATACTCAGAAGATTGG - Intronic
1065843811 10:29728508-29728530 ATGAGATTGACTCAGAACAAAGG + Intronic
1065900972 10:30207666-30207688 ATATGATAGCCACAGAAGCTGGG - Intergenic
1066297485 10:34067534-34067556 ATGAGATCAATGCAGAAGATGGG + Intergenic
1067231186 10:44411787-44411809 GCGAGATTGACGCAGAAGATGGG - Intergenic
1068169021 10:53370165-53370187 GTGAGATTGATGCAGAAGATGGG + Intergenic
1068622912 10:59207177-59207199 GTGAGATCAACACAGAAGGTGGG + Intronic
1068789214 10:61008968-61008990 GTGAGATCAACACAGAAGACGGG - Intergenic
1068899580 10:62251975-62251997 AAGTGATAGACACAGAGGACAGG + Intronic
1069066873 10:63950719-63950741 GTGTGAGAGACGCAGAAGATGGG - Intergenic
1070003028 10:72395357-72395379 GTGTGATCGACACAGAAGATGGG + Intronic
1070061633 10:72989618-72989640 GTGTGATCAACACAGAAGATGGG + Intergenic
1070189626 10:74099900-74099922 AGAAGATAGACACAGAACACTGG + Intronic
1070587692 10:77779150-77779172 TCGAGAAAGACACAGAAGACTGG - Intergenic
1071728903 10:88228256-88228278 ATGCAATGGCCACAGAAGATTGG + Intergenic
1072244921 10:93535026-93535048 GTGAGATCGACACAGAAGACAGG + Intergenic
1072315174 10:94195444-94195466 ATGAAATAGAAGCAGAAGTTTGG + Intronic
1072382726 10:94892411-94892433 GTGTGAGTGACACAGAAGATGGG + Intergenic
1072480618 10:95807577-95807599 GTGTGATTGACCCAGAAGATGGG - Intronic
1073745812 10:106467279-106467301 GCAAGATTGACACAGAAGATGGG + Intergenic
1074415656 10:113264761-113264783 AAGAGACAGGCACAGACGATGGG - Intergenic
1074985272 10:118652670-118652692 GTGAGATCAACACAGAAGGTGGG - Intergenic
1075212410 10:120502376-120502398 GGGAGAGAGACACAGCAGATGGG + Intronic
1075475460 10:122729972-122729994 CTCAAATAGACACAGACGATTGG - Intergenic
1075857998 10:125647596-125647618 ATGTGAGTGACACAGAAGATGGG + Intronic
1077644541 11:3911853-3911875 ATGTGATTGCCACACAAGATTGG + Intronic
1078981116 11:16536378-16536400 GCGAGATTGACGCAGAAGATGGG + Intronic
1079646474 11:22869603-22869625 ATTAGATACACACAGAGGAAGGG - Intergenic
1079834767 11:25320724-25320746 ATGTAAAAGACACAGAAGATGGG - Intergenic
1080381790 11:31779432-31779454 ATCCTATAGACACATAAGATTGG - Intronic
1081222873 11:40483656-40483678 AGCACATAGACACTGAAGATAGG + Intronic
1081313250 11:41599672-41599694 GCGAGATTGACACAGAAGACAGG + Intergenic
1081366557 11:42242439-42242461 CTGAGAAAGACACAGAATGTTGG + Intergenic
1082680791 11:56166416-56166438 ATGACCTAGCAACAGAAGATGGG + Intergenic
1082945059 11:58749685-58749707 GTGTGATCAACACAGAAGATGGG + Intergenic
1083113137 11:60431688-60431710 AGGACACACACACAGAAGATGGG + Intronic
1083385624 11:62307051-62307073 GTGAGATCAACACAGAAGGTAGG - Intergenic
1083426576 11:62590891-62590913 GTGAGGAAGAGACAGAAGATGGG - Intronic
1083444529 11:62698855-62698877 ATGAGAAAGCCACAGAACCTGGG - Intronic
1083503507 11:63133381-63133403 GTGAGATCAACACAGAAGATGGG - Intronic
1083531510 11:63427836-63427858 GTGAGATCGATGCAGAAGATGGG + Intergenic
1084091683 11:66882959-66882981 AGGTGACAGACACAGAAGACAGG + Intronic
1085068924 11:73523747-73523769 ATGAGATAGAAAAGGAAGAGGGG - Intronic
1085242735 11:75071979-75072001 AGGAGAAAGACAAAGAAAATAGG + Intergenic
1085653345 11:78288959-78288981 AAGAGACAGACACAGAAAAGTGG + Intronic
1085879919 11:80454492-80454514 AGGAGATGGACAAAGAAGATAGG - Intergenic
1085922504 11:80974846-80974868 ATGAGATGTAAACAGAAGAAAGG + Intergenic
1086442022 11:86837858-86837880 GTGAGATCGACACAGAAGATGGG + Intronic
1086527334 11:87743240-87743262 ATGAGTGAGACAAAGAAGAAGGG + Intergenic
1087482468 11:98718545-98718567 GTGAGATTGACATAGAAGATGGG - Intergenic
1087596033 11:100256550-100256572 ATGAGATCAACGCAGAAGGTGGG + Intronic
1087607313 11:100392624-100392646 AGGAAATACACACAGAAGTTAGG - Intergenic
1087898224 11:103611275-103611297 GCGAGATTGACACAGAAGACGGG + Intergenic
1087984276 11:104658207-104658229 ATGAGATAGGAACATAAGAGTGG + Intergenic
1088197658 11:107293771-107293793 GCGGGATTGACACAGAAGATGGG + Intergenic
1091371862 11:135067184-135067206 ACCAGATACATACAGAAGATGGG - Intergenic
1091586549 12:1820217-1820239 AGGAGAGAGGCACAGAAGACAGG + Intronic
1092418123 12:8307671-8307693 ATGAGAGAGATGCAGAAGATGGG + Intergenic
1092581782 12:9849975-9849997 GAGAGATCGACACAGAAGGTGGG - Intergenic
1093541154 12:20286983-20287005 AGGAGAGAGACACAGAACATAGG + Intergenic
1093671069 12:21876688-21876710 ATGAAGTAGACACAGATGAGGGG + Intronic
1094705903 12:32914305-32914327 ATGAACCAGACACAGAAGTTAGG + Intergenic
1094858332 12:34431043-34431065 GTGTGAGTGACACAGAAGATGGG + Intergenic
1095140490 12:38656952-38656974 GCGTGACAGACACAGAAGATGGG + Intronic
1095186570 12:39207795-39207817 GTGAGATCGAGGCAGAAGATGGG + Intergenic
1095743636 12:45633635-45633657 ATGAAATAGAAACTGAAAATAGG + Intergenic
1095897919 12:47299498-47299520 ATGAGAAGTACACAGAAGACAGG - Intergenic
1096016034 12:48275774-48275796 GTGAGATCAACACAGAAGATGGG - Intergenic
1097301434 12:58023219-58023241 GTGAGATTGACGCAGAAGATGGG - Intergenic
1097375910 12:58841753-58841775 GTGAGATTGACACAGAAGGCGGG - Intergenic
1097569592 12:61316785-61316807 ATGTGAGCGACGCAGAAGATGGG + Intergenic
1099183861 12:79497244-79497266 GTGAGATCAACACAGAAGGTGGG - Intergenic
1099740316 12:86626794-86626816 GTGTGATTGACACAGAAGACAGG + Intronic
1100417089 12:94389546-94389568 GTGTGATGGACGCAGAAGATGGG + Intronic
1100528760 12:95445173-95445195 ATGGGACAGAAACAGAACATGGG - Intergenic
1100900743 12:99237973-99237995 GTGAGATCGATGCAGAAGATGGG + Intronic
1101301773 12:103490018-103490040 GTGTGATCGACACAGAAGACGGG - Intronic
1101601351 12:106212793-106212815 GTGAGATGGACGCAGAAGGTGGG - Intergenic
1102663291 12:114548080-114548102 AGGAGACTGACGCAGAAGATGGG - Intergenic
1103255750 12:119540072-119540094 GTGAGATCAACACAGAAGGTGGG - Intronic
1104803723 12:131571816-131571838 TTGAGAGAAAGACAGAAGATTGG - Intergenic
1106426689 13:29637051-29637073 GTGAGATCAACACAGAAGGTGGG - Intergenic
1108764401 13:53609083-53609105 AAGAGATTAACAAAGAAGATAGG - Intergenic
1108851097 13:54730252-54730274 ATGAGAAAGAAACAGAAAAAGGG - Intergenic
1108988704 13:56628750-56628772 ATGTGATTGACACAGAAGACGGG + Intergenic
1109081944 13:57914735-57914757 TTGAAATAGATAAAGAAGATGGG + Intergenic
1109675968 13:65675892-65675914 TCGAGATAGACACAGAAGATGGG - Intergenic
1110414430 13:75236338-75236360 ATGATTTATACTCAGAAGATAGG + Intergenic
1110816742 13:79869446-79869468 ATGAGATAGAGAGAGAAAACAGG + Intergenic
1110983288 13:81931676-81931698 ATTAGTTTGACACACAAGATTGG - Intergenic
1111199611 13:84916200-84916222 AGGAGATAGAAAAAGAAGGTTGG + Intergenic
1111933947 13:94540195-94540217 AAGAGATAGAAAAAGAAGATAGG + Intergenic
1112131155 13:96524924-96524946 GTGAGATCAACGCAGAAGATGGG - Intronic
1112412109 13:99173387-99173409 GTGTGATTGACGCAGAAGATGGG - Intergenic
1112745401 13:102522067-102522089 GTGTGAGCGACACAGAAGATGGG + Intergenic
1113300988 13:109018888-109018910 ATGTGATTGACACAGAAGACAGG - Intronic
1114573289 14:23690619-23690641 GTGTGATTGACACAGAAGATAGG - Intergenic
1114844802 14:26308662-26308684 GTGAGATCAACACAGAAGGTGGG + Intergenic
1114981233 14:28168043-28168065 AAGTGATCCACACAGAAGATGGG + Intergenic
1115116714 14:29889303-29889325 GCGAGATTGACGCAGAAGATGGG + Intronic
1115135077 14:30098201-30098223 GTGTGATTGACGCAGAAGATGGG + Intronic
1115412134 14:33088104-33088126 GTGTGAGCGACACAGAAGATGGG + Intronic
1115818382 14:37187810-37187832 GCGAGATTGACACAGAAGATGGG + Intergenic
1116240291 14:42333505-42333527 ATGAGAAGGACAGAGAAGAAAGG + Intergenic
1116401828 14:44516230-44516252 GTGTGATCAACACAGAAGATGGG - Intergenic
1116503221 14:45646500-45646522 ATGAGTTAGACACAGATGAGAGG + Intergenic
1116525500 14:45899307-45899329 AAGATATAGTCACAGAAGTTTGG - Intergenic
1116711406 14:48372330-48372352 GTGTGAGAGACACAGAAGACAGG - Intergenic
1117175312 14:53139793-53139815 ATAAGACATACAAAGAAGATGGG + Intronic
1117804883 14:59481210-59481232 ATGAAATAGTCACAGATAATTGG - Intronic
1117811424 14:59551535-59551557 GTGTGAGTGACACAGAAGATGGG + Intronic
1117821751 14:59657493-59657515 GTGAGATCAACACAGAAGGTGGG + Intronic
1118094449 14:62521143-62521165 GTGTGAGCGACACAGAAGATGGG + Intergenic
1118548402 14:66920447-66920469 ATGAGAAAGACAGGAAAGATAGG - Intronic
1118938561 14:70311136-70311158 GTGTGAGTGACACAGAAGATGGG - Intergenic
1119457373 14:74767684-74767706 ATGAGGTAGAAAAAGAAAATAGG - Intronic
1119737424 14:76992361-76992383 CCGAGATAGACACAGAACTTGGG - Intergenic
1120559701 14:85975126-85975148 GTGTGATCAACACAGAAGATGGG - Intergenic
1120671617 14:87368706-87368728 AAGACATAGATACGGAAGATGGG - Intergenic
1121173000 14:91870126-91870148 ATGAGAGCGACACAGACGTTAGG - Exonic
1121856386 14:97273959-97273981 ATGAGATGAACACACAAGAAGGG - Intergenic
1122696075 14:103552897-103552919 GTGAGATGGAGACAGAAGGTGGG + Intergenic
1123224859 15:17013661-17013683 GTGTGAGTGACACAGAAGATGGG + Intergenic
1124236217 15:27991464-27991486 AGAAGCCAGACACAGAAGATGGG + Intronic
1124724732 15:32145983-32146005 ACGAGATCAACGCAGAAGATGGG - Intronic
1124948469 15:34293082-34293104 GCAAGATTGACACAGAAGATGGG - Intronic
1125218797 15:37309356-37309378 GTGTGAGCGACACAGAAGATGGG - Intergenic
1125219806 15:37320010-37320032 GTGAGATCGACGCAGAAGACAGG + Intergenic
1126433031 15:48606943-48606965 ATGAGAGACAGACAGAAAATGGG - Intronic
1126553980 15:49965870-49965892 ATGAGATCAACACAGAAGGGAGG + Intronic
1126720027 15:51568857-51568879 ACGAGATGGACACAGAAGGCAGG + Intronic
1126742013 15:51786903-51786925 GTGAGATCGACGCAGAAGATGGG + Intronic
1128419943 15:67482286-67482308 ATGAGAGAGAAACAGAAGACAGG - Intronic
1129508055 15:76099467-76099489 GCGAGGTCGACACAGAAGATGGG - Intronic
1130046200 15:80446847-80446869 ATGAGACAGAGACAGAGGAAGGG - Intronic
1130176819 15:81581631-81581653 GTGAGATCAACGCAGAAGATGGG + Intergenic
1130514424 15:84615321-84615343 AAAAGATAGAAACAGAAGTTAGG - Intronic
1130616542 15:85414512-85414534 ATGATATAGAGAATGAAGATGGG + Intronic
1132928854 16:2448191-2448213 ATGTTATAGACCCAGAAGGTGGG - Intronic
1135861391 16:26059120-26059142 ATGAGACAGAGACAGAACCTGGG + Intronic
1135899840 16:26447213-26447235 ATGAGAGAGACACTGAGTATGGG - Intergenic
1137046082 16:35663796-35663818 GTGAGATTGATGCAGAAGATGGG + Intergenic
1138720307 16:59072309-59072331 GTGAGAGCGACACAGAAGATCGG + Intergenic
1139165822 16:64564043-64564065 ATGAGACAGAGATAGAAGCTTGG + Intergenic
1139245840 16:65442708-65442730 GTGAGATGGAGTCAGAAGATAGG - Intergenic
1140695088 16:77525019-77525041 GCGTGATTGACACAGAAGATGGG + Intergenic
1141875826 16:86823718-86823740 AAGAGAAAAACACAGCAGATTGG + Intergenic
1143424677 17:6825431-6825453 ATGATATAGACACACCAGACTGG - Intronic
1144125791 17:12201865-12201887 AGGAGATGGACAGAGAAGACTGG + Intergenic
1145305084 17:21669577-21669599 ATGACATAGACACAGGGGAGGGG + Intergenic
1145861159 17:28211610-28211632 GTGAGATTGATGCAGAAGATGGG + Intergenic
1146145550 17:30412948-30412970 ACAAGATTGACACAGAAGAGGGG - Intronic
1146301631 17:31694107-31694129 ATGAAAGAGACAGAGAAGAACGG + Intergenic
1148351096 17:46942804-46942826 ATGAAAAGGACACAGAAAATGGG - Intronic
1148708057 17:49653693-49653715 CAGAGATAGTCACAGAAGAGTGG + Intronic
1148950269 17:51304993-51305015 GAGTGATCGACACAGAAGATGGG + Intergenic
1149240079 17:54639242-54639264 GCGTGATTGACACAGAAGATGGG + Intergenic
1153398586 18:4654741-4654763 ATGACATAGAGACACAAAATTGG + Intergenic
1153456652 18:5290395-5290417 TTCAGATAGACGCAGAAAATTGG - Exonic
1153562343 18:6383702-6383724 GTGAGATTGACGCAGAAGGTTGG - Intronic
1153616120 18:6935734-6935756 CTGATATAACCACAGAAGATGGG - Intergenic
1153917279 18:9757400-9757422 AAGAGTCAGACACAGAAGAGAGG + Intronic
1154186989 18:12192996-12193018 AATGCATAGACACAGAAGATGGG - Intergenic
1155384831 18:25266499-25266521 ATGAGATCAACACAGAAGGCGGG + Intronic
1155562529 18:27093812-27093834 GTGTGATTGACACAGAAGATGGG - Intronic
1155587613 18:27385566-27385588 ATGAGATACACACATACAATGGG - Intergenic
1156035584 18:32763759-32763781 TTGAGATAGACACTTAAGGTTGG - Intronic
1156443912 18:37219896-37219918 GTGTGATCGACAAAGAAGATGGG - Intronic
1156844744 18:41652170-41652192 TTGACATAGACACAGAATTTTGG - Intergenic
1156979385 18:43266166-43266188 GTGAGATCAACACAGAAGGTGGG - Intergenic
1157904338 18:51554957-51554979 TTGAGAAAAACAGAGAAGATGGG - Intergenic
1158700519 18:59741719-59741741 TTGGGTTAGACACACAAGATTGG - Intergenic
1158942018 18:62413178-62413200 ATGAACTAGACACAGGAGAGGGG - Intergenic
1159148847 18:64493807-64493829 ATGAAATGGACACAGAAAATGGG + Intergenic
1159178508 18:64870346-64870368 ATGAGATTGCTCCAGAAGATTGG + Intergenic
1159402624 18:67957263-67957285 ATAAGATAAACACAGAGGAAAGG - Intergenic
1161201863 19:3019528-3019550 AAGAGGTAGACACAGGGGATGGG + Intronic
1161430349 19:4228668-4228690 ATGAGAGAGACAGAGATGAGAGG - Intergenic
1163380178 19:16961089-16961111 GTGTGATTGACACGGAAGATGGG + Intronic
1163939955 19:20482491-20482513 GTGTGATTGACACAGAAGATGGG + Intergenic
1164685707 19:30165328-30165350 AGGACAGGGACACAGAAGATTGG + Intergenic
1165911385 19:39230357-39230379 GTGAGAGAGAGAGAGAAGATAGG + Intergenic
1167262125 19:48464701-48464723 ATGGGGTGGAAACAGAAGATGGG + Exonic
1202709232 1_KI270714v1_random:7952-7974 GTGAGATAGACACAGAAGACAGG + Intergenic
926885469 2:17594477-17594499 ATGTAATAGGCCCAGAAGATGGG + Intronic
927393309 2:22620868-22620890 ATGAAATAGAAACAGATGAAAGG - Intergenic
928226653 2:29455096-29455118 ATGAAATAGACATGAAAGATGGG - Intronic
928462591 2:31489138-31489160 GTGAGATCAACACAGAAGATGGG + Intergenic
928759213 2:34561384-34561406 GTGTGAGTGACACAGAAGATGGG - Intergenic
930143102 2:47973572-47973594 GTGTGATTGACGCAGAAGATGGG + Intergenic
931089982 2:58875477-58875499 AAGAAAAAGACACAGAAGATTGG - Intergenic
931278496 2:60765782-60765804 ATGAAATGGACAGAGAAGACAGG - Intronic
931292890 2:60891834-60891856 GTGAGATAGACACAGAAGAAGGG - Intronic
931475871 2:62586922-62586944 GTGTGAGTGACACAGAAGATGGG - Intergenic
931538565 2:63304332-63304354 GTGAGATCAACACAGAAGGTGGG + Intronic
931707262 2:64957570-64957592 CTGAGATAGACACAGGAGCTTGG + Intergenic
932076080 2:68664088-68664110 TTGAAATAGACACAGAATCTAGG - Intergenic
932868762 2:75374969-75374991 GTGAGATTGACGCAGAAGACAGG - Intergenic
932911713 2:75813172-75813194 CTAAGACAGACACACAAGATTGG - Intergenic
932939057 2:76140115-76140137 GTGAGATCAACACAGAAGGTGGG - Intergenic
933080692 2:77981220-77981242 ATGAGATATATAAAGAAGAGTGG + Intergenic
934617017 2:95778521-95778543 GTGAGATTGACACAGAAGATGGG + Intergenic
934643876 2:96046038-96046060 GTGAGATTGACACAGAAGATGGG - Intergenic
934837293 2:97602132-97602154 GTGAGATTGACACAGAAGATGGG - Intergenic
934905048 2:98192760-98192782 ATGATCTACTCACAGAAGATTGG + Intronic
935014778 2:99171543-99171565 ATGAGACAGTTACAGAAGTTTGG - Exonic
935528513 2:104203012-104203034 ATGAGATAAACAAGGAAGGTAGG + Intergenic
935604794 2:104959685-104959707 GCGTGATTGACACAGAAGATGGG - Intergenic
935844077 2:107145326-107145348 GTGTGAGTGACACAGAAGATGGG - Intergenic
937074850 2:119095814-119095836 GTGTGAGCGACACAGAAGATGGG + Intergenic
940304340 2:152209547-152209569 ATAAGATAGTCCCAGAAGTTTGG - Intergenic
940927530 2:159381643-159381665 GTGAGAAAGACACAAAAGGTGGG - Intronic
940953693 2:159705382-159705404 ATGAGAAAGATTCAAAAGATAGG + Intergenic
941041514 2:160628651-160628673 GCGAGACTGACACAGAAGATGGG - Intergenic
941707928 2:168679525-168679547 ATGAGAAAGAGAGAAAAGATGGG - Intronic
941713742 2:168742622-168742644 ATGAAATAGACACACAATAAAGG + Intronic
942056997 2:172193348-172193370 GTGTGAGCGACACAGAAGATGGG - Intergenic
943108619 2:183578655-183578677 ATGAGTTAGACCCAGAAGAAAGG + Intergenic
943596853 2:189868546-189868568 AAGAGAAAGTAACAGAAGATAGG - Intronic
944033934 2:195269775-195269797 ACGTGATCGACACAGAAGATGGG - Intergenic
944374100 2:199020724-199020746 ATGAGATTGACAAACGAGATAGG - Intergenic
945548485 2:211188626-211188648 ATGAGATCCACACAGAGGAGAGG + Intergenic
946047626 2:216834278-216834300 GTGAAATAGACCCAGAATATTGG + Intergenic
946633807 2:221701746-221701768 ATGAAAGAGAAACAGAACATTGG - Intergenic
947225952 2:227840079-227840101 GTGAGATCAACACAGAAGGTGGG - Intergenic
1168774700 20:438154-438176 ATCAGATGGACACAGAAGGAGGG - Exonic
1168787782 20:554946-554968 ATGAGAGAGATTCAGTAGATTGG + Intergenic
1169861638 20:10159112-10159134 GCGAGATCGACACAGAAGATGGG + Intergenic
1170366178 20:15600500-15600522 AAGAGATAGAGAAAGAAGAAGGG - Intronic
1170720537 20:18873790-18873812 GTGAGATCAACAGAGAAGATGGG - Intergenic
1171530345 20:25849006-25849028 ATGACATAGACACAGGGGAGGGG + Intronic
1174049108 20:47755262-47755284 ATGAAGTAGACACAGGAGAGAGG - Intronic
1174663328 20:52234732-52234754 AGAAGATATACTCAGAAGATAGG - Intergenic
1174807639 20:53618364-53618386 TAGAGATAGACAAAGAAGAGAGG - Intergenic
1174915600 20:54650108-54650130 ATGAGATAGAAACAGAACTATGG - Intronic
1174990241 20:55500944-55500966 GTGAGACAGACACAGAAGACAGG - Intergenic
1176952393 21:15064067-15064089 ATAAGGTGGACACAGAAGAAGGG + Intronic
1177132082 21:17271358-17271380 GTGTGAGCGACACAGAAGATGGG + Intergenic
1177415974 21:20793940-20793962 ATGAGAAAATCACAGAAGAATGG - Intergenic
1178007020 21:28233797-28233819 GTGAGATCAACACAGAAGATGGG + Intergenic
1179087876 21:38236535-38236557 ATGAGATAGACACATATGGGTGG + Intronic
1179680784 21:43019867-43019889 ATGAGAAAAACACAAAAGATTGG - Intronic
1180375072 22:12084313-12084335 ATGAGATCAACACAGAAGGCAGG + Intergenic
1181294302 22:21822999-21823021 AGGAGATAGACATAGAGGCTGGG + Intronic
1181327018 22:22057662-22057684 GTGAGATCGACGCAGAAGACAGG - Intergenic
1181857690 22:25793921-25793943 AAGAGAGAGACAAAGAATATGGG - Intronic
1181921451 22:26323605-26323627 AAGAGAGAGACAGAGAAGGTGGG + Intronic
1182404364 22:30111840-30111862 ATGAAATAGAGACAGAGGCTTGG - Intronic
949437353 3:4043645-4043667 GTGAGATAGACGAAGAAGAGAGG - Intronic
949440086 3:4071223-4071245 GCGAGATCGACACAGAAGACAGG + Intronic
949632628 3:5944643-5944665 GTGTGTTTGACACAGAAGATGGG - Intergenic
950067293 3:10123207-10123229 ATGAGATGGTAAAAGAAGATTGG + Intronic
950701330 3:14751296-14751318 GTGAGATTGACATAGAAGATGGG + Intronic
950879137 3:16308053-16308075 CTGAGCTAGACATTGAAGATAGG + Intronic
951183242 3:19682863-19682885 GTGAGATCGACTCAGAAGACAGG - Intergenic
951299944 3:20983948-20983970 AAGAGATAGAGACAGAAGGAGGG + Intergenic
951593419 3:24291242-24291264 AGAAGAAAGACACAGAAAATGGG + Intronic
951777352 3:26324469-26324491 CTGAGATCAACACAGAAGGTGGG - Intergenic
952281209 3:31925191-31925213 AAGAGAGAGACAGAGAAAATGGG - Intronic
952550624 3:34472298-34472320 GTGTGATCAACACAGAAGATGGG - Intergenic
952648791 3:35696871-35696893 AAGAGAGAGAAACTGAAGATCGG - Intronic
952949179 3:38505205-38505227 ATAAGATAGACACAAAAATTTGG + Intronic
953466683 3:43127847-43127869 ATTAGATAGACAAGGAAGTTGGG + Intergenic
953890631 3:46749702-46749724 ATGGGACAGACACAGAGGAGAGG + Intronic
954571876 3:51647871-51647893 CTGTGATCGACACAGAAGACAGG + Intronic
954836558 3:53474010-53474032 GCGTGATCGACACAGAAGATGGG - Intergenic
955008716 3:54993702-54993724 ATCAGATAGACAAAGAACAAGGG - Intronic
955652603 3:61210880-61210902 GTGTGAGCGACACAGAAGATGGG - Intronic
956316858 3:67947861-67947883 GCGAGATTGACACAGAAGATGGG + Intergenic
956396679 3:68833259-68833281 GCGAGATTGACACAGAAGATGGG - Intronic
957294608 3:78321318-78321340 ATGAGATGGATACAGATGAGGGG + Intergenic
957917923 3:86709434-86709456 GTGAGATGGATACGGAAGATGGG - Intergenic
957918238 3:86714324-86714346 CTGAGATAGAAAAAGAAGAAAGG - Intergenic
958036934 3:88181997-88182019 GTGAGATCAACACAGAAGATGGG + Intergenic
958255993 3:91325467-91325489 AGGAGATGGATACAGAACATAGG - Intergenic
958618425 3:96526715-96526737 GTGTTATAGACGCAGAAGATGGG + Intergenic
958742958 3:98096491-98096513 GTGAGATGGACACAGAAGATGGG - Intergenic
958828919 3:99064747-99064769 GTGTGAGCGACACAGAAGATGGG - Intergenic
958896406 3:99834673-99834695 ATGAGAAAGACACAGGAGAGGGG - Intronic
958962643 3:100524611-100524633 GTGAAATACACACAGAAGTTGGG + Intronic
959059832 3:101605876-101605898 GTGAGATTGACATAGAAGATGGG - Intergenic
959101618 3:102016827-102016849 ATGAGATACACAAAGAAGCAAGG - Intergenic
959170895 3:102842356-102842378 GTGAGATTGACACAGAAGATGGG - Intergenic
959406104 3:105963317-105963339 ATGAGATAGACACCGGAAGTGGG + Intergenic
959716116 3:109434505-109434527 ATAAGACAGACACAGAAAAATGG + Intergenic
959753274 3:109864153-109864175 ATGAGATTGTTAAAGAAGATTGG + Intergenic
960119758 3:113935666-113935688 ATGAAATAGACAAGGAAGAAAGG - Intronic
960330373 3:116352330-116352352 ATGAGATAGATTCAGAGCATGGG + Intronic
960752210 3:120967366-120967388 GTGTGATTGACACAGAAGATGGG - Intronic
960763419 3:121097705-121097727 GCGAGATCGACACAGAAGGTGGG - Intronic
962460129 3:135604285-135604307 ACGTGAGTGACACAGAAGATGGG + Intergenic
962674546 3:137745084-137745106 AAGAGACAAACACAAAAGATGGG + Intergenic
962864801 3:139439336-139439358 ATAAGGAAGACACAGAAGAAAGG + Intergenic
962882416 3:139591008-139591030 GTGAGAGCGACACAGAAGACGGG + Intronic
964269965 3:154945209-154945231 GTGTGATTGATACAGAAGATGGG + Intergenic
964439246 3:156688819-156688841 TTGAGACAGGCACAGCAGATGGG - Intronic
964517488 3:157528527-157528549 ATGAGATAAACAAAGAAGCCAGG + Intronic
964782779 3:160359420-160359442 GTGTGATCGACACAGAAGACGGG + Intronic
965221341 3:165931148-165931170 GCGAGATCGACACAGAAGACAGG + Intergenic
965754615 3:172012995-172013017 AAGAGAGAGACAGAGAAGATAGG + Intergenic
966477521 3:180367402-180367424 GTGTGATCGACACAGAAGACAGG + Intergenic
968860709 4:3167007-3167029 GTGAGATCGACACAGAAGACAGG - Intronic
969832260 4:9807316-9807338 ATGAGATAAACAAGGAAGAAAGG - Intronic
970032884 4:11697513-11697535 GAGAGACATACACAGAAGATTGG - Intergenic
970152657 4:13106328-13106350 ATGAGACAGAGAGAGAATATCGG + Intergenic
970496209 4:16628678-16628700 GCGAGATAGACGCAGAAGATGGG + Intronic
970721660 4:18996067-18996089 ATGAGATAGAGAGAGAAAATGGG - Intergenic
970884461 4:20971182-20971204 ATAAGATAGGCACAGAAGAAAGG + Intronic
970975784 4:22041256-22041278 GCGTGATCGACACAGAAGATGGG - Intergenic
970975968 4:22043323-22043345 ATGTGATGCAAACAGAAGATTGG + Intergenic
971478958 4:27097576-27097598 CAGAGATAGACACAGACAATGGG + Intergenic
971560695 4:28077011-28077033 GTGTGATCGACGCAGAAGATGGG + Intergenic
971589544 4:28449952-28449974 CTTAGATTGACACAGAAAATGGG - Intergenic
971883144 4:32409132-32409154 GTGAGATCAACACAGAAGGTGGG + Intergenic
972435832 4:39034661-39034683 ATTGGATAGACAAAGAATATGGG + Intergenic
972987857 4:44786853-44786875 ATGACATAAAAACAGATGATAGG - Intergenic
973013916 4:45111180-45111202 GTGTGATCGACACAGAAGACTGG - Intergenic
973142349 4:46784003-46784025 ATGAGATATACACAGACAATGGG - Intronic
973272906 4:48279663-48279685 GTGAGATCAACACAGAAGGTGGG + Intergenic
973729833 4:53812429-53812451 ATGACAAGTACACAGAAGATGGG + Intronic
973871397 4:55170171-55170193 GCGAGATCGACACAGAAGATGGG - Intergenic
973884662 4:55307945-55307967 ATAAGAGAGACCCAGAAGAGGGG - Intergenic
974023620 4:56712691-56712713 GTGTGAATGACACAGAAGATGGG + Intergenic
974264076 4:59560996-59561018 GCGAGATTGACACAGAAGGTGGG - Intergenic
974439740 4:61900617-61900639 ATGAGATAGAGAAAAAAGAGAGG + Intronic
974496297 4:62632637-62632659 ATTAGATAACCACAGAAGAGTGG + Intergenic
974719816 4:65724726-65724748 GTGAGATAGACACAGAAGACAGG + Intergenic
975807342 4:78126469-78126491 GTGAGATTGACGCAGAAGATGGG - Intronic
975834758 4:78410935-78410957 ATGAGATAGACACTAGAGCTAGG + Intronic
976407134 4:84672883-84672905 ATGAGAGAGGTTCAGAAGATGGG - Exonic
976486930 4:85617601-85617623 ATCAAATAGTAACAGAAGATTGG - Intronic
976580571 4:86730872-86730894 GTGTGATCGACACAGAAGACGGG - Intronic
977079976 4:92513329-92513351 GTGTGATAGAAACAGAAGCTTGG - Intronic
977986071 4:103385144-103385166 CTGAGATCAACACAGAAGGTGGG + Intergenic
978078983 4:104568550-104568572 GTGAGATCAACACAGAAGGTGGG - Intergenic
978158618 4:105518132-105518154 ATAATAAAGAAACAGAAGATAGG - Intergenic
978418362 4:108503175-108503197 ACGTGAGTGACACAGAAGATGGG + Intergenic
978552227 4:109939608-109939630 GCAAGATTGACACAGAAGATGGG - Intronic
978984913 4:114999936-114999958 ATAACATTGACACATAAGATTGG - Intronic
979115183 4:116814866-116814888 GTGAGATAGACGCAGAAGGAGGG + Intergenic
979246963 4:118518213-118518235 ATGTGATAAAAATAGAAGATTGG + Intergenic
979310467 4:119197732-119197754 CTGTGATCGACACAGAAGATGGG + Intronic
979510750 4:121550747-121550769 GAGGGATCGACACAGAAGATGGG - Intergenic
979603836 4:122615902-122615924 AAGAGATAGAAATAGAGGATTGG - Intronic
979711405 4:123784096-123784118 ATGAGAAAGACTCAGAGGACAGG - Intergenic
979810493 4:125030224-125030246 CTCAGAAAGACACAGAAGATGGG - Intergenic
980558781 4:134443214-134443236 GCGAGATGGACACAGAAGACGGG - Intergenic
980583736 4:134786997-134787019 GTGAGATCAACACAGAAGGTGGG - Intergenic
980829697 4:138115149-138115171 AGGAGATACACTCAGGAGATTGG - Intergenic
981850918 4:149229453-149229475 GTGAGATTGACGCAGAAGACAGG + Intergenic
982275103 4:153630244-153630266 ATGAGACAGACAAAGCAGATTGG - Intronic
982314094 4:154013703-154013725 ATGAGAGAGAGACAGGAGGTTGG - Intergenic
983364703 4:166770260-166770282 GTGTGAGCGACACAGAAGATGGG - Intronic
984044176 4:174777031-174777053 ATGTGTTAGACACAGATGACTGG + Intronic
984805013 4:183744116-183744138 AAAAGATAGATATAGAAGATTGG - Intergenic
1202756662 4_GL000008v2_random:69760-69782 ATGAGATCAACACAGAAGGCAGG + Intergenic
986323133 5:6649825-6649847 GCGAGATCGACACAGAAGGTGGG - Intronic
987160702 5:15139361-15139383 ATGAGAGAGAAACAGAAAAGTGG - Intergenic
987517049 5:18924084-18924106 ATGAGAGAGAGAAAGAAGAAGGG + Intergenic
987697926 5:21355904-21355926 AAGAGATAAATACAGAAAATTGG - Intergenic
987768814 5:22272711-22272733 GTGAGATAGAAACAGCTGATTGG + Intronic
988008590 5:25452641-25452663 ATATCATACACACAGAAGATAGG + Intergenic
988309795 5:29542233-29542255 GTGTGATTGACACAGAAGACAGG - Intergenic
989008075 5:36837694-36837716 ATGAGATAGAAAGAGATGTTGGG - Intergenic
989072129 5:37522547-37522569 GTGTGAGTGACACAGAAGATGGG + Intronic
989294831 5:39812997-39813019 AAAAGATAGACACAGAATAATGG - Intergenic
989349972 5:40474823-40474845 GTGTGATCGATACAGAAGATGGG - Intergenic
989358132 5:40567454-40567476 GTGAGATTGACGCAGAAGATGGG - Intergenic
989407663 5:41079354-41079376 GTGACAGCGACACAGAAGATGGG - Intergenic
989418183 5:41205301-41205323 GTGTGAGAGACACAGAAGATGGG + Intronic
989828459 5:45887187-45887209 GTGTGAGTGACACAGAAGATGGG - Intergenic
990071810 5:51791224-51791246 GTGTGAGAGACGCAGAAGATGGG - Intergenic
990077459 5:51867446-51867468 ATGTGCTAGATACAGCAGATGGG - Intergenic
990193151 5:53284722-53284744 ATGAGAGTTACACAAAAGATTGG - Intergenic
990772167 5:59260445-59260467 AAGAGATAGAGAAAGAATATAGG - Intronic
990863822 5:60358297-60358319 ATGAGATAGAAGCAAAACATGGG + Intronic
990898866 5:60728895-60728917 GTGAGATCGACACAGAAGACGGG + Intergenic
991086326 5:62651284-62651306 ATGAGATAGAAACCGTACATAGG + Intergenic
991151406 5:63375740-63375762 GTGAGATTGGCGCAGAAGATGGG + Intergenic
991223482 5:64242838-64242860 ATAAGATGAACACAGAAGGTGGG + Intronic
991243512 5:64485062-64485084 GCGTGATCGACACAGAAGATGGG - Intergenic
991425032 5:66482102-66482124 GTGTGATCGACACAGAAGACGGG + Intergenic
991535666 5:67666906-67666928 GTGTGAGTGACACAGAAGATGGG - Intergenic
991742515 5:69696479-69696501 AAGAGATAGATACAGAAAATTGG + Intergenic
991755179 5:69858725-69858747 AAGAGATAGATACAGAAAATTGG - Intergenic
991794089 5:70276217-70276239 AAGAGATAGATACAGAAAATTGG + Intergenic
991821905 5:70571792-70571814 AAGAGATAGATACAGAAAATTGG + Intergenic
991834506 5:70733873-70733895 AAGAGATAGATACAGAAAATTGG - Intergenic
991886466 5:71275759-71275781 AAGAGATAGATACAGAAAATTGG + Intergenic
992046830 5:72901270-72901292 ATGAGATAGTAACAGCAGATTGG + Intronic
992254986 5:74912161-74912183 GTGAGATCGACACAGAAGGCAGG - Intergenic
992516655 5:77500950-77500972 GCGTGATTGACACAGAAGATGGG + Intronic
992756420 5:79911039-79911061 GCAAGATGGACACAGAAGATGGG + Intergenic
992884219 5:81141712-81141734 AAGTGATAGACACAGCAGTTTGG + Intronic
993069071 5:83135285-83135307 GTGTGAGCGACACAGAAGATGGG - Intronic
993266385 5:85731913-85731935 GTGAGATCAACACAGAAGATGGG + Intergenic
993577579 5:89621588-89621610 GTGTGAGCGACACAGAAGATGGG + Intergenic
993909179 5:93660615-93660637 GTGTGATGGACACAGAAGTTTGG + Intronic
994160266 5:96549467-96549489 GTGAGATTGACACAGAAGATGGG + Intronic
994595219 5:101824029-101824051 ATGAGATAGTCACATATCATGGG - Intergenic
995063868 5:107839185-107839207 TTGAAATAGACACAGAATTTTGG - Intergenic
995203852 5:109457308-109457330 ACGTGAGTGACACAGAAGATGGG + Intergenic
995480258 5:112586084-112586106 GTGAGATCGACACAGAAGGCGGG + Intergenic
995644489 5:114295778-114295800 GTGTGAGCGACACAGAAGATGGG - Intergenic
997187740 5:131898994-131899016 GCGTGATCGACACAGAAGATGGG - Intronic
998014568 5:138722096-138722118 ATGAGATAGAAACAGTAAATCGG + Intronic
998938902 5:147259858-147259880 AGGAGAGAGAGACAGAAGAGAGG - Intronic
999542285 5:152586771-152586793 ATGTGAGCGACACAGAAGATGGG + Intergenic
999773077 5:154790189-154790211 AGGAGAAAGACACAGTAGAGAGG - Intronic
1000574808 5:162964757-162964779 GTGAGATTGACACAGAAGACAGG - Intergenic
1000591559 5:163165100-163165122 GTGTGATTGACACAGAAGGTGGG + Intergenic
1000860522 5:166450919-166450941 GTGAGATCAACACAGAAGGTGGG - Intergenic
1001045574 5:168368945-168368967 ATGGGGTAGACACAGGTGATGGG - Intronic
1003719029 6:8679407-8679429 TTGAGCTAGACACAGAAAATCGG + Intergenic
1005210305 6:23453042-23453064 AGGATAGAGACACAGAAGAGAGG + Intergenic
1005552923 6:26942496-26942518 AAGAGATAAATACAGAAAATTGG + Intergenic
1006645006 6:35509826-35509848 ATGAGAAAGACCAAGAAGAAAGG - Exonic
1008407697 6:51136830-51136852 ATGAGATCAACACAGAAGATGGG - Intergenic
1008999345 6:57695706-57695728 AGGAGATGGATACAGAACATAGG + Intergenic
1009187835 6:60595111-60595133 AGGAGATGGATACAGAACATAGG + Intergenic
1009393208 6:63167034-63167056 AGGTGATTGACACAGAAGACAGG + Intergenic
1009679667 6:66875335-66875357 GCGTGATTGACACAGAAGATGGG - Intergenic
1009775418 6:68199358-68199380 GTGAGATATACAAAAAAGATTGG + Intergenic
1010092626 6:72002946-72002968 AGGAGATAGAGACAGAAGTAAGG - Intronic
1010102549 6:72126055-72126077 GTGAGATCGACACAGAAGATGGG - Intronic
1010171880 6:72984779-72984801 GTGTGATCGACACAGAAGACGGG - Intronic
1010190596 6:73192093-73192115 ATGAGCTAGAAACCCAAGATTGG - Intronic
1010837837 6:80612172-80612194 ACGAGATTGACACAGAAGATGGG + Intergenic
1010969240 6:82247038-82247060 TTGAGAGAGACAGAGAAGACAGG - Intronic
1011010541 6:82698748-82698770 AGGAAATAGATACAGAACATGGG + Intergenic
1011332843 6:86228756-86228778 GTGAGATCAACACAGAAGGTGGG - Intergenic
1012209349 6:96500374-96500396 GTGTGATCGACACAGAAGACAGG - Intergenic
1012481965 6:99676876-99676898 ATGTGAGCAACACAGAAGATGGG - Intergenic
1012597939 6:101062053-101062075 GTGAGATTGACTCAGAAGATGGG + Intergenic
1012635432 6:101532967-101532989 ATGAAAAAGACACAGAAGGGAGG + Intronic
1012878371 6:104756619-104756641 GCGAGACTGACACAGAAGATGGG + Intronic
1013037895 6:106404631-106404653 GTGAGATCAACACAGAAGGTGGG + Intergenic
1014087589 6:117365460-117365482 ATGGGAATGACAAAGAAGATGGG + Intronic
1014184604 6:118421076-118421098 GTGAAATTGACACAGAAGATGGG + Intergenic
1014196909 6:118571501-118571523 ATGATAGCGAAACAGAAGATTGG - Intronic
1015132984 6:129835479-129835501 GTGAGATCGACGCAGAAGATGGG + Intronic
1015751490 6:136564334-136564356 AAGAGGTAGACAGAGAAGGTGGG + Intronic
1016058928 6:139608059-139608081 ATGAGAGAGACAGAGAAAATTGG + Intergenic
1016097956 6:140061256-140061278 ATAAGATGGAGACAGAGGATGGG + Intergenic
1016334821 6:142993794-142993816 GCGAGATCGACGCAGAAGATGGG + Intergenic
1016338622 6:143035596-143035618 GTGAGATCGATGCAGAAGATGGG - Intergenic
1016584865 6:145673350-145673372 GTGTGATCGACGCAGAAGATAGG + Intronic
1017317458 6:153048361-153048383 AGGTGGTAGAAACAGAAGATGGG - Intronic
1017327220 6:153153099-153153121 ATGTGATAGACATACAATATAGG - Intergenic
1017659876 6:156663557-156663579 GTGTGATCAACACAGAAGATGGG + Intergenic
1019259255 7:71498-71520 CTGAGACAGCCACAGGAGATTGG + Intergenic
1020333297 7:7041880-7041902 GTGAGATCGACACAGAAGGCAGG + Intergenic
1020736149 7:11950912-11950934 CTGAGGAAGACACAGAAGCTGGG - Intergenic
1020874368 7:13674409-13674431 GTGAGATCAACACAGAAGGTGGG - Intergenic
1021059815 7:16097748-16097770 AGGAGATTTTCACAGAAGATTGG + Intronic
1021282750 7:18740337-18740359 CTGTGATTGACACAGAAGATGGG - Intronic
1021342339 7:19480079-19480101 GTGTGAGTGACACAGAAGATGGG - Intergenic
1021489367 7:21201976-21201998 ACGACATAAACACAGAAGTTGGG + Intergenic
1021513705 7:21460955-21460977 ATTAGCTAGACACAGCTGATTGG + Intronic
1021726065 7:23549260-23549282 ATGAGATAGAGACTGAAGAATGG + Intergenic
1023218459 7:37892564-37892586 AAGTGATAGATACAGAAGTTAGG - Intronic
1023569004 7:41553214-41553236 GCGTGATGGACACAGAAGATGGG - Intergenic
1023660271 7:42463853-42463875 TTGAGATATAGAAAGAAGATGGG + Intergenic
1024106199 7:46089017-46089039 GTGAGATCGACACAGAAGACGGG - Intergenic
1026098236 7:67364216-67364238 ATTAGCTAGACACAGAACACTGG + Intergenic
1027790294 7:82633146-82633168 GTGAGATCAACACAGAAGGTGGG + Intergenic
1028152751 7:87393436-87393458 ATGAGATAGAGAAAAGAGATTGG + Intronic
1028340874 7:89718757-89718779 GTAAGATTGACGCAGAAGATGGG + Intergenic
1028396089 7:90369887-90369909 GCAAGATCGACACAGAAGATGGG - Intronic
1028646875 7:93108381-93108403 GTGTGAGAGACACAGAAGACAGG + Intronic
1028652940 7:93170803-93170825 GTGAGATGGACGCAGAAGGTGGG - Intergenic
1028836077 7:95376822-95376844 GTGAGATCAACACAGAAGACAGG + Intronic
1029017385 7:97328327-97328349 GCGTGATTGACACAGAAGATGGG + Intergenic
1029040553 7:97568810-97568832 ATGAGATCGGCAAAGAAGAAAGG - Intergenic
1029419262 7:100464034-100464056 ATGGGAAAAACACAGAAGAAAGG + Exonic
1030144446 7:106339358-106339380 ATCAGTCAGAAACAGAAGATTGG + Intergenic
1031463556 7:122081023-122081045 AAGAGATAGACGCATAAGCTCGG + Intronic
1031569387 7:123340629-123340651 ATAAGCCAGACAGAGAAGATTGG - Intergenic
1031614684 7:123866769-123866791 AAGAGAGAGAAAGAGAAGATAGG - Intronic
1031981959 7:128133764-128133786 TTGAGATAGCCACTGTAGATGGG + Intergenic
1032604163 7:133330843-133330865 GTGAGATCGACGCAGAAGAAGGG - Intronic
1032646339 7:133828994-133829016 AGGAGAGAGACACAGAAGGCTGG + Intronic
1033446025 7:141422803-141422825 AGGAGATGGACGCAGAAGGTTGG - Intronic
1033494976 7:141884927-141884949 ATGAGAGAGGCAAAGGAGATTGG + Intergenic
1034371837 7:150605650-150605672 CTGTGAGTGACACAGAAGATGGG + Intergenic
1034778370 7:153853177-153853199 ATGAGACAGACAGAGAAGAGGGG - Intergenic
1035432531 7:158833032-158833054 ATCAGATAGACCCAGAAGGAAGG + Intergenic
1035891875 8:3353872-3353894 ATGAAATTAACACAGAAGAAAGG + Intronic
1036522903 8:9508670-9508692 ATAAGAGAGACACAAAATATAGG - Intergenic
1037050202 8:14362762-14362784 ATGAGATAGACACAGAAGATGGG - Intronic
1037077158 8:14734654-14734676 GTGATATAGACACAGCACATTGG - Intronic
1039154027 8:34535449-34535471 GTGAGATTGACACAGAAGATGGG + Intergenic
1039347649 8:36725807-36725829 GTGAGATTGACGCAGAAGACGGG + Intergenic
1040411403 8:47158292-47158314 GTGTGAGCGACACAGAAGATGGG + Intergenic
1040418736 8:47219603-47219625 AACAGATAGACACAGAAGAATGG + Intergenic
1040540764 8:48352704-48352726 GTGTGATCAACACAGAAGATGGG + Intergenic
1041304173 8:56443599-56443621 ATGAGAAAGACACTTATGATTGG - Intronic
1041447151 8:57964908-57964930 ATGAGATAGAAAATGCAGATTGG + Intergenic
1042308776 8:67359011-67359033 GTGTGATCAACACAGAAGATGGG - Intergenic
1042541032 8:69907304-69907326 ATGTGAATGACACAGAAGATAGG + Intergenic
1043118255 8:76286945-76286967 GTGAGATCAACACAGAAGGTGGG - Intergenic
1043126994 8:76410591-76410613 GTGAGCTAGACAGAGAAGGTAGG + Intergenic
1044378131 8:91500203-91500225 ATGAGATCAACACAGAAGGTGGG - Intergenic
1044413696 8:91912499-91912521 ATGAGAAAGACTAAGAAGAAAGG - Intergenic
1044470690 8:92562903-92562925 GCGTGATAGACCCAGAAGATGGG - Intergenic
1044521650 8:93205794-93205816 GCGTGATTGACACAGAAGATGGG - Intergenic
1045157516 8:99492935-99492957 GTGAGATCGACGCAGAAGATGGG - Intronic
1045212006 8:100108423-100108445 GTGAGATTGACACAGAAGGAGGG + Intronic
1045253630 8:100501639-100501661 ATGAGCTAAACAGAGAAGCTTGG + Intergenic
1045550619 8:103168775-103168797 AAGAGAAAGACACAGAATACAGG - Intronic
1045628058 8:104080096-104080118 CTGAGATAGAATGAGAAGATTGG + Intronic
1045880230 8:107029747-107029769 AAGAGATTAACACAGAAAATTGG + Intergenic
1046723643 8:117651324-117651346 CTGAGAGAGAGAGAGAAGATGGG + Intergenic
1048673701 8:136752540-136752562 TTCAGATAGACACAAAGGATGGG - Intergenic
1049872471 8:144991189-144991211 TTGAGACCAACACAGAAGATGGG - Intergenic
1050057243 9:1668507-1668529 ATGTGATACACACATATGATGGG + Intergenic
1050295009 9:4195837-4195859 ATTAGCTAGACACAGAACACTGG - Intronic
1050404384 9:5292823-5292845 GTGACATTGTCACAGAAGATGGG + Intergenic
1050700254 9:8330255-8330277 GTGAGATTGACACAGAAGGCAGG - Intronic
1051338029 9:16084719-16084741 TTCACATAGTCACAGAAGATTGG + Intergenic
1051713849 9:19961097-19961119 AGGAGAGAGAGACAGAAGAAAGG + Intergenic
1051713850 9:19961117-19961139 AGGAGAGAGAGACAGAAGAAAGG + Intergenic
1052495702 9:29220765-29220787 ATGAGATAGGGACAGAGGGTAGG + Intergenic
1052821141 9:33138692-33138714 ATGAGATGGAAACAGAGGTTTGG - Intronic
1053651229 9:40171593-40171615 ATTACATAGACAGAGAAGTTGGG - Intergenic
1054533351 9:66204610-66204632 ATTACATAGACAGAGAAGTTGGG + Intergenic
1055548493 9:77408358-77408380 GTGTGAGCGACACAGAAGATGGG + Intronic
1056477911 9:86970567-86970589 ATGAGGAAGACACAGAAGATGGG + Intergenic
1057897556 9:98921946-98921968 AGGAGAGAGACACAGAACAGAGG - Intergenic
1058485674 9:105441289-105441311 AGGAGATAGAAAGGGAAGATTGG - Intergenic
1059513253 9:114869422-114869444 GTGAGATTGACACAGAAGGCTGG + Intergenic
1059675731 9:116537213-116537235 GTGTGAGCGACACAGAAGATGGG - Intronic
1059921737 9:119167676-119167698 TTGACATAGACAAAGAACATGGG + Exonic
1060761238 9:126251075-126251097 AAGTGATAGATACAGAAGTTAGG - Intergenic
1203537458 Un_KI270743v1:54616-54638 ATGAGATCAACACAGAAGGCAGG + Intergenic
1185496967 X:562020-562042 ATGTGATAGATAAAGATGATTGG - Intergenic
1185519803 X:729833-729855 ATCAGGTGCACACAGAAGATGGG + Intergenic
1185592507 X:1286915-1286937 AGGAGACAGAGACAGAAGAGCGG + Intronic
1186937273 X:14463938-14463960 GTGAGATAGATGCAGAAGACGGG - Intergenic
1188561343 X:31471539-31471561 GTGAGATCAACACAGAAGGTGGG - Intronic
1188954627 X:36418931-36418953 GTGTGATCGACACAGAAGATGGG - Intergenic
1189024629 X:37379918-37379940 ATAATATACACACAGAAAATGGG + Intronic
1189580088 X:42396787-42396809 ATCAGATAGGCACTGGAGATAGG + Intergenic
1190603738 X:52119201-52119223 GTGTGAGTGACACAGAAGATGGG + Intergenic
1191153954 X:57251771-57251793 GTGAGATCGACACAGAAGATGGG + Intergenic
1191181113 X:57564981-57565003 GTGAGATCGACACAGAAGGCAGG + Intergenic
1191197840 X:57744046-57744068 GCGAGATTGACACAGGAGATGGG + Intergenic
1191645602 X:63478068-63478090 GTGTGATCGACACAGAAGATGGG + Intergenic
1191687309 X:63904762-63904784 GTGTGAGTGACACAGAAGATGGG - Intergenic
1191941743 X:66488945-66488967 GTGAGATAGACGCAGAAGGTGGG + Intergenic
1191947653 X:66553539-66553561 GTGAGATCAACACAGAAGGTGGG + Intergenic
1191995556 X:67091482-67091504 ATGAGAGAGAAACAAGAGATAGG - Intergenic
1192097163 X:68224802-68224824 GTGTGAGCGACACAGAAGATGGG + Intronic
1192406360 X:70890267-70890289 ACGTGATCGACACAGAAGACGGG + Intronic
1192694630 X:73401118-73401140 GTGAGATCGACGCAGAAGGTGGG + Intergenic
1192825862 X:74695764-74695786 GTGTGATTGACCCAGAAGATGGG + Intergenic
1192878488 X:75257837-75257859 ATGAGATTGATGCAGAAGAAGGG + Intergenic
1192975072 X:76274086-76274108 GCGAGATAGATACAGAAGGTGGG - Intergenic
1193058943 X:77184519-77184541 GTGTGAGTGACACAGAAGATGGG + Intergenic
1193436010 X:81475522-81475544 GTGTGATCGACACAGAAGATGGG - Intergenic
1194754293 X:97719477-97719499 ATGAGATTAACAAAGAAGAGTGG - Intergenic
1195049965 X:101088233-101088255 ATGTGATAAACACAAAAGACAGG - Intronic
1195515856 X:105774970-105774992 AGGAGATAGAAACAGAAAGTAGG + Intergenic
1195580394 X:106494243-106494265 GTGAGATCGACACAGAAGTCGGG - Intergenic
1195621991 X:106966360-106966382 GTGAGATCGACGCAGAAGACAGG + Intronic
1197051079 X:122060783-122060805 GTGAGATCAACACAGAAGGTGGG + Intergenic
1198704635 X:139435749-139435771 GTGTGAGCGACACAGAAGATGGG + Intergenic
1199068026 X:143443060-143443082 GTGAGATCAACACAGAAGGTGGG - Intergenic
1199344115 X:146719108-146719130 GCGTGATCGACACAGAAGATGGG + Intergenic
1199379222 X:147148093-147148115 GCGTGAGAGACACAGAAGATGGG - Intergenic
1199398592 X:147369973-147369995 ATGACATATACATAGAAAATGGG - Intergenic
1199436515 X:147819119-147819141 GTGAGATTGACACAGAAGGTAGG + Intergenic
1199556855 X:149118766-149118788 TTGAGAGAGACTCAGAAGATGGG - Intergenic
1199968580 X:152841374-152841396 GCGTGATCGACACAGAAGATGGG - Intronic
1201038352 Y:9805154-9805176 ATGGGTAAGACAGAGAAGATAGG - Intergenic
1201286409 Y:12382424-12382446 AAGAGATGGACACAGGAGTTAGG + Intergenic
1201752276 Y:17445806-17445828 GCAAGATCGACACAGAAGATGGG - Intergenic
1201783132 Y:17744756-17744778 AAGAGATAAACAAAGAATATTGG - Intergenic
1201818421 Y:18161231-18161253 AAGAGATAAACAAAGAATATTGG + Intergenic
1201988354 Y:19993934-19993956 GTGTGAGAGACGCAGAAGATAGG - Intergenic