ID: 1037050203

View in Genome Browser
Species Human (GRCh38)
Location 8:14362763-14362785
Sequence AATGAGATAGACACAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1059
Summary {0: 1, 1: 1, 2: 18, 3: 133, 4: 906}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050203_1037050206 9 Left 1037050203 8:14362763-14362785 CCATCTTCTGTGTCTATCTCATT 0: 1
1: 1
2: 18
3: 133
4: 906
Right 1037050206 8:14362795-14362817 AGACCGGAGCTGTTCCTATTTGG 0: 1668
1: 3281
2: 1708
3: 550
4: 245
1037050203_1037050208 18 Left 1037050203 8:14362763-14362785 CCATCTTCTGTGTCTATCTCATT 0: 1
1: 1
2: 18
3: 133
4: 906
Right 1037050208 8:14362804-14362826 CTGTTCCTATTTGGCCATCTTGG 0: 1017
1: 3367
2: 1743
3: 827
4: 622
1037050203_1037050205 -7 Left 1037050203 8:14362763-14362785 CCATCTTCTGTGTCTATCTCATT 0: 1
1: 1
2: 18
3: 133
4: 906
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050203 Original CRISPR AATGAGATAGACACAGAAGA TGG (reversed) Intronic
900356369 1:2266755-2266777 AATGAGATAGAAAATGAAGATGG + Intronic
902168306 1:14590446-14590468 AATGAGAAAGAAACAAAAGGTGG + Intergenic
902268746 1:15288075-15288097 AAAGAGAGAGAGAGAGAAGAAGG + Intronic
902966435 1:20007793-20007815 AGTGAGACCAACACAGAAGATGG - Intergenic
903127656 1:21258729-21258751 ACTGACATAGACAGAGAAGAAGG + Exonic
903432767 1:23320415-23320437 GATGAGGTAGACATAGAAGTAGG + Intronic
903551089 1:24157683-24157705 GATGAGGAGGACACAGAAGATGG - Exonic
903912170 1:26735653-26735675 AATGAGAAAGACACAGGGGATGG - Intronic
903913022 1:26742418-26742440 AAGAAGACAGACACAGAACAGGG - Intronic
904645334 1:31961391-31961413 AATGAGGCAAACACAGAAAAAGG + Intergenic
905097677 1:35487950-35487972 AGTGAGAAAACCACAGAAGAGGG - Intronic
906235778 1:44208135-44208157 AATAAAATAAACAAAGAAGAAGG + Intergenic
906246520 1:44279162-44279184 GATGAGATTGCCAAAGAAGAGGG - Intronic
906362963 1:45179994-45180016 AGTGTGAGCGACACAGAAGACGG + Intronic
906868765 1:49452553-49452575 AATGAGAAATATATAGAAGATGG - Intronic
906868766 1:49452594-49452616 AATGAGAAAGATATAGAAGATGG - Intronic
907004044 1:50892419-50892441 AGTGTGAGCGACACAGAAGATGG - Intronic
907357222 1:53886217-53886239 GATGAGCAAGACCCAGAAGATGG + Intronic
907588077 1:55639402-55639424 AATGAGAGAGACACAGAGCAAGG - Intergenic
907720528 1:56967873-56967895 GATGGGAAAGCCACAGAAGATGG + Intergenic
907799439 1:57750226-57750248 AATGTGATAGAAACACAAAAAGG - Intronic
907857819 1:58321336-58321358 AAGGTGATCGACGCAGAAGATGG + Intronic
909133187 1:71765611-71765633 AATGGGACAGAAACAGAATATGG - Intronic
909457169 1:75862353-75862375 AGCGAGATTGACGCAGAAGATGG - Intronic
910061784 1:83102587-83102609 AATGAGGGAGACACAGGAGGGGG + Intergenic
910348034 1:86263462-86263484 AACTAGATGGACACAGATGAGGG + Intergenic
910628667 1:89335441-89335463 AAGGAAAAAGACACTGAAGAGGG + Intergenic
910829074 1:91441865-91441887 AGCGTGATCGACACAGAAGACGG + Intergenic
911034074 1:93520540-93520562 AATGAGATAAGTACAGAAGTTGG - Intronic
911121975 1:94305431-94305453 AATGAGAGAATGACAGAAGATGG + Intergenic
911218059 1:95216922-95216944 AGTGAGACTGACACAGAAGATGG - Intronic
911304658 1:96218226-96218248 AATGCTTTAGACACAAAAGATGG - Intergenic
911541448 1:99162627-99162649 AGTGAGATTGACGCAGAAGGCGG - Intergenic
911757789 1:101580110-101580132 AATAAGTTAGACACACAAGAGGG - Intergenic
911825284 1:102476514-102476536 AGTGAGAAAGAGAGAGAAGAGGG - Intergenic
911891412 1:103377262-103377284 AGTGTGAGTGACACAGAAGACGG + Intergenic
912639925 1:111335261-111335283 AGAGTGAGAGACACAGAAGACGG + Intergenic
912755685 1:112323096-112323118 AAAGACATAGAAACAGAAGCAGG + Intergenic
912927089 1:113922710-113922732 AAAGAGAGAGAGAGAGAAGAAGG - Intergenic
913363184 1:118004883-118004905 AGTGTGATCGACACAGAAGATGG - Intronic
913526397 1:119697455-119697477 AGTGTGATAGACCCAGAAGATGG - Intronic
914868304 1:151451708-151451730 AATGAGATAAATCCAGAAGGTGG + Intronic
915077416 1:153320504-153320526 AGTGAGATTGACGCAGAAGATGG - Intergenic
915214310 1:154329704-154329726 ACTGAGATAGAGATAGAGGAGGG - Intronic
915528299 1:156489381-156489403 GGTGAGGCAGACACAGAAGAGGG + Intronic
915651501 1:157315308-157315330 AGCGAGACTGACACAGAAGATGG + Intergenic
916126760 1:161578242-161578264 AAGGAGATAGACACAGAATCAGG - Intergenic
916136679 1:161660082-161660104 AAGGAGATAGACACAGAATCAGG - Intronic
916172707 1:162012633-162012655 AAAGAGATACACACACCAGAAGG + Intronic
916878823 1:168998960-168998982 AATGAGATCAACGCAGAAGGCGG - Intergenic
916905640 1:169279767-169279789 AGTGTGAGTGACACAGAAGATGG - Intronic
917111831 1:171556492-171556514 AGTGTGATTGACGCAGAAGACGG - Intronic
917163248 1:172081017-172081039 AGTGAGATCAACACAGAAGCAGG - Intronic
917464392 1:175262322-175262344 AGTAAGATTGACACAGAAGATGG - Intergenic
917585075 1:176417537-176417559 AGTGAGATCGACACAGAAGGTGG - Intergenic
917612977 1:176708170-176708192 AATGTGATAGACACAAATTAAGG - Intronic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917663485 1:177200601-177200623 AATGAGATAGAAACCAAACACGG - Intronic
917770354 1:178270610-178270632 AAAAAGAGAGACACAGAAAAAGG - Intronic
918146067 1:181757029-181757051 AAAGATATTGACAAAGAAGAAGG - Exonic
918925066 1:190772922-190772944 AGTGAAATAGACGCATAAGAAGG - Intergenic
919063985 1:192669029-192669051 AGTGAGATCGACGCAGAAGATGG - Intergenic
919258992 1:195165383-195165405 AAATAGATTGACACACAAGAGGG + Intergenic
919417671 1:197331657-197331679 ATTGAGATAGAAGCAGAAAATGG - Intronic
919445937 1:197705312-197705334 AATGACATAGATACACAAAATGG + Intronic
919628981 1:199941218-199941240 AATGAGAGAGAGAGAGGAGAGGG + Intergenic
919638253 1:200024869-200024891 AAAGAGAGAGAGAGAGAAGATGG + Intergenic
920174517 1:204092016-204092038 AAAGTGAAAGAGACAGAAGAAGG - Intronic
920332286 1:205218409-205218431 AATGACATTGACATAGAAAAGGG - Intergenic
920428601 1:205899355-205899377 AGCGAGATCGACACAGAAGATGG + Intergenic
920632258 1:207663704-207663726 AGTGTGAGCGACACAGAAGACGG - Intronic
921206866 1:212857078-212857100 AATGAGGGAGACAAAGAAGTGGG - Intergenic
921438921 1:215160863-215160885 AAGGAGAGAGCCACAGAATATGG - Intronic
921514050 1:216067924-216067946 AATGAAAGAGAAAGAGAAGACGG + Intronic
921607985 1:217177522-217177544 AATGAGAAAGAGAAAGAAAATGG - Intergenic
922000489 1:221472867-221472889 AATGAGATGGAAGCAGTAGAAGG + Intergenic
922312237 1:224405933-224405955 AATCAGAAAGACACAGGATAAGG + Intronic
923169420 1:231399848-231399870 AAGGAGAAAAACACAGGAGAGGG + Intronic
923246544 1:232137915-232137937 AATGAAATAGATACAGAAGCTGG + Intergenic
923548360 1:234941337-234941359 AATGAGTCACACAGAGAAGAGGG - Intergenic
923691014 1:236192732-236192754 AGCGAGATCGACACAGAAGGTGG - Intronic
923853327 1:237820271-237820293 AGTGAGATTGACGCAGAAGGTGG + Intronic
924159404 1:241215531-241215553 AAAGAGAGAGACATAGAAGGAGG - Intronic
924253503 1:242158707-242158729 AGTGAGATTGACACAGAAAGCGG - Intronic
924359575 1:243223422-243223444 AGTGTGATAAACACAGATGAGGG + Intronic
924411133 1:243807099-243807121 AGTGTGAGCGACACAGAAGACGG + Intronic
924490942 1:244536676-244536698 AAGGAAACAGACACTGAAGACGG - Intronic
924603151 1:245509251-245509273 AATGAGAAATACAAACAAGATGG + Intronic
924628411 1:245714801-245714823 AGCGAGATCGACACAGAAGGCGG + Intergenic
924833986 1:247629485-247629507 AATAAAAGAGACACTGAAGAAGG - Intergenic
1062930230 10:1348028-1348050 AGAGAGACAGAGACAGAAGAGGG + Intronic
1062942063 10:1429959-1429981 AATGAAATAATAACAGAAGAAGG + Intronic
1063059612 10:2537792-2537814 AGTGAGATAAACAAGGAAGAAGG - Intergenic
1063083682 10:2793149-2793171 TAGGAGATAGAGACAGGAGAAGG - Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1064300559 10:14119158-14119180 AGGGTGATAGACACAGCAGAGGG + Intronic
1064655719 10:17553677-17553699 AATGGGATAGAAAAAGAAGAGGG + Intergenic
1064728614 10:18306520-18306542 AATGTGAGAGAGGCAGAAGAAGG + Intronic
1065119454 10:22514440-22514462 AGCAAGATTGACACAGAAGATGG - Intergenic
1065156968 10:22880704-22880726 AACAAGATCAACACAGAAGATGG + Intergenic
1065427314 10:25619231-25619253 AGTGAGATCAACACAGAAGGTGG + Intergenic
1065651641 10:27899058-27899080 AGTGAGATCGACACAGAAAGTGG + Intronic
1066053503 10:31659541-31659563 ATTTAGATAAACAGAGAAGAAGG + Intergenic
1066297484 10:34067533-34067555 AATGAGATCAATGCAGAAGATGG + Intergenic
1067231187 10:44411788-44411810 AGCGAGATTGACGCAGAAGATGG - Intergenic
1068169020 10:53370164-53370186 AGTGAGATTGATGCAGAAGATGG + Intergenic
1068534760 10:58229773-58229795 AGTGTGATCGACGCAGAAGACGG + Intronic
1068622911 10:59207176-59207198 AGTGAGATCAACACAGAAGGTGG + Intronic
1068789215 10:61008969-61008991 AGTGAGATCAACACAGAAGACGG - Intergenic
1069066874 10:63950720-63950742 AGTGTGAGAGACGCAGAAGATGG - Intergenic
1069608488 10:69756306-69756328 GATGAGAGAGGCAGAGAAGAGGG - Intergenic
1069835434 10:71305023-71305045 AATGAAGTAGAGACAGAGGAAGG - Intergenic
1069892075 10:71658163-71658185 AAAGAGATAAACACAGGCGAGGG - Intronic
1070003027 10:72395356-72395378 AGTGTGATCGACACAGAAGATGG + Intronic
1070061632 10:72989617-72989639 AGTGTGATCAACACAGAAGATGG + Intergenic
1070574821 10:77670158-77670180 AATGAGAGAGACAGAGAAAGAGG + Intergenic
1070892963 10:79956217-79956239 AGTGTGAGCGACACAGAAGACGG + Intronic
1070998771 10:80810999-80811021 AATGGGATAGTCACAGGAAAGGG - Intergenic
1071021175 10:81058943-81058965 AAAGAGACACACAGAGAAGAAGG - Intergenic
1071162461 10:82764885-82764907 AGAGAGAAAGACAGAGAAGAAGG + Intronic
1071557505 10:86616370-86616392 AAGGACATAGACACACATGAAGG - Intergenic
1072382725 10:94892410-94892432 AGTGTGAGTGACACAGAAGATGG + Intergenic
1072480619 10:95807578-95807600 AGTGTGATTGACCCAGAAGATGG - Intronic
1072712929 10:97729482-97729504 AATGCGGTATAAACAGAAGATGG - Intergenic
1073745811 10:106467278-106467300 AGCAAGATTGACACAGAAGATGG + Intergenic
1073803969 10:107075455-107075477 AATGTTCTAGGCACAGAAGATGG + Intronic
1074303127 10:112250948-112250970 AGTGTGAGCGACACAGAAGACGG + Intergenic
1074415657 10:113264762-113264784 AAAGAGACAGGCACAGACGATGG - Intergenic
1074985273 10:118652671-118652693 AGTGAGATCAACACAGAAGGTGG - Intergenic
1075212409 10:120502375-120502397 AGGGAGAGAGACACAGCAGATGG + Intronic
1075847264 10:125555021-125555043 GATGAGGAAGACACAGAAGAGGG - Intergenic
1075857997 10:125647595-125647617 AATGTGAGTGACACAGAAGATGG + Intronic
1075911849 10:126131824-126131846 AATGAAAGTAACACAGAAGAAGG + Intronic
1076190789 10:128482064-128482086 ATGGAGAGAGACACAGATGAAGG + Intergenic
1076290341 10:129340853-129340875 AAGGAGAGAGGCACAGAAGGAGG - Intergenic
1077390319 11:2297935-2297957 AAGGAGAGAGAGAGAGAAGAGGG + Intronic
1077711479 11:4541497-4541519 AATGATATAGAAAAAGAATAGGG + Intergenic
1077779071 11:5305144-5305166 AAGGAGATAGACAAAGAAGCAGG + Intronic
1077974922 11:7238079-7238101 ATTGTGACAGACACGGAAGATGG - Intergenic
1078405053 11:11063315-11063337 AAAGAGAGAGAGACAGAAGGGGG + Intergenic
1078550272 11:12275498-12275520 AAGGAGATAGCCAGTGAAGAAGG + Intergenic
1078564425 11:12402238-12402260 AAAGCCATAGGCACAGAAGAGGG + Intronic
1078884083 11:15482523-15482545 AATGAGAACGACAGAGAGGAAGG - Intergenic
1079646475 11:22869604-22869626 GATTAGATACACACAGAGGAAGG - Intergenic
1079834768 11:25320725-25320747 CATGTAAAAGACACAGAAGATGG - Intergenic
1079894542 11:26102386-26102408 AAAGAGAGAGAAAAAGAAGAGGG + Intergenic
1080854542 11:36100861-36100883 ACTGGGATGGGCACAGAAGAGGG - Intronic
1080966654 11:37220681-37220703 AAGGAAAGAGACACTGAAGAAGG - Intergenic
1081346079 11:41988099-41988121 AGAGAGATGGAAACAGAAGAGGG + Intergenic
1081389650 11:42514698-42514720 AGTGTGAGCGACACAGAAGACGG + Intergenic
1082648224 11:55754972-55754994 AAAGAGAGAGAGACAGAAAAAGG - Intergenic
1082945058 11:58749684-58749706 AGTGTGATCAACACAGAAGATGG + Intergenic
1082956685 11:58877349-58877371 AGTGTGAGCGACACAGAAGATGG - Intronic
1083426577 11:62590892-62590914 AGTGAGGAAGAGACAGAAGATGG - Intronic
1083444530 11:62698856-62698878 AATGAGAAAGCCACAGAACCTGG - Intronic
1083503508 11:63133382-63133404 AGTGAGATCAACACAGAAGATGG - Intronic
1083528956 11:63398740-63398762 ACTGAAAGAGACACTGAAGAGGG - Intronic
1083531509 11:63427835-63427857 AGTGAGATCGATGCAGAAGATGG + Intergenic
1083544328 11:63537784-63537806 AAGGAAATAGACAAGGAAGAGGG - Intronic
1085068925 11:73523748-73523770 AATGAGATAGAAAAGGAAGAGGG - Intronic
1086113454 11:83222783-83222805 AATGAGAAAGACAGGAAAGAAGG - Intronic
1086275553 11:85124070-85124092 AATGAGAGAGAAAGAGGAGAGGG + Intronic
1086416773 11:86596772-86596794 AATGAGTTACACATAGAATAAGG - Intronic
1086421812 11:86644809-86644831 AATGAGACCAACACAGAAGGCGG + Intronic
1086442021 11:86837857-86837879 AGTGAGATCGACACAGAAGATGG + Intronic
1086527333 11:87743239-87743261 AATGAGTGAGACAAAGAAGAAGG + Intergenic
1086612930 11:88778522-88778544 AATGTGATCGATGCAGAAGACGG - Intronic
1086670066 11:89535580-89535602 AAGGAGAGAGAGACAGAAGAGGG - Intergenic
1086735752 11:90303017-90303039 AGTGAGATGGACGCAGAAGGTGG - Intergenic
1087082074 11:94180500-94180522 TGTGAGACAGACAGAGAAGAGGG - Intronic
1087243367 11:95806301-95806323 AGTGTGAGTGACACAGAAGACGG + Intronic
1087364257 11:97198790-97198812 AGCGAGATCGACACGGAAGACGG - Intergenic
1087444526 11:98232911-98232933 AATTAGAAAGCCACAGTAGAAGG - Intergenic
1087482469 11:98718546-98718568 AGTGAGATTGACATAGAAGATGG - Intergenic
1087596032 11:100256549-100256571 AATGAGATCAACGCAGAAGGTGG + Intronic
1087898223 11:103611274-103611296 AGCGAGATTGACACAGAAGACGG + Intergenic
1087954195 11:104264661-104264683 AATGAGAGAGGCAGGGAAGAAGG - Intergenic
1088197657 11:107293770-107293792 AGCGGGATTGACACAGAAGATGG + Intergenic
1088511077 11:110575518-110575540 AATGAAGTACACACAGATGATGG - Intergenic
1088726613 11:112643309-112643331 AATGAAATACACAGAGAAAAAGG - Intergenic
1088904080 11:114140891-114140913 AAGGAGACAGACAGAGAAAAGGG - Intronic
1089095996 11:115920523-115920545 AATGAGAGAGACAATGATGAAGG - Intergenic
1089139610 11:116275343-116275365 ACTGGGAGAGACAGAGAAGAGGG - Intergenic
1089229412 11:116958687-116958709 ACTGGGATAGGCAGAGAAGAAGG + Intronic
1089436522 11:118473476-118473498 AACGAGGAAGAGACAGAAGACGG - Exonic
1090033156 11:123224879-123224901 AAGGAGGTAAATACAGAAGAAGG + Intergenic
1090683770 11:129091714-129091736 AGTGAAATAGACACAGAAAAAGG + Intronic
1091170434 11:133515645-133515667 TATGAGAAATACACAGAAGATGG + Intronic
1091616745 12:2055240-2055262 AAGGAGTGAGACACAAAAGAGGG + Intronic
1091676127 12:2491487-2491509 AATGAAATTGACAGAGAACAAGG + Intronic
1091865103 12:3827111-3827133 AATGAGATGGTCCAAGAAGATGG - Intronic
1092319729 12:7459763-7459785 AAGGAAAGAGACACTGAAGAAGG + Intronic
1092327013 12:7543678-7543700 AGTGAGATCGACGCAAAAGACGG + Intergenic
1092418122 12:8307670-8307692 GATGAGAGAGATGCAGAAGATGG + Intergenic
1092581783 12:9849976-9849998 AGAGAGATCGACACAGAAGGTGG - Intergenic
1093661070 12:21757670-21757692 CAAGTGATAGACAAAGAAGACGG - Intronic
1093671068 12:21876687-21876709 GATGAAGTAGACACAGATGAGGG + Intronic
1093721154 12:22443555-22443577 AATGAGTTCCACACAGAACAGGG - Intergenic
1093906219 12:24694991-24695013 GGTGATATTGACACAGAAGAGGG + Intergenic
1094005570 12:25746468-25746490 AAGGAGAGAGAGAGAGAAGAAGG - Intergenic
1094738593 12:33262601-33262623 ATTTAGATAGGCAGAGAAGATGG + Intergenic
1094800985 12:34035805-34035827 AAAGAGGGAGTCACAGAAGAAGG - Intergenic
1094858331 12:34431042-34431064 AGTGTGAGTGACACAGAAGATGG + Intergenic
1095042610 12:37459415-37459437 AATGCCGAAGACACAGAAGAAGG - Intergenic
1095114123 12:38331815-38331837 AAAGAGGGAGTCACAGAAGAAGG - Intergenic
1095140489 12:38656951-38656973 AGCGTGACAGACACAGAAGATGG + Intronic
1095186569 12:39207794-39207816 AGTGAGATCGAGGCAGAAGATGG + Intergenic
1095271010 12:40219332-40219354 AATAAGTTAGAAACAGAATACGG + Intronic
1095385523 12:41645712-41645734 AAAGAGAAAGAGAGAGAAGAGGG + Intergenic
1096016035 12:48275775-48275797 AGTGAGATCAACACAGAAGATGG - Intergenic
1096687500 12:53298400-53298422 AATGAGATGAACACACAGGAAGG + Intronic
1097301435 12:58023220-58023242 AGTGAGATTGACGCAGAAGATGG - Intergenic
1097304208 12:58051865-58051887 AGTGTGAGAGACGCAGAAGACGG + Intergenic
1097336838 12:58393281-58393303 AATGAGATAGATACCTCAGAAGG + Intergenic
1097375911 12:58841754-58841776 AGTGAGATTGACACAGAAGGCGG - Intergenic
1097589378 12:61555138-61555160 AATGAGAGGGATACAGAAAAGGG - Intergenic
1097591122 12:61576736-61576758 AGTGAGAGAGACAAATAAGAAGG + Intergenic
1097710232 12:62909656-62909678 AATGAGACAGACAAAAAAGAGGG - Intronic
1098038661 12:66333001-66333023 AATGAGAAGGAGACAGAAAAAGG - Intronic
1098087389 12:66861424-66861446 AATGAGATTTACACAAACGAAGG + Intergenic
1098823979 12:75270078-75270100 AATGATATAGACAGAAAAGATGG - Intergenic
1099183862 12:79497245-79497267 AGTGAGATCAACACAGAAGGTGG - Intergenic
1099377878 12:81915418-81915440 AATGAGATATGGAGAGAAGAGGG + Intergenic
1099410149 12:82314930-82314952 AGCGTGATCGACACAGAAGACGG - Intronic
1100271900 12:93033798-93033820 AATGAGGCAGACACAAGAGATGG - Intergenic
1100417088 12:94389545-94389567 AGTGTGATGGACGCAGAAGATGG + Intronic
1100563771 12:95775247-95775269 AGTGTGAGTGACACAGAAGACGG + Intronic
1100702713 12:97164963-97164985 AGTGAGATAGATGAAGAAGAGGG + Intergenic
1100900742 12:99237972-99237994 AGTGAGATCGATGCAGAAGATGG + Intronic
1101026325 12:100609960-100609982 ACTGAGAGAGACATTGAAGAGGG - Intronic
1101181995 12:102229179-102229201 AGTGAGGTAGACAGAGGAGAGGG + Intergenic
1101301774 12:103490019-103490041 AGTGTGATCGACACAGAAGACGG - Intronic
1101499353 12:105288056-105288078 AATGAGTTGGAAACAGGAGATGG + Intronic
1101601352 12:106212794-106212816 AGTGAGATGGACGCAGAAGGTGG - Intergenic
1101828130 12:108236709-108236731 AATGAGACAGAAACAGAGAAGGG - Intronic
1102902543 12:116649459-116649481 AAGGAGGAAGACAGAGAAGAGGG - Intergenic
1103255751 12:119540073-119540095 AGTGAGATCAACACAGAAGGTGG - Intronic
1103268604 12:119652644-119652666 AATGATAGAGCCACAGAAAAGGG + Intergenic
1104096596 12:125563784-125563806 AAGGAGAAATACAGAGAAGAAGG + Intronic
1104377895 12:128281241-128281263 AATGAGATAGATACAAGAGGTGG + Intronic
1106009568 13:25806285-25806307 TATGACATATATACAGAAGATGG + Intronic
1106426690 13:29637052-29637074 AGTGAGATCAACACAGAAGGTGG - Intergenic
1106657709 13:31764221-31764243 AAAGAGAGAGAGACAGACGAGGG - Intronic
1106993973 13:35459088-35459110 AATGAGAAAAATACAGAAGGAGG + Intronic
1108851098 13:54730253-54730275 GATGAGAAAGAAACAGAAAAAGG - Intergenic
1108988703 13:56628749-56628771 AATGTGATTGACACAGAAGACGG + Intergenic
1109174280 13:59135936-59135958 AATGAGAGAGAAACAGTGGAAGG - Intergenic
1109669367 13:65585219-65585241 AGAGTGATCGACACAGAAGAGGG + Intergenic
1109675969 13:65675893-65675915 ATCGAGATAGACACAGAAGATGG - Intergenic
1110194958 13:72778204-72778226 AAAGAGAAAGCCATAGAAGAAGG - Exonic
1110826248 13:79974978-79975000 AGTGAGATTGATGCAGAAGAAGG + Intergenic
1110964851 13:81680704-81680726 AACAACAAAGACACAGAAGATGG - Intergenic
1111005491 13:82242539-82242561 AAGGAGAAAGAAAGAGAAGATGG - Intergenic
1111005639 13:82244344-82244366 AAAGAGAAAGAAAGAGAAGATGG - Intergenic
1111095882 13:83515229-83515251 AGAGAGATAGACACAGAAAAAGG + Intergenic
1111415194 13:87931516-87931538 AATTGGAAGGACACAGAAGATGG - Intergenic
1111569488 13:90063856-90063878 ACTGAGTTAAACACAGAAGCTGG + Intergenic
1111572206 13:90103690-90103712 AAGGAAAGAGACACTGAAGAAGG - Intergenic
1111727705 13:92033447-92033469 ATTTAGTTGGACACAGAAGACGG - Intronic
1111746721 13:92280813-92280835 AGTGTGAGTGACACAGAAGACGG + Intronic
1112081278 13:95974114-95974136 GATGAGCTACACACAGAGGAGGG + Intronic
1112131156 13:96524925-96524947 AGTGAGATCAACGCAGAAGATGG - Intronic
1112213998 13:97411303-97411325 AATGAGACAGAGATAGAAGATGG - Intergenic
1112412110 13:99173388-99173410 AGTGTGATTGACGCAGAAGATGG - Intergenic
1112745400 13:102522066-102522088 AGTGTGAGCGACACAGAAGATGG + Intergenic
1112756006 13:102634472-102634494 AATGAGGTAGAAAGAGAAGGAGG + Intronic
1112900034 13:104346435-104346457 AGTGTGAGCGACACAGAAGACGG - Intergenic
1113407518 13:110055384-110055406 AATGACCTAGATAGAGAAGAAGG - Intergenic
1113931249 13:113970100-113970122 AGTGAGGTGGACACAGGAGAGGG - Intergenic
1114591316 14:23867241-23867263 TGTGAGATAGACAAGGAAGAGGG - Intergenic
1114844801 14:26308661-26308683 AGTGAGATCAACACAGAAGGTGG + Intergenic
1114981232 14:28168042-28168064 AAAGTGATCCACACAGAAGATGG + Intergenic
1115116713 14:29889302-29889324 AGCGAGATTGACGCAGAAGATGG + Intronic
1115135076 14:30098200-30098222 AGTGTGATTGACGCAGAAGATGG + Intronic
1115412133 14:33088103-33088125 AGTGTGAGCGACACAGAAGATGG + Intronic
1115555049 14:34538900-34538922 CCTGAGATAGGCACAGAAGAAGG - Intronic
1115818381 14:37187809-37187831 AGCGAGATTGACACAGAAGATGG + Intergenic
1115944561 14:38644715-38644737 AGTGAGAGAGAGAGAGAAGAGGG - Intergenic
1116047406 14:39761686-39761708 AATGAGATAGACGCCGGACACGG + Intergenic
1116068932 14:40018144-40018166 AATGACAATGACACACAAGAGGG - Intergenic
1116401829 14:44516231-44516253 AGTGTGATCAACACAGAAGATGG - Intergenic
1116586043 14:46706085-46706107 AATGAATTTGACACAGGAGAAGG + Intergenic
1116863756 14:50015018-50015040 AAGGAGAAAGAAAGAGAAGAAGG + Intergenic
1116871494 14:50072898-50072920 AGTGTGAGAGACGCAGAAGACGG + Intergenic
1116953467 14:50899530-50899552 AAGGAAATAGGCACAGAATAGGG - Intronic
1117104503 14:52384337-52384359 AGTGTGAGCGACACAGAAGACGG + Intergenic
1117247436 14:53900144-53900166 AAAGAGAGAGAAAAAGAAGAAGG + Intergenic
1117609918 14:57472323-57472345 AATGAAAAAGACAATGAAGATGG - Intronic
1117762421 14:59044277-59044299 TATGAGATATACAAAGAAGCAGG - Intergenic
1117811423 14:59551534-59551556 AGTGTGAGTGACACAGAAGATGG + Intronic
1117821750 14:59657492-59657514 AGTGAGATCAACACAGAAGGTGG + Intronic
1117869938 14:60189769-60189791 CATGAAATAGACACAGAAAAAGG - Intergenic
1118094448 14:62521142-62521164 AGTGTGAGCGACACAGAAGATGG + Intergenic
1118271819 14:64350508-64350530 AATAAGAGAGGTACAGAAGAGGG + Intergenic
1118609434 14:67528654-67528676 AATGGGATAGGGACAGGAGAGGG - Intronic
1118938562 14:70311137-70311159 AGTGTGAGTGACACAGAAGATGG - Intergenic
1119199833 14:72744145-72744167 AATAATAAAGAAACAGAAGAGGG + Intronic
1119431239 14:74569326-74569348 TATGAGATTCACACAGGAGAAGG + Intronic
1119637762 14:76290695-76290717 AATAAAGTAGACAAAGAAGAGGG + Intergenic
1119871677 14:78023222-78023244 AATGAGACATACACATGAGAGGG + Intergenic
1120077965 14:80181741-80181763 AATGGGTTAGACACAGCTGAAGG + Intergenic
1120084759 14:80258854-80258876 AATGACATAGAAAATGAAGAAGG - Intronic
1120187352 14:81407497-81407519 AAAGAGGTAGACAGGGAAGATGG - Intronic
1120559702 14:85975127-85975149 AGTGTGATCAACACAGAAGATGG - Intergenic
1120625679 14:86823129-86823151 ATTGAGAAAGACACTGAAAATGG - Intergenic
1120643161 14:87039970-87039992 AATGAGATAGACATATAAAAGGG - Intergenic
1121565120 14:94903624-94903646 TATGAGCAGGACACAGAAGAGGG + Intergenic
1121856387 14:97273960-97273982 GATGAGATGAACACACAAGAAGG - Intergenic
1122259252 14:100502728-100502750 AATGAAAGACTCACAGAAGAAGG + Intronic
1123149909 14:106170734-106170756 ACTGTGAGAGACACAGGAGAGGG - Intergenic
1123224858 15:17013660-17013682 AGTGTGAGTGACACAGAAGATGG + Intergenic
1124236216 15:27991463-27991485 AAGAAGCCAGACACAGAAGATGG + Intronic
1124532463 15:30519542-30519564 AAAGAGAGAGAGACAGATGAAGG - Intergenic
1124589929 15:31044373-31044395 AATAAAATAGAAACAGAAAAAGG + Intronic
1124724733 15:32145984-32146006 AACGAGATCAACGCAGAAGATGG - Intronic
1124766190 15:32488103-32488125 AAAGAGAGAGAGACAGATGAAGG + Intergenic
1124948470 15:34293083-34293105 AGCAAGATTGACACAGAAGATGG - Intronic
1125218798 15:37309357-37309379 AGTGTGAGCGACACAGAAGATGG - Intergenic
1125233216 15:37482081-37482103 AAAGAGAGAGAGAGAGAAGATGG + Intergenic
1125269907 15:37927361-37927383 TAAGAGATACACACTGAAGAGGG + Intronic
1125325776 15:38534687-38534709 AAGGCCACAGACACAGAAGAGGG + Intronic
1125663294 15:41411373-41411395 AATGAGATTGGGAGAGAAGAGGG + Intronic
1125779562 15:42252316-42252338 AGCGTGATCGACACAGAAGACGG - Intronic
1126742012 15:51786902-51786924 AGTGAGATCGACGCAGAAGATGG + Intronic
1127016856 15:54698870-54698892 AGCGTGAGAGACACAGAAGACGG + Intergenic
1127231593 15:57001840-57001862 AAGGAGAAAGCCACAGGAGAAGG + Intronic
1127579556 15:60325090-60325112 AATGATAAAGACACTGAAGATGG + Intergenic
1128339900 15:66814068-66814090 AGCGTGATTGACACAGAAGACGG - Intergenic
1128794334 15:70453885-70453907 AATGTGATAGACCCATATGATGG - Intergenic
1128855316 15:71006486-71006508 AGTGATATAGACACAGAATCAGG - Intronic
1128884235 15:71271658-71271680 AATGAGAAAGAAAGAGAAAAGGG - Intronic
1129508056 15:76099468-76099490 AGCGAGGTCGACACAGAAGATGG - Intronic
1129808326 15:78483289-78483311 AATGAGAAAGAGAAAGAACAAGG - Intronic
1129831350 15:78673049-78673071 AATGAGATAGAGACAGAGAGAGG + Intronic
1130046201 15:80446848-80446870 AATGAGACAGAGACAGAGGAAGG - Intronic
1130176818 15:81581630-81581652 AGTGAGATCAACGCAGAAGATGG + Intergenic
1130736427 15:86554960-86554982 ATTTAGATTGACGCAGAAGATGG - Intronic
1130961585 15:88663090-88663112 ACTGAAATAGGCACTGAAGAGGG + Intergenic
1131452207 15:92551953-92551975 AATCAGTTAAACACAAAAGAAGG + Intergenic
1131566447 15:93489983-93490005 AATGAGAGAGAAATAGAAGTAGG + Intergenic
1131571931 15:93546641-93546663 GATGAGACAGACAGAGAACATGG + Intergenic
1132928855 16:2448192-2448214 AATGTTATAGACCCAGAAGGTGG - Intronic
1133443460 16:5839925-5839947 ACTAAGGTAGACAAAGAAGAAGG + Intergenic
1133747320 16:8697054-8697076 AATGAGAAAGAGACAGATAAGGG + Intronic
1133834319 16:9352444-9352466 AAGGAAAGAGACACTGAAGAGGG - Intergenic
1133988388 16:10685639-10685661 GATGAGATAGAGACAGAGAAAGG - Intronic
1134895893 16:17886584-17886606 AATGAGACAGACAGACAGGAGGG - Intergenic
1135043498 16:19135920-19135942 AAAGAGACAGACAAAGATGATGG + Intronic
1135175204 16:20221705-20221727 ATTGAGATAGGCAAAGAACAAGG - Intergenic
1135247154 16:20866861-20866883 AAGGGGGTAGACACAGAAGAAGG - Intronic
1135475984 16:22775401-22775423 AGAGAGAGAGACACAGAGGAAGG + Intergenic
1135667977 16:24351812-24351834 AAAGAGAGAGAGAGAGAAGATGG - Intronic
1135769891 16:25209621-25209643 AAAGAGATAGAAAAGGAAGACGG + Intergenic
1135807458 16:25555889-25555911 AGTGAGATCAACACAGAAGGCGG + Intergenic
1135854016 16:25990129-25990151 AATGTGATACATTCAGAAGATGG - Intronic
1135855126 16:26002674-26002696 AAAGAGATAGAGAAAAAAGAAGG + Intronic
1135861390 16:26059119-26059141 AATGAGACAGAGACAGAACCTGG + Intronic
1136084603 16:27875889-27875911 AATGATACTAACACAGAAGAAGG + Intronic
1136680144 16:31956058-31956080 ACTGTGAGAGACACAGGAGAGGG + Intergenic
1136780486 16:32897602-32897624 ACTGTGAGAGACACAGGAGAGGG + Intergenic
1136889921 16:33962046-33962068 ACTGTGAGAGACACAGGAGAGGG - Intergenic
1137046081 16:35663795-35663817 AGTGAGATTGATGCAGAAGATGG + Intergenic
1137325039 16:47425514-47425536 AGTGAGATCAACGCAGAAGACGG - Intronic
1138712334 16:58983459-58983481 AGTGTGAGCGACACAGAAGACGG - Intergenic
1138861878 16:60768197-60768219 AATGAGATAGTCAAGGAATAAGG + Intergenic
1139025907 16:62817344-62817366 AATGAGATTGATGGAGAAGATGG - Intergenic
1139322782 16:66128999-66129021 AATGAGAGAGTGAGAGAAGAAGG + Intergenic
1139944188 16:70627473-70627495 AAAGAGAAAGAAAAAGAAGAGGG - Intronic
1140564354 16:76023757-76023779 CATGAGAGAGACACACATGAAGG + Intergenic
1140695087 16:77525018-77525040 AGCGTGATTGACACAGAAGATGG + Intergenic
1140767035 16:78169607-78169629 AATCTAATAGAAACAGAAGAAGG - Intronic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1203083113 16_KI270728v1_random:1161568-1161590 ACTGTGAGAGACACAGGAGAGGG + Intergenic
1143254131 17:5543215-5543237 AATGAAATAGCCTCAAAAGAGGG + Intronic
1144336433 17:14274897-14274919 AATCAGCTAAACACAAAAGAAGG - Intergenic
1144404311 17:14938022-14938044 AAGAAGATAGACAAAGGAGATGG + Intergenic
1145305083 17:21669576-21669598 CATGACATAGACACAGGGGAGGG + Intergenic
1145861158 17:28211609-28211631 AGTGAGATTGATGCAGAAGATGG + Intergenic
1145931034 17:28685858-28685880 AATGAAATAGCCACAAAAGGAGG + Intronic
1146145551 17:30412949-30412971 GACAAGATTGACACAGAAGAGGG - Intronic
1146378586 17:32311921-32311943 AATGAAAATGACAGAGAAGAAGG + Intronic
1146983368 17:37187782-37187804 AATATGATAGACACTGATGATGG + Intronic
1148348897 17:46924322-46924344 AATGTGGTAGACACATAAAACGG - Intronic
1148351097 17:46942805-46942827 AATGAAAAGGACACAGAAAATGG - Intronic
1148950268 17:51304992-51305014 AGAGTGATCGACACAGAAGATGG + Intergenic
1148971429 17:51486253-51486275 TATGAGGTGCACACAGAAGAGGG + Intergenic
1149133683 17:53339935-53339957 AGCGTGATCGACACAGAAGACGG + Intergenic
1149178343 17:53902579-53902601 AATTAAATAGACACAAAAAAGGG + Intergenic
1149240078 17:54639241-54639263 AGCGTGATTGACACAGAAGATGG + Intergenic
1149469722 17:56906432-56906454 AAAGAGAAAAACACACAAGAAGG + Intronic
1150459371 17:65334785-65334807 AATGAGATACACACAGGGAATGG - Intergenic
1150647620 17:66989353-66989375 ACGGAGAAGGACACAGAAGATGG + Intronic
1153144323 18:2012759-2012781 AATCAGATAGAGAAAGAAAATGG - Intergenic
1153616121 18:6935735-6935757 ACTGATATAACCACAGAAGATGG - Intergenic
1154181209 18:12141415-12141437 AGTGTGAGCGACACAGAAGACGG - Intergenic
1154186990 18:12192997-12193019 AAATGCATAGACACAGAAGATGG - Intergenic
1154288641 18:13084692-13084714 AGCGTGATTGACACAGAAGATGG - Intronic
1154462312 18:14605052-14605074 GATGAGTTAGAAACAGAAAATGG + Intergenic
1155082068 18:22420214-22420236 AATGCCATAGACACAGAGCAGGG + Intergenic
1155384830 18:25266498-25266520 AATGAGATCAACACAGAAGGCGG + Intronic
1155393316 18:25360291-25360313 AAAGAGAGAGAGAAAGAAGACGG - Intergenic
1155562530 18:27093813-27093835 AGTGTGATTGACACAGAAGATGG - Intronic
1155587614 18:27385567-27385589 AATGAGATACACACATACAATGG - Intergenic
1156279975 18:35627640-35627662 AGTGTGAGCGACACAGAAGACGG + Intronic
1156443913 18:37219897-37219919 AGTGTGATCGACAAAGAAGATGG - Intronic
1156539376 18:37894442-37894464 GATGAGACAGGCAAAGAAGAAGG + Intergenic
1156541081 18:37911150-37911172 AATGAGAAATACCCAAAAGAGGG - Intergenic
1156615967 18:38784480-38784502 AAAGAGAGAGACACTGGAGAAGG + Intergenic
1156979386 18:43266167-43266189 AGTGAGATCAACACAGAAGGTGG - Intergenic
1157410420 18:47458601-47458623 GATGAGAAAGAGAGAGAAGAGGG + Intergenic
1157659487 18:49427276-49427298 AATCAGATAAATACAGAAGATGG + Intronic
1157903248 18:51541386-51541408 GATGAGTTAAACACAGAAAAGGG - Intergenic
1158734026 18:60059151-60059173 AAAGAGAGGGACACAGAGGAGGG - Intergenic
1158942019 18:62413179-62413201 TATGAACTAGACACAGGAGAGGG - Intergenic
1159148846 18:64493806-64493828 AATGAAATGGACACAGAAAATGG + Intergenic
1159273918 18:66191083-66191105 AATGAGAGACACACACAAAAGGG - Intergenic
1159376743 18:67603230-67603252 GAGGAGACAGACACAAAAGAAGG + Intergenic
1159671876 18:71230770-71230792 CATGAGACAGACACAGAATATGG - Intergenic
1159927520 18:74282268-74282290 AATAAGATAGTCACAGAGCAGGG + Intronic
1159927543 18:74282420-74282442 AATAAGATAGTCACAGAGCAGGG + Intronic
1160279614 18:77475532-77475554 AAGTAGCTAGACACAAAAGAAGG + Intergenic
1162826772 19:13257425-13257447 AAAGATATTGACAAAGAAGAAGG + Exonic
1162877798 19:13633798-13633820 AAAGAGAGAGAGACAGAGGAAGG - Intergenic
1163380177 19:16961088-16961110 AGTGTGATTGACACGGAAGATGG + Intronic
1163939954 19:20482490-20482512 AGTGTGATTGACACAGAAGATGG + Intergenic
1164184710 19:22854591-22854613 AGTGAAACAGACACAAAAGAGGG - Intergenic
1164220583 19:23189842-23189864 AATGTGATAGTCACAGATTATGG + Intergenic
1164307714 19:24019410-24019432 AGTGTGAGTGACACAGAAGACGG - Intergenic
1165160422 19:33812665-33812687 ACTGAGATCGTCACAGGAGAAGG + Intronic
1165625797 19:37278610-37278632 CGTGAGAGAGACACAGAAGTCGG + Intergenic
1165627959 19:37288711-37288733 CGTGAGAGAGACACAGAAGTCGG + Intergenic
1166804971 19:45480656-45480678 AAGCAAATAGACACAGAAAATGG - Intergenic
1167126419 19:47552303-47552325 AGTGTGACAGACACAGCAGAAGG + Intronic
1167262124 19:48464700-48464722 AATGGGGTGGAAACAGAAGATGG + Exonic
1167579139 19:50331788-50331810 AAAGAGAGAGACCCAGAAGAAGG - Intronic
1167607389 19:50488696-50488718 CATGAGACAGAAAGAGAAGAGGG + Exonic
1167657810 19:50777623-50777645 CATGAGAGAGAGACAGAACATGG - Intergenic
1167726837 19:51220509-51220531 GATGTGATATACACAGAAGGAGG - Intergenic
1167775616 19:51552903-51552925 ACTGAGATAGACGAAGAAGCAGG + Intergenic
1168058987 19:53880014-53880036 AGAGAGAGAGACACAGAAAAGGG + Intronic
925028985 2:634843-634865 ACTGAGAAAGAGACAGGAGAAGG + Intergenic
925484860 2:4316642-4316664 AAGGAAAGAGACACTGAAGAGGG - Intergenic
925578799 2:5388681-5388703 AATGGGACAGAGACAGAAGGTGG + Intergenic
925848957 2:8061813-8061835 AATGAAATAGTCACAGTCGAGGG - Intergenic
927182699 2:20458353-20458375 AATGAGATCAACGCAGAAGGAGG + Intergenic
927302124 2:21527028-21527050 AGTGTGAGAGACGCAGAAGACGG - Intergenic
927903639 2:26841730-26841752 AATGGAATAGACACAGAACCTGG + Intergenic
928362038 2:30671346-30671368 AATTAAATAGACAGAGAATAAGG + Intergenic
928462590 2:31489137-31489159 AGTGAGATCAACACAGAAGATGG + Intergenic
928759214 2:34561385-34561407 AGTGTGAGTGACACAGAAGATGG - Intergenic
929042799 2:37761798-37761820 AAGGAGATAGAGACAGGAGATGG + Intergenic
930035948 2:47085213-47085235 AATGAGATAGAGGCGGGAGATGG - Intronic
930143101 2:47973571-47973593 AGTGTGATTGACGCAGAAGATGG + Intergenic
930358843 2:50352629-50352651 AAAGGGACAGACTCAGAAGAGGG + Intronic
930471443 2:51820663-51820685 AATAAAATATACACAAAAGAAGG - Intergenic
930535689 2:52643500-52643522 AAGGAGACACACAGAGAAGACGG - Intergenic
930537179 2:52657516-52657538 AGTGAGAAAGAAACAGAAGGGGG + Intergenic
930681435 2:54260738-54260760 AATGAGGTAGACAGAGGATAGGG + Intronic
931210249 2:60187252-60187274 AATATGATAGACATAAAAGAAGG + Intergenic
931229814 2:60364801-60364823 AATGAATTAGACACGGATGATGG + Intergenic
931237954 2:60427676-60427698 AGGGAGACAGAAACAGAAGAGGG + Intergenic
931292891 2:60891835-60891857 AGTGAGATAGACACAGAAGAAGG - Intronic
931475872 2:62586923-62586945 AGTGTGAGTGACACAGAAGATGG - Intergenic
931538564 2:63304331-63304353 AGTGAGATCAACACAGAAGGTGG + Intronic
931545985 2:63388185-63388207 AGTGTGACTGACACAGAAGACGG + Intronic
931594443 2:63926560-63926582 AGCGAGATCGACGCAGAAGACGG + Intronic
932269180 2:70394276-70394298 AGGGAGATTGACCCAGAAGAAGG - Intergenic
932737989 2:74268962-74268984 AATCAGATGGACACAGAATGGGG + Intronic
932939058 2:76140116-76140138 AGTGAGATCAACACAGAAGGTGG - Intergenic
934162967 2:89269858-89269880 AATAAGCTAGACTCAGAAGATGG - Intergenic
934204306 2:89912666-89912688 AATAAGCTAGACTCAGAAGATGG + Intergenic
934617016 2:95778520-95778542 AGTGAGATTGACACAGAAGATGG + Intergenic
934643877 2:96046039-96046061 AGTGAGATTGACACAGAAGATGG - Intergenic
934837294 2:97602133-97602155 AGTGAGATTGACACAGAAGATGG - Intergenic
934928845 2:98403929-98403951 AAGGAAAGAGACACTGAAGAGGG + Intergenic
935604795 2:104959686-104959708 AGCGTGATTGACACAGAAGATGG - Intergenic
935695452 2:105767147-105767169 TATGAGATAAACACAGACGGGGG - Intronic
935701620 2:105817200-105817222 AATGAGATGCAGACAGATGAAGG + Intronic
935791059 2:106590591-106590613 GATGAGAAAGAGAAAGAAGAGGG - Intergenic
935844078 2:107145327-107145349 AGTGTGAGTGACACAGAAGATGG - Intergenic
935884411 2:107600262-107600284 AAAGAGATGGATTCAGAAGAGGG - Intergenic
936162681 2:110096534-110096556 CATGAGAAAGATACAGAGGAGGG + Intronic
936782918 2:116054895-116054917 AGTGTGAGAGACGCAGAAGACGG - Intergenic
936888346 2:117339581-117339603 AATGAGACAGAAACACAAAAGGG + Intergenic
936980419 2:118259641-118259663 AATGAAATAGACTTAGAAGTGGG + Intergenic
937074849 2:119095813-119095835 AGTGTGAGCGACACAGAAGATGG + Intergenic
937577741 2:123444577-123444599 AACCAGAAAGGCACAGAAGAGGG - Intergenic
938153360 2:128905104-128905126 AAAGAGAGAGACACAGAAAGAGG - Intergenic
938600828 2:132837471-132837493 AATGAAAAAGACGCAGTAGAAGG - Intronic
939005618 2:136783443-136783465 ATTGAAATACAAACAGAAGATGG + Intronic
939199876 2:139020239-139020261 AATTAGTTAAACACAAAAGAAGG - Intergenic
939226152 2:139367185-139367207 GAGGAGATAGACACAGATGTTGG + Intergenic
940402680 2:153265591-153265613 AAAGAAATAGACACTAAAGAGGG - Intergenic
940468553 2:154063962-154063984 ATTGAAAGAGGCACAGAAGAGGG + Intronic
940578444 2:155546131-155546153 AAAGAGAAAGACAAAAAAGAAGG + Intergenic
940720808 2:157279887-157279909 AGCGTGATTGACACAGAAGACGG - Intronic
940753696 2:157657810-157657832 AGTGAGGAAGACACAGAAGTTGG - Intergenic
940754600 2:157667675-157667697 AATGAGATAGAGCCTGAATAGGG + Intergenic
941041515 2:160628652-160628674 AGCGAGACTGACACAGAAGATGG - Intergenic
941233471 2:162940459-162940481 AATAAAATATACACAGAAGTTGG - Intergenic
941323130 2:164080464-164080486 AAGGAGCTAGAGACAAAAGAGGG - Intergenic
941827735 2:169918659-169918681 AATCATATAGAAACAGGAGATGG + Intronic
941851945 2:170191747-170191769 ACTGAAAGAGACACTGAAGAGGG - Intronic
942056998 2:172193349-172193371 AGTGTGAGCGACACAGAAGATGG - Intergenic
942567695 2:177282924-177282946 AATGAGAGGGACACATAAGGTGG + Intronic
943768394 2:191688265-191688287 AATGATAAAAACACAGAACAAGG - Intronic
944033935 2:195269776-195269798 AACGTGATCGACACAGAAGATGG - Intergenic
944096565 2:195975184-195975206 ACTGAAAGAGACACCGAAGAGGG + Intronic
944119633 2:196227128-196227150 ACTGTAATAGTCACAGAAGAAGG + Intronic
944402248 2:199341497-199341519 AATGAGACAGAAACAGACGTTGG - Intronic
944472809 2:200072978-200073000 AAAGAGACACAGACAGAAGAAGG - Intergenic
944611785 2:201416876-201416898 AATGAGAAAAAAACGGAAGACGG + Intronic
944693410 2:202179180-202179202 AATCAGATAGACACAGATGCTGG - Intronic
946063416 2:216965765-216965787 AAGGAGAGAGAGAGAGAAGAGGG + Intergenic
946083458 2:217148031-217148053 AATGTGAGAGACACAGAGGAAGG - Intergenic
946133410 2:217625307-217625329 ATTGAGATAGACACAGACCATGG - Intronic
946480030 2:220046292-220046314 AATGAGATAGAACTAAAAGATGG + Intergenic
946933863 2:224699340-224699362 AAAGAAAAAGACAAAGAAGAAGG - Intergenic
947190491 2:227499930-227499952 AATGAAAAAGACACAGGAAAAGG - Intronic
947225953 2:227840080-227840102 AGTGAGATCAACACAGAAGGTGG - Intergenic
947378296 2:229520216-229520238 TCAGAGATAGACACGGAAGAAGG - Intronic
947478979 2:230480112-230480134 GAAGAAATAAACACAGAAGATGG - Intronic
947946628 2:234109299-234109321 AATGAGAAACATACAGAAGAGGG - Intergenic
948310945 2:236986334-236986356 AATGATATGGAGACAGATGAAGG + Intergenic
1168774701 20:438155-438177 CATCAGATGGACACAGAAGGAGG - Exonic
1169170910 20:3464265-3464287 TAGGAGATACACACAGAAGACGG + Intergenic
1169861637 20:10159111-10159133 AGCGAGATCGACACAGAAGATGG + Intergenic
1170283637 20:14680158-14680180 AAGGAGAGAGTCACAGATGAAGG + Intronic
1170366179 20:15600501-15600523 AAAGAGATAGAGAAAGAAGAAGG - Intronic
1170720538 20:18873791-18873813 AGTGAGATCAACAGAGAAGATGG - Intergenic
1171278153 20:23876052-23876074 CAGGAGACAGACACAGAAGGTGG - Exonic
1171314433 20:24176595-24176617 AATGAGATTGTCACTAAAGATGG - Intergenic
1171483744 20:25472219-25472241 AATGTGATACAGACAGAAGATGG + Intronic
1171530344 20:25849005-25849027 CATGACATAGACACAGGGGAGGG + Intronic
1171804069 20:29658665-29658687 AATGCCCAAGACACAGAAGAAGG + Intergenic
1171923902 20:31173138-31173160 AATGAAATGGACTCAAAAGAAGG + Intergenic
1171998129 20:31749287-31749309 AATGGAATAGACACCGAAGGTGG - Intronic
1172531283 20:35632870-35632892 AATGAGATGGTCACAGGAAATGG + Exonic
1172900194 20:38329122-38329144 AAGGAGACAGACACAAAGGAAGG + Intronic
1173044217 20:39493946-39493968 AGAGAGATAGACAGAGGAGAAGG + Intergenic
1174224134 20:48983064-48983086 AGTGTGATCGACGCAGAAGACGG - Intronic
1174506622 20:51021678-51021700 AATGACAGACACATAGAAGAGGG - Intronic
1175031741 20:55961568-55961590 AATGAGACTGAAACAGATGAGGG + Intergenic
1176317240 21:5257627-5257649 AGTGTGAGTGACACAGAAGACGG - Intergenic
1176812197 21:13553315-13553337 GATGAGTTAGAAACAGAAAATGG - Intergenic
1176917043 21:14638048-14638070 AAAGAGAAAGACACACCAGAAGG - Intronic
1176952392 21:15064066-15064088 AATAAGGTGGACACAGAAGAAGG + Intronic
1177092049 21:16781581-16781603 AGTGAGATCAACACAGAAGGTGG + Intergenic
1177132081 21:17271357-17271379 AGTGTGAGCGACACAGAAGATGG + Intergenic
1178007019 21:28233796-28233818 AGTGAGATCAACACAGAAGATGG + Intergenic
1178496557 21:33090893-33090915 AGTGAGAAAGACAGAGAGGAAGG + Intergenic
1179026386 21:37682544-37682566 TATAAGAGACACACAGAAGAAGG - Intronic
1179029522 21:37708450-37708472 AATGAGATAGACATATTGGAAGG + Intronic
1180735401 22:18012668-18012690 GTTGTGATACACACAGAAGATGG - Intronic
1181857691 22:25793922-25793944 AAAGAGAGAGACAAAGAATATGG - Intronic
1181921450 22:26323604-26323626 AAAGAGAGAGACAGAGAAGGTGG + Intronic
1182091557 22:27598768-27598790 AATGAGATAGACCAAGATGGGGG + Intergenic
1183114727 22:35682010-35682032 AATGTGATAGAGGCAGGAGATGG - Intergenic
1184392195 22:44210315-44210337 TATAAGAGAGACACAGAGGAGGG - Intronic
1184954419 22:47874802-47874824 AAAGAGATAAAGACAGAAAAAGG - Intergenic
1185302425 22:50089406-50089428 AACCAGACAGACACAGAAAACGG + Intergenic
1203294986 22_KI270736v1_random:33289-33311 AAGGGGATAGAGACAGGAGATGG + Intergenic
949112131 3:273993-274015 AATGAAATAGACTCAGCAGCAGG + Intronic
949456690 3:4246329-4246351 AGCGAGATTGACACAGAAAACGG - Intronic
949632629 3:5944644-5944666 AGTGTGTTTGACACAGAAGATGG - Intergenic
949791712 3:7799870-7799892 TTTGAAAGAGACACAGAAGAGGG - Intergenic
950701329 3:14751295-14751317 AGTGAGATTGACATAGAAGATGG + Intronic
951029417 3:17864236-17864258 ACTGAAAGAGACACTGAAGATGG - Intronic
951299943 3:20983947-20983969 AAAGAGATAGAGACAGAAGGAGG + Intergenic
951777353 3:26324470-26324492 ACTGAGATCAACACAGAAGGTGG - Intergenic
951811694 3:26707687-26707709 CATGAGAAAAACACAGGAGATGG - Intronic
952550625 3:34472299-34472321 AGTGTGATCAACACAGAAGATGG - Intergenic
952943495 3:38460379-38460401 AATGTAATAGAGTCAGAAGAAGG - Intronic
953112169 3:39953607-39953629 AGTGTGAGCGACACAGAAGACGG + Intronic
953466682 3:43127846-43127868 AATTAGATAGACAAGGAAGTTGG + Intergenic
953728609 3:45425102-45425124 AATAAGATAGAAAAACAAGAAGG - Intronic
954500849 3:51012722-51012744 AGTGTGAGCGACACAGAAGACGG - Intronic
954836559 3:53474011-53474033 AGCGTGATCGACACAGAAGATGG - Intergenic
955008717 3:54993703-54993725 AATCAGATAGACAAAGAACAAGG - Intronic
955652604 3:61210881-61210903 AGTGTGAGCGACACAGAAGATGG - Intronic
955715159 3:61821682-61821704 AAAGAGATATAAACAGTAGAGGG + Intronic
955816795 3:62852354-62852376 AGTGTGAGCGACACAGAAGACGG - Intronic
955839829 3:63100113-63100135 AGAGAGAGAGACACTGAAGAAGG - Intergenic
956316857 3:67947860-67947882 AGCGAGATTGACACAGAAGATGG + Intergenic
956396680 3:68833260-68833282 AGCGAGATTGACACAGAAGATGG - Intronic
956715933 3:72080036-72080058 AATGAGAAAGAGAGAAAAGAGGG - Intergenic
956741044 3:72276407-72276429 AGCGAGATTGACGCAGAAGACGG + Intergenic
957038604 3:75318088-75318110 AATGACATTGACACATAGGAAGG + Intergenic
957294607 3:78321317-78321339 AATGAGATGGATACAGATGAGGG + Intergenic
957312162 3:78534556-78534578 AATGAGAAAGGCACAAAAGAGGG + Intergenic
957327274 3:78712281-78712303 AATGAGCTATACACAAAACACGG + Intronic
957348954 3:78998351-78998373 AAGCAGGTAGACACAGAACATGG - Intronic
957810600 3:85215994-85216016 AAGGAAAGAGACACTGAAGAGGG - Intronic
957917924 3:86709435-86709457 AGTGAGATGGATACGGAAGATGG - Intergenic
958036933 3:88181996-88182018 GGTGAGATCAACACAGAAGATGG + Intergenic
958083297 3:88774409-88774431 AAGGAAAGAGACACTGAAGAGGG + Intergenic
958135142 3:89479025-89479047 AATAGGATACACAGAGAAGAAGG - Intronic
958618424 3:96526714-96526736 AGTGTTATAGACGCAGAAGATGG + Intergenic
958724336 3:97886167-97886189 AATTAGATAAACACTGAAGAGGG + Intronic
958742959 3:98096492-98096514 AGTGAGATGGACACAGAAGATGG - Intergenic
958828920 3:99064748-99064770 AGTGTGAGCGACACAGAAGATGG - Intergenic
958896407 3:99834674-99834696 AATGAGAAAGACACAGGAGAGGG - Intronic
959059833 3:101605877-101605899 AGTGAGATTGACATAGAAGATGG - Intergenic
959100841 3:102008254-102008276 AACGTGAGCGACACAGAAGACGG + Intergenic
959170896 3:102842357-102842379 AGTGAGATTGACACAGAAGATGG - Intergenic
960330372 3:116352329-116352351 AATGAGATAGATTCAGAGCATGG + Intronic
960378222 3:116928679-116928701 AGTGAGATCAACTCAGAAGACGG - Intronic
960478744 3:118162651-118162673 AGTAAGATCGACGCAGAAGATGG + Intergenic
960612785 3:119570373-119570395 AATGAAATAGAAACTGAAAAGGG - Intergenic
960631361 3:119734723-119734745 AATGAGAAAGAAAAACAAGAAGG - Intronic
960752211 3:120967367-120967389 AGTGTGATTGACACAGAAGATGG - Intronic
960763420 3:121097706-121097728 AGCGAGATCGACACAGAAGGTGG - Intronic
960851136 3:122055877-122055899 AATGAGATAGAGAAGGTAGAGGG + Intronic
960913135 3:122669063-122669085 AGCGTGATAAACACAGAAGATGG - Intergenic
961206230 3:125084057-125084079 AGTGAGAGAGACACAGAGGATGG + Intronic
961998341 3:131269621-131269643 AGTGAGATCAACACAGAAGGCGG - Intronic
962038912 3:131684071-131684093 ACTGAGAGAGACACTGAAGAGGG - Intronic
962163685 3:133026408-133026430 AGTGAGAGAGACACAGATTATGG - Intergenic
962446317 3:135469098-135469120 AATCAGATAGTCACAGAAGCAGG + Intergenic
962460128 3:135604284-135604306 AACGTGAGTGACACAGAAGATGG + Intergenic
962882415 3:139591007-139591029 AGTGAGAGCGACACAGAAGACGG + Intronic
963932201 3:151015024-151015046 AGTGAGAAATACGCAGAAGAAGG - Intergenic
964269964 3:154945208-154945230 AGTGTGATTGATACAGAAGATGG + Intergenic
964468784 3:157029390-157029412 AATGAGGAAGAGACTGAAGAAGG + Intronic
964730609 3:159860798-159860820 GATGAGAAAGGCACAGAAGTGGG - Intronic
964782778 3:160359419-160359441 AGTGTGATCGACACAGAAGACGG + Intronic
965338716 3:167459563-167459585 AACTAGATATACACAAAAGAGGG + Intronic
965893242 3:173540778-173540800 AAGGAGCTAAACACAGAAGCAGG - Intronic
966230814 3:177649375-177649397 ACGGAGGTAGACACAGAAGGAGG + Intergenic
966299291 3:178460978-178461000 AATGAGAGAGAAACAAAAGCAGG - Intronic
966742441 3:183246547-183246569 AATGTGGTAGACACATAAAATGG - Intronic
967383586 3:188887312-188887334 AAAGAGAAAGAGAGAGAAGAAGG - Exonic
967659708 3:192091638-192091660 AGTGAGAGAGAAACAGAACAGGG + Intergenic
968276493 3:197444342-197444364 ACTGAGATAGCCACAGTAGGAGG + Intergenic
968818083 4:2832027-2832049 AGTGAGAGGGACACAGAAGCAGG - Intronic
970000647 4:11362775-11362797 CATGAGATACACAAAGGAGAGGG + Intergenic
970182772 4:13416812-13416834 AGTGTGATCAACACAGAAGATGG + Intronic
970496208 4:16628677-16628699 AGCGAGATAGACGCAGAAGATGG + Intronic
970721661 4:18996068-18996090 CATGAGATAGAGAGAGAAAATGG - Intergenic
970975785 4:22041257-22041279 AGCGTGATCGACACAGAAGATGG - Intergenic
971523479 4:27585603-27585625 AGAGAGATACAAACAGAAGAAGG + Intergenic
971560694 4:28077010-28077032 AGTGTGATCGACGCAGAAGATGG + Intergenic
971661500 4:29422221-29422243 GATGAGAAAGAAACAGGAGATGG + Intergenic
971883143 4:32409131-32409153 AGTGAGATCAACACAGAAGGTGG + Intergenic
972195782 4:36652208-36652230 AATGACTTAGACATAGCAGATGG + Intergenic
972435831 4:39034660-39034682 AATTGGATAGACAAAGAATATGG + Intergenic
972751412 4:41992544-41992566 AATGACAGCTACACAGAAGAGGG - Intronic
973142350 4:46784004-46784026 GATGAGATATACACAGACAATGG - Intronic
973171350 4:47147866-47147888 GATAAGATAGAGACAGAGGAAGG + Intronic
973177815 4:47229726-47229748 AAAGAGACACACAGAGAAGATGG + Intronic
973272905 4:48279662-48279684 AGTGAGATCAACACAGAAGGTGG + Intergenic
973871398 4:55170172-55170194 AGCGAGATCGACACAGAAGATGG - Intergenic
973884663 4:55307946-55307968 CATAAGAGAGACCCAGAAGAGGG - Intergenic
974023619 4:56712690-56712712 AGTGTGAATGACACAGAAGATGG + Intergenic
974264077 4:59560997-59561019 AGCGAGATTGACACAGAAGGTGG - Intergenic
974413334 4:61570901-61570923 ACTGAAATAAACACAGAAGTAGG - Intronic
974515469 4:62902545-62902567 AAAGAGAGAGAGAAAGAAGAAGG + Intergenic
974835014 4:67237798-67237820 AATGAAGTTGACACAGAAAAAGG + Intergenic
974868073 4:67604288-67604310 AAGGAAAGAGACACTGAAGAGGG - Intronic
975371069 4:73588820-73588842 AATGAAATAGATACAGATGCTGG - Intronic
975434126 4:74331422-74331444 CATGAGAGAGACAGAGAAGTGGG + Intergenic
975521048 4:75301056-75301078 AGTGTGATCAACACAGAAGATGG - Intergenic
975695662 4:77010295-77010317 AATGAGATAGTTATAGAGGATGG - Intronic
975807343 4:78126470-78126492 AGTGAGATTGACGCAGAAGATGG - Intronic
975969072 4:80012133-80012155 AATGAAACAGACACAGAACGGGG + Intronic
976163139 4:82225150-82225172 AAGGGAATAGACAGAGAAGAAGG - Intergenic
976363874 4:84211721-84211743 AGTGATATAGACACACAACACGG + Intergenic
976364424 4:84217406-84217428 AAAGAGAATGACAAAGAAGAAGG - Intergenic
976580572 4:86730873-86730895 AGTGTGATCGACACAGAAGACGG - Intronic
976817846 4:89171232-89171254 AATGAGACAAAGACAGCAGAAGG - Intergenic
977659363 4:99564974-99564996 GATGAGGAAGAAACAGAAGAGGG - Intronic
977986070 4:103385143-103385165 ACTGAGATCAACACAGAAGGTGG + Intergenic
978078984 4:104568551-104568573 AGTGAGATCAACACAGAAGGTGG - Intergenic
978237023 4:106471972-106471994 AGTGAGATCGACAGAGAAGGCGG - Intergenic
978251988 4:106641779-106641801 AATGAGAAAAACAGAGAGGAGGG - Intergenic
978287686 4:107098217-107098239 ACTGAAAGAGGCACAGAAGAGGG + Intronic
978418361 4:108503174-108503196 AACGTGAGTGACACAGAAGATGG + Intergenic
978512231 4:109533242-109533264 ATTTGGATAGCCACAGAAGAGGG + Intronic
978552228 4:109939609-109939631 AGCAAGATTGACACAGAAGATGG - Intronic
978591321 4:110327881-110327903 AGTGTGAGCGACACAGAAGACGG - Intergenic
978896192 4:113890222-113890244 AGCGAGATCGACATAGAAGACGG + Intergenic
979115182 4:116814865-116814887 AGTGAGATAGACGCAGAAGGAGG + Intergenic
979310466 4:119197731-119197753 ACTGTGATCGACACAGAAGATGG + Intronic
979510751 4:121550748-121550770 AGAGGGATCGACACAGAAGATGG - Intergenic
979581293 4:122364753-122364775 AGCGAGACTGACACAGAAGAGGG + Intergenic
979810494 4:125030225-125030247 CCTCAGAAAGACACAGAAGATGG - Intergenic
980260628 4:130442954-130442976 AACGAGATTGACACACAAGACGG - Intergenic
980558782 4:134443215-134443237 AGCGAGATGGACACAGAAGACGG - Intergenic
980583737 4:134786998-134787020 AGTGAGATCAACACAGAAGGTGG - Intergenic
980899068 4:138887366-138887388 AGTGTGAGCGACACAGAAGACGG - Intergenic
981199623 4:141965753-141965775 AGCGAGATCGACATAGAAGACGG + Intergenic
982473305 4:155820317-155820339 AAAGAGAGAGAAAGAGAAGAAGG - Intergenic
982678911 4:158406973-158406995 ACAAAGATGGACACAGAAGAAGG + Intronic
982744865 4:159095845-159095867 AAGAAGAAAAACACAGAAGATGG + Intergenic
982934788 4:161459069-161459091 AACTAGATAGGCACAGAAAAAGG - Intronic
983364704 4:166770261-166770283 AGTGTGAGCGACACAGAAGATGG - Intronic
984509906 4:180666872-180666894 AATGAAATAGAGAGAGATGAAGG - Intergenic
985367417 4:189246089-189246111 AGTGAGATTGATGCAGAAGACGG - Intergenic
986323134 5:6649826-6649848 AGCGAGATCGACACAGAAGGTGG - Intronic
986656431 5:10017114-10017136 AGCGAGATCAACACAGAAGAAGG - Intergenic
986749145 5:10770413-10770435 GATGAGATAGACACTGAAATGGG + Intergenic
986796754 5:11220097-11220119 CATGAGAGAAAAACAGAAGAGGG + Intronic
987517048 5:18924083-18924105 AATGAGAGAGAGAAAGAAGAAGG + Intergenic
987519443 5:18960585-18960607 AATGAGATATACAATGAATAAGG - Intergenic
987603440 5:20102725-20102747 AAAGAAATAGAGACAGAAGGAGG + Intronic
987696018 5:21333378-21333400 AAAAAAATAGACACAGATGAAGG - Intergenic
987715658 5:21566445-21566467 AATGTGATATACACATAAAATGG - Intergenic
987812516 5:22856556-22856578 AAGGATATATACACAGAAGTGGG - Intergenic
988756183 5:34253233-34253255 AAAAAAATAGACACAGATGAAGG + Intergenic
989008076 5:36837695-36837717 AATGAGATAGAAAGAGATGTTGG - Intergenic
989072128 5:37522546-37522568 AGTGTGAGTGACACAGAAGATGG + Intronic
989349973 5:40474824-40474846 AGTGTGATCGATACAGAAGATGG - Intergenic
989358133 5:40567455-40567477 AGTGAGATTGACGCAGAAGATGG - Intergenic
989407664 5:41079355-41079377 AGTGACAGCGACACAGAAGATGG - Intergenic
989418182 5:41205300-41205322 AGTGTGAGAGACACAGAAGATGG + Intronic
989828460 5:45887188-45887210 AGTGTGAGTGACACAGAAGATGG - Intergenic
990071811 5:51791225-51791247 AGTGTGAGAGACGCAGAAGATGG - Intergenic
990077460 5:51867447-51867469 AATGTGCTAGATACAGCAGATGG - Intergenic
990367031 5:55081429-55081451 AGTGTGAGTGACACAGAAGACGG - Intergenic
990838663 5:60050318-60050340 AGTGAGAGCGTCACAGAAGACGG - Intronic
990863821 5:60358296-60358318 AATGAGATAGAAGCAAAACATGG + Intronic
990898865 5:60728894-60728916 AGTGAGATCGACACAGAAGACGG + Intergenic
991151405 5:63375739-63375761 AGTGAGATTGGCGCAGAAGATGG + Intergenic
991161283 5:63507018-63507040 AGCGAGATTGACACAGAAGGCGG + Intergenic
991223481 5:64242837-64242859 AATAAGATGAACACAGAAGGTGG + Intronic
991243513 5:64485063-64485085 AGCGTGATCGACACAGAAGATGG - Intergenic
991395428 5:66199395-66199417 ACTGAAAGAGACACTGAAGAGGG - Intergenic
991425031 5:66482101-66482123 AGTGTGATCGACACAGAAGACGG + Intergenic
991438468 5:66620713-66620735 AGAGAGATAGACACAGAGGCAGG - Intronic
991535667 5:67666907-67666929 AGTGTGAGTGACACAGAAGATGG - Intergenic
991605309 5:68395100-68395122 AAGGACATAGAGACAGGAGAGGG - Intergenic
992127940 5:73661688-73661710 AAGGAGAGAGGCAGAGAAGAGGG + Intronic
992154717 5:73943758-73943780 AATGAGAGAGATACAGAGGTTGG - Intergenic
992438626 5:76779028-76779050 AATGAGGAAGTCATAGAAGAGGG + Intergenic
992516654 5:77500949-77500971 AGCGTGATTGACACAGAAGATGG + Intronic
992634000 5:78709809-78709831 AGTGTGAGCGACACAGAAGACGG + Intronic
992756419 5:79911038-79911060 AGCAAGATGGACACAGAAGATGG + Intergenic
993026577 5:82653895-82653917 ACTGAAAGAGACACTGAAGAGGG - Intergenic
993040690 5:82811112-82811134 TATGACATAGACAAAGAACAAGG - Intergenic
993069072 5:83135286-83135308 AGTGTGAGCGACACAGAAGATGG - Intronic
993113777 5:83693399-83693421 AAGAAGATAGAAAAAGAAGAGGG + Intronic
993266384 5:85731912-85731934 AGTGAGATCAACACAGAAGATGG + Intergenic
993269119 5:85770539-85770561 AAGGAAAGAGACACTGAAGAGGG - Intergenic
993577578 5:89621587-89621609 AGTGTGAGCGACACAGAAGATGG + Intergenic
994120681 5:96109178-96109200 AGTGTGAGCGACACAGAAGACGG - Intergenic
994160265 5:96549466-96549488 AGTGAGATTGACACAGAAGATGG + Intronic
994230612 5:97307036-97307058 AGTGTGAGTGACACAGAAGACGG - Intergenic
994279103 5:97878674-97878696 AAGAAAATAGAGACAGAAGAAGG - Intergenic
994474963 5:100255879-100255901 AATGAAAAACACACAAAAGAAGG + Intergenic
994548596 5:101203991-101204013 AATGAGGAAGACACAAAAGTGGG - Intergenic
994595220 5:101824030-101824052 AATGAGATAGTCACATATCATGG - Intergenic
994871423 5:105354145-105354167 AAAGAAAGACACACAGAAGAGGG - Intergenic
995459706 5:112390120-112390142 AGCGTGATCGACACAGAAGACGG + Intronic
995480257 5:112586083-112586105 AGTGAGATCGACACAGAAGGCGG + Intergenic
995644490 5:114295779-114295801 AGTGTGAGCGACACAGAAGATGG - Intergenic
996618176 5:125467186-125467208 AATGTGAAACACAAAGAAGAAGG - Intergenic
996714006 5:126571843-126571865 AATGCCACAGACACAAAAGAAGG + Intronic
997089451 5:130840466-130840488 AAGCAGATAGACCCAGAAGTGGG + Intergenic
997115786 5:131124368-131124390 AGTGAGATTGATGCAGAAGACGG - Intergenic
997187741 5:131898995-131899017 AGCGTGATCGACACAGAAGATGG - Intronic
997246024 5:132349839-132349861 AGTGTGATCGACGCAGAAGACGG - Intergenic
998507857 5:142686400-142686422 AGGGAGGTAGAGACAGAAGACGG + Intronic
998616477 5:143745784-143745806 TATGATATAGTCACAGGAGAGGG + Intergenic
998760287 5:145424676-145424698 AGTGTGAGCGACACAGAAGACGG - Intergenic
999275762 5:150329039-150329061 AATGAGCTTGACACAAAAGCAGG - Intronic
999510232 5:152242477-152242499 AAAAAGATGGAGACAGAAGATGG - Intergenic
999523358 5:152375991-152376013 AATGGGACAGACAGTGAAGAAGG + Intergenic
999542284 5:152586770-152586792 AATGTGAGCGACACAGAAGATGG + Intergenic
999849620 5:155524021-155524043 ACTGAAAGAGACACTGAAGAGGG - Intergenic
999958355 5:156726647-156726669 AAGGAGAAAGAAACAGGAGATGG - Intronic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1000540385 5:162531607-162531629 AGTGTGAGCGACACAGAAGACGG - Intergenic
1000576951 5:162986754-162986776 TATGAGATGGACACTGTAGATGG - Intergenic
1000591558 5:163165099-163165121 AGTGTGATTGACACAGAAGGTGG + Intergenic
1000731454 5:164838930-164838952 ACACAGAAAGACACAGAAGAAGG - Intergenic
1000860523 5:166450920-166450942 AGTGAGATCAACACAGAAGGTGG - Intergenic
1001037299 5:168306453-168306475 AAGAAGATAGGCATAGAAGAGGG - Intronic
1001045575 5:168368946-168368968 AATGGGGTAGACACAGGTGATGG - Intronic
1002438326 5:179248281-179248303 AATGTGTTAAACACAAAAGAAGG + Intronic
1002996018 6:2286290-2286312 AGTGAGAGAGACGCAGAAGGCGG + Intergenic
1003225829 6:4204572-4204594 AGTGTGAGCGACACAGAAGACGG - Intergenic
1003558560 6:7162229-7162251 AATGAGATAAAGACAGTAGATGG - Intronic
1003714240 6:8628621-8628643 AAAGAGACAGAAAGAGAAGAAGG - Intergenic
1003730942 6:8823818-8823840 AATGAGCCAGACACACAAAAAGG - Intergenic
1004225731 6:13782717-13782739 AAGGAGAGAGACACATGAGAAGG + Intergenic
1004247475 6:13993668-13993690 AAAGAGAGAGAGAGAGAAGAAGG - Intergenic
1004748367 6:18535836-18535858 CATGACATACAGACAGAAGAAGG + Intergenic
1004933251 6:20482372-20482394 ATAGAGAAAGACAGAGAAGATGG - Intronic
1005122905 6:22410461-22410483 AATGAGATAAAAACTTAAGATGG - Intergenic
1005279872 6:24262065-24262087 AAGGAGAAAGGCACTGAAGATGG + Intronic
1005329540 6:24736260-24736282 ACAGAGATACACAGAGAAGAAGG + Intergenic
1005554768 6:26964677-26964699 AAAAAAATAGACACAGATGAAGG + Intergenic
1005662912 6:28018505-28018527 AATGAGAGACAAACAGGAGATGG - Intergenic
1006710926 6:36070374-36070396 AAGGAAATAGAGACAGAATAAGG - Intronic
1007241013 6:40425220-40425242 AAGGAGAGAGACCCTGAAGATGG - Intronic
1008123204 6:47641189-47641211 AGTGTGAGCGACACAGAAGACGG - Intergenic
1008407698 6:51136831-51136853 AATGAGATCAACACAGAAGATGG - Intergenic
1008963179 6:57287848-57287870 AGCAAGATTGACACAGAAGACGG + Intergenic
1009001068 6:57715600-57715622 AATGTGATATACACATAAAATGG + Intergenic
1009189632 6:60614502-60614524 AAGGAGATAGAAAAAGAAGCTGG + Intergenic
1009289995 6:61869612-61869634 AGCGAGATTGACGCAGAAGACGG + Intronic
1009679668 6:66875336-66875358 AGCGTGATTGACACAGAAGATGG - Intergenic
1009824645 6:68851234-68851256 AAAGAGAGAGAGACAGAAGGAGG - Intronic
1010102550 6:72126056-72126078 AGTGAGATCGACACAGAAGATGG - Intronic
1010171881 6:72984780-72984802 AGTGTGATCGACACAGAAGACGG - Intronic
1010174254 6:73008156-73008178 AATGAACTAAACACAAAAGAAGG + Intronic
1010837836 6:80612171-80612193 AACGAGATTGACACAGAAGATGG + Intergenic
1011010540 6:82698747-82698769 AAGGAAATAGATACAGAACATGG + Intergenic
1011081571 6:83495712-83495734 AATGTGAGCGACTCAGAAGACGG + Intergenic
1011332844 6:86228757-86228779 AGTGAGATCAACACAGAAGGTGG - Intergenic
1012471862 6:99581350-99581372 ATTGACATAGAAAAAGAAGAAGG + Intergenic
1012481966 6:99676877-99676899 AATGTGAGCAACACAGAAGATGG - Intergenic
1012585305 6:100914202-100914224 AGCGAGATTGACGCAGAAGACGG - Intergenic
1012597938 6:101062052-101062074 AGTGAGATTGACTCAGAAGATGG + Intergenic
1012878370 6:104756618-104756640 AGCGAGACTGACACAGAAGATGG + Intronic
1012933180 6:105338468-105338490 AGTGTGAGTGACACAGAAGACGG + Intronic
1013037894 6:106404630-106404652 AGTGAGATCAACACAGAAGGTGG + Intergenic
1013168449 6:107615221-107615243 AAGGACATAAACACAGAGGAAGG + Intronic
1013787911 6:113802862-113802884 AAAGAGAAAGAAAAAGAAGAAGG + Intergenic
1013995149 6:116299642-116299664 AAAGAGATAGAGATAGATGATGG + Intronic
1014017946 6:116555704-116555726 ACTGAGACAGTCACAGAAGATGG - Intronic
1014184603 6:118421075-118421097 AGTGAAATTGACACAGAAGATGG + Intergenic
1014235848 6:118953720-118953742 AATGAAATGGTCAGAGAAGATGG + Intergenic
1014362205 6:120493102-120493124 AATGAAATAGAAACAGCATATGG - Intergenic
1014378632 6:120711003-120711025 ACTGAAATAGGCACAGAAGAGGG + Intergenic
1014538224 6:122642562-122642584 AATGGGATAGAGTGAGAAGAGGG - Intronic
1015049356 6:128820155-128820177 AATGAGAGAGCCACAGAAAAGGG + Intergenic
1015132983 6:129835478-129835500 AGTGAGATCGACGCAGAAGATGG + Intronic
1015672367 6:135705005-135705027 AAGGAGAGAGAGAGAGAAGAGGG + Intergenic
1016006064 6:139090497-139090519 AGTGTGATTGACGCAGAAGATGG - Intergenic
1016062960 6:139649300-139649322 AATGAGAGAGACAGAGAAAGAGG + Intergenic
1016097955 6:140061255-140061277 AATAAGATGGAGACAGAGGATGG + Intergenic
1016290324 6:142522044-142522066 AAAGAGAGAGACAGTGAAGAAGG + Intergenic
1016334820 6:142993793-142993815 AGCGAGATCGACGCAGAAGATGG + Intergenic
1016338623 6:143035597-143035619 AGTGAGATCGATGCAGAAGATGG - Intergenic
1016580998 6:145629275-145629297 AATCAGATATACATAGAAGCTGG - Intronic
1017279584 6:152609042-152609064 AGAGTGATCGACACAGAAGACGG + Intronic
1017307313 6:152934060-152934082 AGTAAGATAGAGAAAGAAGAAGG - Intergenic
1017539107 6:155381808-155381830 AATGAGACAAATACAGAAGGAGG - Intergenic
1017659875 6:156663556-156663578 AGTGTGATCAACACAGAAGATGG + Intergenic
1018078431 6:160237582-160237604 AATGAAAAAGTTACAGAAGATGG + Intronic
1020391520 7:7662707-7662729 AGTGAGATCAACACAGAAGGCGG - Intronic
1020574949 7:9914113-9914135 ACTGAGAGAGACACTGAAAAGGG - Intergenic
1020635878 7:10695639-10695661 AGTGAGATTGACGCAGAAGGCGG + Intergenic
1020736150 7:11950913-11950935 ACTGAGGAAGACACAGAAGCTGG - Intergenic
1020874369 7:13674410-13674432 AGTGAGATCAACACAGAAGGTGG - Intergenic
1021182669 7:17526044-17526066 AATGAGATGTACACAGAAATGGG + Intergenic
1021282751 7:18740338-18740360 TCTGTGATTGACACAGAAGATGG - Intronic
1021342340 7:19480080-19480102 AGTGTGAGTGACACAGAAGATGG - Intergenic
1021361546 7:19719179-19719201 AAAGAGACAGTCACAGACGAAGG - Intergenic
1021489366 7:21201975-21201997 AACGACATAAACACAGAAGTTGG + Intergenic
1021765740 7:23947216-23947238 AGTGTGAGTGACACAGAAGACGG + Intergenic
1023034653 7:36119999-36120021 AACGAGATCGATGCAGAAGACGG + Intergenic
1023569005 7:41553215-41553237 AGCGTGATGGACACAGAAGATGG - Intergenic
1024106200 7:46089018-46089040 AGTGAGATCGACACAGAAGACGG - Intergenic
1024421409 7:49171179-49171201 AAGGAGACAGAAACAGAAGCAGG + Intergenic
1024462077 7:49669415-49669437 AATGCAATAGACACAAAAGTGGG + Intergenic
1024799392 7:53058486-53058508 ATTGAGAGAGACATAGAAAATGG - Intergenic
1024898058 7:54283098-54283120 AATGAGAAAGCCACAGAAAAGGG + Intergenic
1024960189 7:54966349-54966371 ATTGAGATAGATACAAAACAGGG + Intergenic
1025595208 7:62914913-62914935 AGTGTGAGGGACACAGAAGACGG - Intergenic
1025783555 7:64623192-64623214 AATGTGCTAGGCACAGAATATGG + Intergenic
1026157867 7:67843053-67843075 AATGAGAAGGACAAAGGAGAAGG + Intergenic
1026244662 7:68608433-68608455 AAGGAGACAGACACAAAAGATGG + Intergenic
1026508546 7:71007690-71007712 AATGAAAGAGACACTGAGGAGGG - Intergenic
1027447446 7:78290532-78290554 AATGAGACAGAAAGAGAACAAGG + Intronic
1027574444 7:79915121-79915143 AGCGTGATCGACACAGAAGATGG + Intergenic
1027604749 7:80287199-80287221 ACTGAAAGAGGCACAGAAGAGGG + Intergenic
1027629863 7:80589918-80589940 AAGGAGACAGACACAGTATATGG + Intronic
1027790293 7:82633145-82633167 AGTGAGATCAACACAGAAGGTGG + Intergenic
1027826080 7:83118426-83118448 AAGGAAAGAGGCACAGAAGAGGG + Intronic
1028140100 7:87263915-87263937 AGCGAGATTGACACAGAAGATGG - Intergenic
1028297715 7:89155955-89155977 AAAGAGAGAGAGACAGAGGAGGG - Intronic
1028340873 7:89718756-89718778 AGTAAGATTGACGCAGAAGATGG + Intergenic
1028396090 7:90369888-90369910 AGCAAGATCGACACAGAAGATGG - Intronic
1028413072 7:90551600-90551622 AGCAAGATTGACACAGAAGACGG - Intronic
1028652941 7:93170804-93170826 AGTGAGATGGACGCAGAAGGTGG - Intergenic
1029017384 7:97328326-97328348 AGCGTGATTGACACAGAAGATGG + Intergenic
1029313097 7:99686071-99686093 AGTGTGAGTGACACAGAAGACGG + Intronic
1030966172 7:115995670-115995692 ACTGAGAGAGACACTGGAGAAGG + Intronic
1030996983 7:116371303-116371325 AGTGTGAGCGACACAGAAGACGG + Intronic
1031091368 7:117359337-117359359 AATAATGTAGACAAAGAAGAAGG - Intergenic
1031152668 7:118072858-118072880 AAGGAGAGGGACACAAAAGAGGG - Intergenic
1031837988 7:126702328-126702350 AATGAGGTTGAAACAGATGATGG - Intronic
1031904990 7:127451013-127451035 AGCGTGATTGACACAGAAGACGG + Intergenic
1032313361 7:130809856-130809878 AAAGAGATAGAAAAATAAGAGGG + Intergenic
1032411165 7:131694101-131694123 AAAGAGACAGAAACAGACGAGGG + Intergenic
1032604164 7:133330844-133330866 AGTGAGATCGACGCAGAAGAAGG - Intronic
1032650994 7:133878389-133878411 AATCAGACAAATACAGAAGATGG - Intronic
1032837178 7:135685132-135685154 AAAGAGGTAGCCACAGAAAATGG - Intronic
1033587926 7:142788012-142788034 AAGGAGAAGGTCACAGAAGAGGG + Intergenic
1034371836 7:150605649-150605671 ACTGTGAGTGACACAGAAGATGG + Intergenic
1034673965 7:152878315-152878337 CACGATATAGACACAGAGGAAGG - Intergenic
1034778371 7:153853178-153853200 GATGAGACAGACAGAGAAGAGGG - Intergenic
1036019360 8:4826431-4826453 AATAAGCTAGTCACAGAAGCAGG + Intronic
1037050203 8:14362763-14362785 AATGAGATAGACACAGAAGATGG - Intronic
1037371301 8:18182107-18182129 GAAGAGATACACACTGAAGAAGG - Intronic
1037566405 8:20122031-20122053 AAAGAGGGAGAAACAGAAGAAGG - Intergenic
1038670152 8:29576721-29576743 AATTACAGAGGCACAGAAGAAGG - Intergenic
1038971410 8:32640370-32640392 AATGAAAACGACATAGAAGAGGG - Intronic
1039154026 8:34535448-34535470 AGTGAGATTGACACAGAAGATGG + Intergenic
1039347648 8:36725806-36725828 AGTGAGATTGACGCAGAAGACGG + Intergenic
1039672675 8:39619731-39619753 ATTGAAATAGACACAGTAAATGG + Intronic
1039819377 8:41122607-41122629 AATGAAAGAGACAGAGGAGAAGG - Intergenic
1040411402 8:47158291-47158313 AGTGTGAGCGACACAGAAGATGG + Intergenic
1040540763 8:48352703-48352725 AGTGTGATCAACACAGAAGATGG + Intergenic
1040962488 8:53049218-53049240 AGTGTGAGTGACACAGAAGACGG - Intergenic
1041035662 8:53786599-53786621 ATTGTGAGTGACACAGAAGACGG - Intronic
1041111535 8:54487532-54487554 AGAGAGATAGATAGAGAAGAGGG - Intergenic
1041630674 8:60083327-60083349 AGTGAGATCAACACAGAAGGAGG - Intergenic
1041845443 8:62322403-62322425 AGTGTGAGCGACACAGAAGACGG - Intronic
1042308777 8:67359012-67359034 AGTGTGATCAACACAGAAGATGG - Intergenic
1042322759 8:67495311-67495333 GAAGAGACAGACACAAAAGAAGG - Intronic
1042786530 8:72552891-72552913 AAGGAGAGAAACAAAGAAGAGGG - Intronic
1043089241 8:75876393-75876415 AGTGTGATTGACGCAGAAGACGG - Intergenic
1043118256 8:76286946-76286968 AGTGAGATCAACACAGAAGGTGG - Intergenic
1043242961 8:77959562-77959584 AATGAGATAGAAAAAGGGGAGGG - Intergenic
1043451261 8:80369328-80369350 AATGAGGGAGACACAGAGGAAGG + Intergenic
1043528709 8:81125714-81125736 AATGAGATAGATGTACAAGAAGG + Intergenic
1043567190 8:81561558-81561580 ACTGAGAGAGGCACTGAAGAGGG + Intergenic
1044123455 8:88426825-88426847 AAAGAGAAAGACATAAAAGAAGG + Intergenic
1044378132 8:91500204-91500226 AATGAGATCAACACAGAAGGTGG - Intergenic
1044470691 8:92562904-92562926 AGCGTGATAGACCCAGAAGATGG - Intergenic
1044521651 8:93205795-93205817 AGCGTGATTGACACAGAAGATGG - Intergenic
1044597074 8:93969900-93969922 AGTGTGATCAACACAGAAGACGG - Intergenic
1044818234 8:96134787-96134809 AGTGAGCAAGACACAGAAGAGGG - Intergenic
1045071219 8:98506467-98506489 AGTGTGATTGACGCAGAAGACGG - Intronic
1045123346 8:99063144-99063166 AGCGTGATTGACACAGAAGACGG + Intronic
1045157517 8:99492936-99492958 AGTGAGATCGACGCAGAAGATGG - Intronic
1045212005 8:100108422-100108444 AGTGAGATTGACACAGAAGGAGG + Intronic
1045232071 8:100315310-100315332 TATGATATAGACACAGGACAAGG + Intronic
1046311513 8:112443043-112443065 AATGAGAAGGACAAAGAAAAAGG - Intronic
1046551729 8:115726706-115726728 AATGAGACAGATATAGAAGATGG - Intronic
1046897786 8:119491748-119491770 GCTGAAAAAGACACAGAAGAAGG - Intergenic
1047402597 8:124558956-124558978 ACAGACATATACACAGAAGAGGG + Intronic
1047930746 8:129726357-129726379 AAGGAGAAAGACATGGAAGAGGG + Intergenic
1048007091 8:130428178-130428200 AGTGAGATGGACACTGAAGAGGG - Intronic
1048123052 8:131603279-131603301 ATTGAAATTGACCCAGAAGAAGG + Intergenic
1048125829 8:131634988-131635010 AATGAGAAAGACAAAGTTGAAGG - Intergenic
1048495164 8:134929192-134929214 AAAGTGATAGAGACAGAAAAAGG + Intergenic
1048673702 8:136752541-136752563 ATTCAGATAGACACAAAGGATGG - Intergenic
1048823153 8:138398061-138398083 GATGATATAGACACAGAGGGAGG + Intronic
1048932716 8:139327595-139327617 AATTAGATAGAGGTAGAAGATGG - Intergenic
1049677229 8:143895982-143896004 AAGAAGCTAGACACAAAAGACGG - Intergenic
1049872472 8:144991190-144991212 ATTGAGACCAACACAGAAGATGG - Intergenic
1050057242 9:1668506-1668528 AATGTGATACACACATATGATGG + Intergenic
1050198595 9:3115324-3115346 AATGTGATATACACATATGACGG - Intergenic
1050335158 9:4583434-4583456 ACAGAGATAAACACAGAACAAGG + Intronic
1050404383 9:5292822-5292844 AGTGACATTGTCACAGAAGATGG + Intergenic
1050450735 9:5779247-5779269 AGCGAGATCGACACAGAAGGCGG + Intronic
1050969051 9:11845812-11845834 AATGAGATATTCAGTGAAGAGGG + Intergenic
1050991946 9:12166915-12166937 AAAGACACAGTCACAGAAGATGG - Intergenic
1051248971 9:15139748-15139770 AAAGAAATAGTCACAGAAGGTGG - Intergenic
1051360449 9:16277274-16277296 AGAGAGATACATACAGAAGAAGG + Intergenic
1051418168 9:16864516-16864538 AAGGAGATAGACAGAGTTGAGGG - Intronic
1051941368 9:22508942-22508964 AGTGTGAGCGACACAGAAGACGG - Intergenic
1052327287 9:27228833-27228855 AATGAGATTCAGACAGAGGAAGG + Intronic
1052329268 9:27251231-27251253 AGTGAGATCGACGCAGAAGGCGG + Intergenic
1052552337 9:29968299-29968321 AATGATATAGAGCCAGAAGGAGG + Intergenic
1052799969 9:32957857-32957879 AGCGTGATCGACACAGAAGACGG + Intergenic
1053374132 9:37590845-37590867 AGTGAAAGAGACACAGAATAAGG + Intronic
1055242483 9:74200350-74200372 AATGAGAGAGACAAAGGATATGG + Intergenic
1055548492 9:77408357-77408379 AGTGTGAGCGACACAGAAGATGG + Intronic
1055621031 9:78125400-78125422 ACTGAGATAGACAAGAAAGATGG - Intergenic
1055779919 9:79809406-79809428 AATGAAATAAACAAAGAAAAAGG - Intergenic
1055826890 9:80338370-80338392 AAGGAAATAGACACTGAAGAGGG + Intergenic
1056047701 9:82736258-82736280 AATGAGATAGAGACAGAGGAGGG - Intergenic
1056266810 9:84905335-84905357 AATGATGTGGACACAGAAGCAGG + Intronic
1056477910 9:86970566-86970588 GATGAGGAAGACACAGAAGATGG + Intergenic
1057202248 9:93147797-93147819 AATGAGAGACACACAGAGCAAGG - Intergenic
1058181317 9:101803523-101803545 AATGATATAGTTAAAGAAGATGG + Intergenic
1059105862 9:111510963-111510985 AATGAGAGAAACACAGGGGAAGG + Intergenic
1059238941 9:112786517-112786539 AGAGGGACAGACACAGAAGAAGG - Intronic
1059675732 9:116537214-116537236 AGTGTGAGCGACACAGAAGATGG - Intronic
1060098268 9:120813159-120813181 AATAAGTTAGGCACAGAAGGTGG - Intergenic
1203415504 Un_KI270582v1:2675-2697 AGTGTGAGTGACACAGAAGACGG - Intergenic
1185683789 X:1910447-1910469 AATGAGAGAGACAGAGAGGGAGG - Intergenic
1185886475 X:3788061-3788083 AATCACATAGACAAAGAAAAAGG + Intergenic
1185979558 X:4761740-4761762 AGTGAGAGAGAGAGAGAAGAAGG + Intergenic
1186020139 X:5245533-5245555 AAACAGAGAGACAAAGAAGAAGG - Intergenic
1186602276 X:11050419-11050441 ACTGAAAGAGGCACAGAAGAGGG - Intergenic
1186805662 X:13138405-13138427 AGTGTGAGCGACACAGAAGACGG - Intergenic
1186937274 X:14463939-14463961 AGTGAGATAGATGCAGAAGACGG - Intergenic
1187197317 X:17100077-17100099 CATGAGATAGACAAATCAGAGGG - Intronic
1187723495 X:22176614-22176636 ATGGAGATAGACGCAGAGGAAGG - Intronic
1187814504 X:23216349-23216371 AGTGAAATAGCCACATAAGAGGG - Intergenic
1188353089 X:29156304-29156326 AATGAGATGGAAGGAGAAGATGG + Intronic
1188561344 X:31471540-31471562 AGTGAGATCAACACAGAAGGTGG - Intronic
1188954628 X:36418932-36418954 AGTGTGATCGACACAGAAGATGG - Intergenic
1189017745 X:37301648-37301670 AGCGTGATCGACACAGAAGACGG - Intergenic
1189024628 X:37379917-37379939 AATAATATACACACAGAAAATGG + Intronic
1189102417 X:38205127-38205149 AGTGAGAGAGACAGAGAAAATGG + Intronic
1189800323 X:44685889-44685911 AATTAGAGACACAGAGAAGAAGG - Intergenic
1189933849 X:46043827-46043849 AGAGAGATAGACAGATAAGAGGG - Intergenic
1189948295 X:46203056-46203078 AATGAGAGAGAAAGAAAAGAGGG + Intergenic
1189978522 X:46486449-46486471 AGTGAGATTGATGCAGAAGATGG - Intronic
1190603737 X:52119200-52119222 AGTGTGAGTGACACAGAAGATGG + Intergenic
1190648980 X:52550811-52550833 AGTGAGATCGATGCAGAAGACGG + Intergenic
1191079651 X:56495518-56495540 AGTGTGATTGACTCAGAAGACGG - Intergenic
1191153953 X:57251770-57251792 AGTGAGATCGACACAGAAGATGG + Intergenic
1191197839 X:57744045-57744067 AGCGAGATTGACACAGGAGATGG + Intergenic
1191645601 X:63478067-63478089 AGTGTGATCGACACAGAAGATGG + Intergenic
1191687310 X:63904763-63904785 AGTGTGAGTGACACAGAAGATGG - Intergenic
1191711328 X:64152654-64152676 AGGGAGATCAACACAGAAGATGG + Intergenic
1191941742 X:66488944-66488966 AGTGAGATAGACGCAGAAGGTGG + Intergenic
1191947652 X:66553538-66553560 AGTGAGATCAACACAGAAGGTGG + Intergenic
1191960275 X:66693064-66693086 AGTGGGAGCGACACAGAAGACGG - Intergenic
1192097162 X:68224801-68224823 AGTGTGAGCGACACAGAAGATGG + Intronic
1192159839 X:68776240-68776262 AATGATATTGATGCAGAAGACGG + Intergenic
1192353153 X:70373279-70373301 AAAGAGACAGACAGAGAAGGAGG + Intronic
1192406359 X:70890266-70890288 AACGTGATCGACACAGAAGACGG + Intronic
1192601430 X:72468522-72468544 AATGACATTGACTCAAAAGAGGG - Intronic
1192637253 X:72831343-72831365 AGTGAGATCGACGCAGAAGGCGG - Intronic
1192644461 X:72889471-72889493 AGTGAGATCGACGCAGAAGGCGG + Intronic
1192694629 X:73401117-73401139 AGTGAGATCGACGCAGAAGGTGG + Intergenic
1192761742 X:74101136-74101158 AGTGTGAGCGACACAGAAGACGG - Intergenic
1192825861 X:74695763-74695785 AGTGTGATTGACCCAGAAGATGG + Intergenic
1192878487 X:75257836-75257858 AATGAGATTGATGCAGAAGAAGG + Intergenic
1192975073 X:76274087-76274109 AGCGAGATAGATACAGAAGGTGG - Intergenic
1193058942 X:77184518-77184540 AGTGTGAGTGACACAGAAGATGG + Intergenic
1193070914 X:77304767-77304789 AACGTGAGTGACACAGAAGATGG + Intergenic
1193252459 X:79308260-79308282 ACTGAAAGAGACAGAGAAGAGGG + Intergenic
1193289461 X:79754468-79754490 ACTAAGATAGGCACTGAAGAGGG - Intergenic
1193344518 X:80389155-80389177 ACTGAGACAGGCACTGAAGAGGG - Intronic
1193436011 X:81475523-81475545 AGTGTGATCGACACAGAAGATGG - Intergenic
1193568352 X:83108440-83108462 AATTAGAAAGAGACAGAAAAAGG - Intergenic
1194068607 X:89292679-89292701 AGTGAGAGCGACGCAGAAGACGG + Intergenic
1194189267 X:90815209-90815231 ACTGAGATAGACACTAAAAATGG + Intergenic
1194242469 X:91469531-91469553 AGTGAGACCAACACAGAAGATGG + Intergenic
1194413613 X:93583549-93583571 AATAAAATAGACAAATAAGATGG + Intergenic
1194660453 X:96624900-96624922 AAAGAGATAGAGACAGAGAAGGG - Intergenic
1194726870 X:97409446-97409468 AGAGTGATCGACACAGAAGATGG + Intronic
1194961826 X:100244834-100244856 AATAAAATAGACACAGAAGTAGG + Intergenic
1195424205 X:104709529-104709551 AAGGCAATACACACAGAAGAGGG - Intronic
1195500933 X:105598266-105598288 AAACACATAGAAACAGAAGAGGG + Intronic
1195580395 X:106494244-106494266 AGTGAGATCGACACAGAAGTCGG - Intergenic
1196252093 X:113473158-113473180 AGTCAGAGAGAAACAGAAGAGGG + Intergenic
1196643710 X:118093939-118093961 AACGTGAGCGACACAGAAGACGG + Intronic
1196975919 X:121157503-121157525 AAGAAGATAGAAAAAGAAGAAGG + Intergenic
1197051078 X:122060782-122060804 AGTGAGATCAACACAGAAGGTGG + Intergenic
1198082516 X:133252782-133252804 AAAGAGAGTGAGACAGAAGACGG - Intergenic
1198179722 X:134194566-134194588 AAGGAGAAAGAAAAAGAAGAAGG - Intergenic
1198600134 X:138274691-138274713 AATAAGATAGACAAAGAGGAAGG + Intergenic
1198704634 X:139435748-139435770 AGTGTGAGCGACACAGAAGATGG + Intergenic
1199018694 X:142849045-142849067 ACTGAAAGAGGCACAGAAGAGGG - Intergenic
1199068027 X:143443061-143443083 AGTGAGATCAACACAGAAGGTGG - Intergenic
1199344114 X:146719107-146719129 AGCGTGATCGACACAGAAGATGG + Intergenic
1199379223 X:147148094-147148116 AGCGTGAGAGACACAGAAGATGG - Intergenic
1199435113 X:147804453-147804475 AATTAGAGAGAAAGAGAAGAGGG + Intergenic
1199556856 X:149118767-149118789 CTTGAGAGAGACTCAGAAGATGG - Intergenic
1199752059 X:150829354-150829376 AAGGAGAGAGACACAGAAAGGGG + Intronic
1199968581 X:152841375-152841397 AGCGTGATCGACACAGAAGATGG - Intronic
1200174127 X:154100034-154100056 AATGAAATAGAAACAAATGATGG + Intergenic
1200535844 Y:4397102-4397124 ACTGAGATAGACACTAAAAATGG + Intergenic
1201364224 Y:13186089-13186111 AGCGAGATCGACACAGAAGATGG + Intergenic
1201540147 Y:15097000-15097022 AGAGTGAGAGACACAGAAGAAGG - Intergenic
1201690724 Y:16762097-16762119 AGTGTGAGTGACACAGAAGACGG + Intergenic
1201752277 Y:17445807-17445829 AGCAAGATCGACACAGAAGATGG - Intergenic
1201954893 Y:19613037-19613059 AACGTGAGCGACACAGAAGACGG + Intergenic