ID: 1037056969

View in Genome Browser
Species Human (GRCh38)
Location 8:14454879-14454901
Sequence ATGTATATGCCTAATCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037056969_1037056972 17 Left 1037056969 8:14454879-14454901 CCAAATGGATTAGGCATATACAT 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1037056972 8:14454919-14454941 CAAGTGCTAGGAGAAGAGATGGG No data
1037056969_1037056970 5 Left 1037056969 8:14454879-14454901 CCAAATGGATTAGGCATATACAT 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1037056970 8:14454907-14454929 AATGAAATCATACAAGTGCTAGG No data
1037056969_1037056971 16 Left 1037056969 8:14454879-14454901 CCAAATGGATTAGGCATATACAT 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1037056971 8:14454918-14454940 ACAAGTGCTAGGAGAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037056969 Original CRISPR ATGTATATGCCTAATCCATT TGG (reversed) Intronic
905788563 1:40777633-40777655 TTGTATGTGCCTAAGCCATGTGG + Intergenic
908048798 1:60205235-60205257 ATGTATAAGGCTATTCCTTTAGG - Intergenic
908814578 1:68018552-68018574 ATGTATATCCCTTCTCCTTTTGG + Intergenic
909833742 1:80227597-80227619 ATTTATATACGAAATCCATTTGG + Intergenic
910579102 1:88801824-88801846 ATATATATCCCTTATGCATTTGG + Intronic
911771962 1:101755104-101755126 ATGTGTTTGCTTAATGCATTCGG - Intergenic
912468229 1:109888637-109888659 ATGAATATGCCCAATGCAATAGG - Intergenic
913004394 1:114614668-114614690 ATGTCTATGCCTTATGGATTAGG - Intronic
915775545 1:158481087-158481109 ATTTAAATGCCTAGTCCACTGGG + Intergenic
915824489 1:159060237-159060259 ATGAATATTCCTTATCCGTTAGG - Intergenic
916911050 1:169346738-169346760 ATGCATATACCTAGTCCCTTGGG - Intronic
917162368 1:172072172-172072194 TTGTATACTCCAAATCCATTTGG - Intronic
917781626 1:178403678-178403700 TTTTAGATCCCTAATCCATTTGG - Intronic
918587567 1:186205301-186205323 ATGCATATGTCTAATACAGTGGG + Intergenic
920757668 1:208749722-208749744 TTGAATATGGCTAATCCGTTTGG + Intergenic
1063723832 10:8615005-8615027 ATGTCTATGGCAAAACCATTTGG - Intergenic
1066023584 10:31328187-31328209 ATTTATATGTCTAATGCATCAGG + Intronic
1066071300 10:31816491-31816513 ATGTGAATGCCTTATGCATTGGG - Intronic
1067979211 10:51064225-51064247 ATCAATATACCTAATCCTTTTGG - Intronic
1068832455 10:61512063-61512085 ATTTATATCCCTGATCCATATGG - Intergenic
1069611611 10:69776369-69776391 AAGTAGGTGCTTAATCCATTTGG + Intergenic
1071001508 10:80836263-80836285 ATTTATAATCCTAATCCTTTGGG + Intergenic
1071103923 10:82072043-82072065 ATGTATATGTCTACTCCTGTAGG + Intronic
1078092061 11:8269929-8269951 ATGAATGAGCTTAATCCATTTGG + Intergenic
1078282491 11:9916984-9917006 ATGTCTAAGTATAATCCATTTGG - Intronic
1080480402 11:32642778-32642800 ACCTACATGCCTAATACATTTGG + Intronic
1080559339 11:33448205-33448227 ATGTAAATACCTAATGCATGTGG - Intergenic
1080931527 11:36816639-36816661 ATGTATCAGCCTCCTCCATTAGG + Intergenic
1089136789 11:116255699-116255721 ATCTATATGCCTAATGCTGTTGG + Intergenic
1089200409 11:116721286-116721308 ATATATATATCTATTCCATTAGG - Intergenic
1092736672 12:11589210-11589232 ATATACATGTCTAATCAATTTGG - Intergenic
1094532796 12:31292979-31293001 AAGTATATTCCTAACCTATTTGG + Intronic
1095554850 12:43489126-43489148 ATTTAAATCTCTAATCCATTGGG - Intronic
1098511749 12:71323064-71323086 ATGTATATGTCAGCTCCATTTGG - Intronic
1099301027 12:80894398-80894420 AAGTATTTGCCTCATGCATTGGG - Intronic
1104211467 12:126692563-126692585 ATGTATATGCCAATTCGACTGGG - Intergenic
1106935778 13:34717649-34717671 ATGTACACGCTTAATCCATTTGG - Intergenic
1108568597 13:51727029-51727051 ATTTAGATCCCTAATTCATTTGG + Intronic
1109065888 13:57689650-57689672 CTGTATATGCATAATGCAATCGG + Intronic
1109069443 13:57745966-57745988 ATGATTATGCCTACTTCATTAGG + Intergenic
1110535651 13:76647862-76647884 ACGTCTATGGCTAATACATTAGG + Intergenic
1116162166 14:41281793-41281815 AAATATATGTCTAATCCAATGGG - Intergenic
1116589902 14:46759316-46759338 AAGTATATTTCTAATCCTTTTGG + Intergenic
1118440847 14:65810238-65810260 TTGTATAGGCTTAATCAATTTGG + Intergenic
1120106801 14:80505422-80505444 ATGTATATGAGTAAAACATTGGG - Intronic
1122497223 14:102166402-102166424 ATGTATATTCCTTATCTGTTAGG + Intronic
1124180710 15:27470929-27470951 ATTTAGATCCCTGATCCATTTGG + Intronic
1127159034 15:56161023-56161045 ATTTATATACCTAATTCAATAGG - Intronic
1128440800 15:67706783-67706805 TTTTATATACCTAATCTATTTGG + Intronic
1131426485 15:92349307-92349329 ATGTATATGTCTAATCCAGTAGG - Intergenic
1131724029 15:95202959-95202981 ATGTATATACCACTTCCATTCGG - Intergenic
1132723133 16:1326716-1326738 ATGTATATGGTTAATACATATGG + Exonic
1133431267 16:5739108-5739130 AAGTATGTGTCTTATCCATTGGG + Intergenic
1134463361 16:14449362-14449384 ATTTAGATATCTAATCCATTAGG - Intronic
1136285764 16:29240378-29240400 ATATAGATCTCTAATCCATTTGG + Intergenic
1139077454 16:63469768-63469790 ATGTATATTCATACTCCAGTAGG + Intergenic
1142091100 16:88210565-88210587 ATATAGATCTCTAATCCATTTGG + Intergenic
1149154707 17:53613605-53613627 ATGTATGTGACTAAAACATTGGG + Intergenic
1154081127 18:11258077-11258099 ATGGAAATGCCTACTCCTTTTGG - Intergenic
1157780962 18:50438747-50438769 ATGTATATGACAAAACCATAGGG - Intergenic
1157962068 18:52165824-52165846 CTTTAAATACCTAATCCATTTGG - Intergenic
1164554180 19:29237601-29237623 TTCTATTTGCCTAATCTATTTGG - Intergenic
925796636 2:7552666-7552688 ATTTATATGTATAATGCATTTGG + Intergenic
926433499 2:12815080-12815102 AAGTATAGGCCTAACCCATAGGG + Intergenic
928058861 2:28088771-28088793 ATGTTTATTCCTAATCCATTTGG + Intronic
928879259 2:36078900-36078922 ATGAATAAGCCTAATATATTGGG + Intergenic
935428943 2:102951953-102951975 ATATATATGATTAATCAATTAGG + Intergenic
937039765 2:118812165-118812187 ATGTTTTTTACTAATCCATTTGG - Intergenic
937608507 2:123831043-123831065 CTGTGTATGCCTAATCCAACTGG + Intergenic
939094414 2:137817797-137817819 TCATATATACCTAATCCATTGGG - Intergenic
942073035 2:172332436-172332458 ATTTCTATCCCAAATCCATTTGG + Intergenic
944776613 2:202973358-202973380 ATATATATGCTTATTACATTTGG - Intronic
944917114 2:204372545-204372567 ATATATATGCATAATCCCTTAGG - Intergenic
947100631 2:226617529-226617551 GTCTATGTGCCTAATACATTTGG - Intergenic
947987825 2:234463949-234463971 ACGTATTTGCCTAGACCATTTGG - Intergenic
948498846 2:238375848-238375870 ATGTACATGCTTAATCCACCTGG + Intronic
1172210793 20:33197115-33197137 ATGTAAATTCATAACCCATTTGG - Intergenic
1177997920 21:28125522-28125544 TAGTATATGCCTAAGTCATTAGG - Intergenic
1179259911 21:39749048-39749070 ATGTTTATGCCTTATGCATATGG + Intronic
1179955831 21:44737723-44737745 ATTTATTTCCCTCATCCATTTGG - Intergenic
1184311404 22:43646656-43646678 ATGTAGATGCTTAATCCATGTGG - Intronic
951053570 3:18122006-18122028 ATGTATATGTGTATTTCATTTGG - Intronic
955657206 3:61257114-61257136 AGGTATATGTCTATACCATTTGG + Intergenic
958794390 3:98691506-98691528 ATGAATTTGCCTATTCCTTTGGG - Intergenic
960654928 3:119992463-119992485 ATTTAGATCCCTGATCCATTTGG - Intronic
963658875 3:148098177-148098199 ATGTATATTTTTAATCCATCGGG - Intergenic
967467592 3:189825255-189825277 ATGTATATGCCTATTATATGAGG - Intronic
970255258 4:14162024-14162046 ATTTAGATCCCTAATCCATTTGG + Intergenic
972747118 4:41946050-41946072 CTGGATATGCCAAATCAATTAGG - Intronic
973069454 4:45838812-45838834 ATGTATAAGAATAATCCATGTGG + Intergenic
976732255 4:88275494-88275516 ATGTAGATGCTTAAACCAATCGG - Intronic
977683345 4:99818971-99818993 ATGTATCTACCAAATGCATTAGG + Intronic
980714703 4:136614538-136614560 CTGTATATCTCTAATCCATATGG + Intergenic
981989465 4:150900039-150900061 AATTATATACCTAATCCTTTTGG + Exonic
982185787 4:152797113-152797135 ATCTAGATTCCTAATCCATTTGG + Intronic
983209538 4:164944706-164944728 TTGTATATGCCTAGACCATTTGG + Intergenic
983215116 4:164995568-164995590 TTGTATATGCATAGACCATTTGG + Intergenic
983217397 4:165014780-165014802 TTGTACATGCATACTCCATTTGG + Intergenic
988604346 5:32667109-32667131 AGGTATAAGCCTTATCCAATTGG - Intergenic
988870403 5:35383895-35383917 ATTTATATATTTAATCCATTTGG + Intergenic
989714972 5:44452347-44452369 ATGTATATGACTTAGCCTTTGGG - Intergenic
993344941 5:86771078-86771100 AGGTAGATACCTAGTCCATTGGG - Intergenic
993757741 5:91751714-91751736 ATGGATTTTCCTTATCCATTTGG - Intergenic
994966623 5:106680677-106680699 GTTGATATTCCTAATCCATTAGG - Intergenic
1001359303 5:171065134-171065156 ATTTATATCTCTGATCCATTTGG + Intronic
1008717230 6:54303648-54303670 ATTTATATGCCAACTCCTTTAGG + Intergenic
1008844594 6:55948273-55948295 ATTTAGATTGCTAATCCATTTGG - Intergenic
1012397148 6:98811532-98811554 ATGTTCATGCCTAAACCAGTTGG - Intergenic
1012791440 6:103702730-103702752 ATGTATATGAATAATCTATAAGG - Intergenic
1013228665 6:108140934-108140956 ATTTGTATGTGTAATCCATTTGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014330069 6:120052953-120052975 ATGTAGATCTCTAATCCATTTGG - Intergenic
1016374657 6:143407830-143407852 ATTTAGATCCCTGATCCATTTGG - Intergenic
1018611478 6:165651786-165651808 ATGTACATATGTAATCCATTTGG + Intronic
1020855114 7:13410621-13410643 ATTTATAGGCTTACTCCATTTGG - Intergenic
1021070127 7:16227883-16227905 ATTTAAATCCCTAATCCATTTGG + Intronic
1021095551 7:16531236-16531258 ATGTCTAAGCCTGATCCAATGGG + Intronic
1022836301 7:34118778-34118800 ATGGATAGGCCTCATCCAATTGG + Intronic
1023789465 7:43741669-43741691 ATATAGATTCTTAATCCATTTGG - Intergenic
1024186682 7:46955791-46955813 ATTTAAATTCCTAATCCATCTGG + Intergenic
1035138353 7:156730502-156730524 ACGTATCAGTCTAATCCATTAGG - Intronic
1037056969 8:14454879-14454901 ATGTATATGCCTAATCCATTTGG - Intronic
1041702996 8:60812270-60812292 ATTTAGGTGCCTGATCCATTTGG + Intronic
1045643977 8:104282337-104282359 AGGTATATGCCTTCTCCCTTAGG + Intergenic
1046433716 8:114160966-114160988 ATGTACATTCCTATTCCACTTGG - Intergenic
1047472367 8:125189260-125189282 ATGTTTATCCCTTATGCATTTGG + Intronic
1047667277 8:127105779-127105801 ATATATATGCCTTAGTCATTAGG + Intergenic
1050415489 9:5412301-5412323 ATTTAGATTCCAAATCCATTTGG - Intronic
1052722768 9:32192340-32192362 ATGAATTGGCCTAATCCATTTGG - Intergenic
1053526620 9:38836532-38836554 ATCTAAATGCCTTATCAATTTGG + Intergenic
1053798624 9:41748739-41748761 ATTTAAATCCTTAATCCATTTGG + Intergenic
1054198848 9:62060967-62060989 ATCTAAATGCCTTATCAATTTGG + Intergenic
1054639506 9:67527400-67527422 ATCTAAATGCCTTATCAATTTGG - Intergenic
1055794418 9:79959526-79959548 GTGTATACACCTAACCCATTTGG + Intergenic
1055907926 9:81315265-81315287 ATGTAAATGCCAAATAAATTTGG - Intergenic
1192764224 X:74125926-74125948 TTGTATCTCCCTAATCCATGTGG - Intergenic
1193496823 X:82223679-82223701 CTGTATATGTCTATTCCATTTGG + Intergenic
1199701505 X:150380659-150380681 ATTTAGATTCCTAATCCATTTGG + Intronic