ID: 1037054310

View in Genome Browser
Species Human (GRCh38)
Location 8:14419274-14419296
Sequence ATGTCCTAACAGCTAGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037054308_1037054310 6 Left 1037054308 8:14419245-14419267 CCATATCTGGGTTATTAGACCAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1037054310 8:14419274-14419296 ATGTCCTAACAGCTAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037054310 Original CRISPR ATGTCCTAACAGCTAGATAA TGG Intronic
No off target data available for this crispr