ID: 1037050205

View in Genome Browser
Species Human (GRCh38)
Location 8:14362779-14362801
Sequence TCTCATTAGGAGCTGTAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037050201_1037050205 18 Left 1037050201 8:14362738-14362760 CCTGAGATGAAAATGCAGAAATC No data
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data
1037050202_1037050205 -6 Left 1037050202 8:14362762-14362784 CCCATCTTCTGTGTCTATCTCAT No data
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data
1037050200_1037050205 24 Left 1037050200 8:14362732-14362754 CCAGTGCCTGAGATGAAAATGCA No data
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data
1037050203_1037050205 -7 Left 1037050203 8:14362763-14362785 CCATCTTCTGTGTCTATCTCATT No data
Right 1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037050205 Original CRISPR TCTCATTAGGAGCTGTAGAC CGG Intronic