ID: 1037050204

View in Genome Browser
Species Human (GRCh38)
Location 8:14362766-14362788
Sequence TCTTCTGTGTCTATCTCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050197_1037050204 30 Left 1037050197 8:14362713-14362735 CCAGTCCCAGTGAGGTGAACCAG 0: 7
1: 308
2: 666
3: 710
4: 785
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data
1037050201_1037050204 5 Left 1037050201 8:14362738-14362760 CCTGAGATGAAAATGCAGAAATC 0: 1
1: 29
2: 2839
3: 4197
4: 1996
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data
1037050199_1037050204 24 Left 1037050199 8:14362719-14362741 CCAGTGAGGTGAACCAGTGCCTG 0: 1
1: 0
2: 0
3: 21
4: 148
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data
1037050198_1037050204 25 Left 1037050198 8:14362718-14362740 CCCAGTGAGGTGAACCAGTGCCT 0: 1
1: 0
2: 7
3: 27
4: 175
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data
1037050200_1037050204 11 Left 1037050200 8:14362732-14362754 CCAGTGCCTGAGATGAAAATGCA 0: 1
1: 0
2: 31
3: 2311
4: 1856
Right 1037050204 8:14362766-14362788 TCTTCTGTGTCTATCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050204 Original CRISPR TCTTCTGTGTCTATCTCATT AGG Intronic
No off target data available for this crispr