ID: 1037054310 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:14419274-14419296 |
Sequence | ATGTCCTAACAGCTAGATAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037054308_1037054310 | 6 | Left | 1037054308 | 8:14419245-14419267 | CCATATCTGGGTTATTAGACCAG | 0: 1 1: 0 2: 0 3: 7 4: 81 |
||
Right | 1037054310 | 8:14419274-14419296 | ATGTCCTAACAGCTAGATAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037054310 | Original CRISPR | ATGTCCTAACAGCTAGATAA TGG | Intronic | ||
No off target data available for this crispr |