ID: 1037058023

View in Genome Browser
Species Human (GRCh38)
Location 8:14469207-14469229
Sequence CTGTATAGGTAGTAGTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037058023_1037058026 8 Left 1037058023 8:14469207-14469229 CCATCTTACTACTACCTATACAG 0: 1
1: 0
2: 1
3: 4
4: 110
Right 1037058026 8:14469238-14469260 CCTCAGCATCATTGACATGTTGG No data
1037058023_1037058028 13 Left 1037058023 8:14469207-14469229 CCATCTTACTACTACCTATACAG 0: 1
1: 0
2: 1
3: 4
4: 110
Right 1037058028 8:14469243-14469265 GCATCATTGACATGTTGGGCTGG No data
1037058023_1037058027 9 Left 1037058023 8:14469207-14469229 CCATCTTACTACTACCTATACAG 0: 1
1: 0
2: 1
3: 4
4: 110
Right 1037058027 8:14469239-14469261 CTCAGCATCATTGACATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037058023 Original CRISPR CTGTATAGGTAGTAGTAAGA TGG (reversed) Intronic
902119989 1:14155986-14156008 CAGTAAAAGTAGTACTAAGAGGG - Intergenic
908968945 1:69801866-69801888 CAGTAAAAGTAGTACTAAGAGGG - Intronic
909091508 1:71231887-71231909 CTGAATAGGCAATAGCAAGAGGG + Intergenic
909546107 1:76849120-76849142 CAGCATAAGTAGTACTAAGATGG - Intergenic
911415981 1:97575003-97575025 CTGGATAGGTTGTTGAAAGATGG - Intronic
913224964 1:116690969-116690991 GTGTAGAGGAGGTAGTAAGAGGG + Intergenic
918218971 1:182418430-182418452 CTGAATAAGTATTAGTAAAAAGG + Intergenic
918791479 1:188836193-188836215 CTGTATAGATAGGAAGAAGAAGG + Intergenic
921308577 1:213820969-213820991 CTGGATATGTTGTAGTAGGAGGG - Intergenic
921373011 1:214444932-214444954 CTGTTTAGGTACCAGAAAGAGGG - Intronic
923820274 1:237431335-237431357 ATGTAAAGGTAGTACAAAGATGG + Intronic
1065432383 10:25672862-25672884 CTGACTTTGTAGTAGTAAGAGGG - Intergenic
1070165154 10:73891869-73891891 CTGTACAGGTAATATAAAGAGGG - Intergenic
1072335165 10:94391396-94391418 CTTTATGGGCAGTAGGAAGAAGG - Intergenic
1072519863 10:96221834-96221856 ATGGGTAGGTAATAGTAAGAAGG + Intronic
1073764768 10:106669858-106669880 CTGAATAAATAGTACTAAGAAGG - Intronic
1077651751 11:3979075-3979097 CTTTATAGGTAGTAGTATATAGG + Intronic
1078622592 11:12922754-12922776 CTGTATTTCTAGTAGTAACAGGG - Intronic
1080864386 11:36180453-36180475 CTGTACATGTAGAAGTAAGTAGG + Intronic
1084362857 11:68680290-68680312 TTGTATATGTAGTAGAGAGAGGG + Intergenic
1086273769 11:85099203-85099225 TTGTATTGGTAGTAGGAAGCTGG + Intronic
1092867215 12:12773680-12773702 CTTTATAGGAAGTATTAAGTCGG - Intronic
1096312432 12:50533037-50533059 CAGCAAAGGTAGTAGTGAGAAGG + Intronic
1097624416 12:61982519-61982541 CTGGATAGGTATTAGGAACATGG - Intronic
1097913878 12:64999752-64999774 CTGCTTAGGTAGTAGGAAGCTGG + Intergenic
1098352795 12:69581747-69581769 CTGTTTGGGTAGTAGGGAGAAGG - Intergenic
1098427181 12:70378126-70378148 CTGTATTGGTAGTAGAGACAGGG + Intronic
1100457040 12:94762573-94762595 CTGAATAGGCAGTTGTAACATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105755231 13:23457697-23457719 CTGGATAGCTAGTAGAAAGCAGG - Intergenic
1106061217 13:26294427-26294449 CTATATAGCCAGTAGTAGGATGG + Intronic
1106831399 13:33587041-33587063 TTGTATTTTTAGTAGTAAGACGG - Intergenic
1109843348 13:67949959-67949981 CTCTAGAAGTAGTAGTATGATGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1111526508 13:89477927-89477949 TGGAATAGGAAGTAGTAAGAGGG + Intergenic
1116685856 14:48037489-48037511 CAGTAAAGGTAGTAATAAAAGGG - Intergenic
1119810067 14:77510147-77510169 ATGTATAGGTTAAAGTAAGAAGG - Exonic
1121960085 14:98251527-98251549 ATGTTTAAGTAGGAGTAAGAAGG + Intergenic
1124546997 15:30637990-30638012 TTGTATATGTAGTAGAAAGGGGG + Intronic
1126149341 15:45508358-45508380 GAGTAGAGGTAGGAGTAAGAAGG + Intronic
1127185664 15:56477513-56477535 CTGTACATGTAGTAGTATAAAGG + Intergenic
1127690688 15:61393591-61393613 AAGTATTGGTAATAGTAAGAAGG - Intergenic
1128764160 15:70240883-70240905 CTGTCTTGGGAGTAGTAAGGAGG + Intergenic
1133920314 16:10146916-10146938 TTGTGTAGGTAGTAGCAAGAGGG - Intronic
1135671229 16:24377238-24377260 CTGTGAAGCTAGTAGCAAGATGG - Intergenic
1137041359 16:35615814-35615836 TTTTATGGGTAGTAGGAAGAAGG + Intergenic
1142626594 17:1196255-1196277 TTGTATTTGTAGTAGAAAGAGGG - Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1159111927 18:64069589-64069611 CTGTGTAGGTAGTGGTAGGTTGG + Intergenic
1166350621 19:42196395-42196417 CTGAATGGGATGTAGTAAGACGG - Intronic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
930280657 2:49365350-49365372 CTTTATAAGTATTAGCAAGAAGG - Intergenic
930935978 2:56951950-56951972 CAGTAAAGGCAGTGGTAAGAGGG - Intergenic
931092246 2:58898806-58898828 CTGAATAGGGACTAGGAAGAGGG - Intergenic
932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG + Intronic
933620094 2:84528710-84528732 CTGGATAGGGAGTACTGAGAAGG + Intronic
1170182050 20:13542816-13542838 CAGTAAAAGTAGTACTAAGAGGG + Intronic
1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG + Exonic
1173634074 20:44539589-44539611 TTGTATATTTAGTAGTAACAGGG + Intronic
1176155154 20:63615966-63615988 ATCTCTAGGTAGTAGTAATATGG + Intronic
1177890863 21:26802551-26802573 CTGTATAGGAAGGGGTGAGATGG + Intergenic
1178198078 21:30371583-30371605 ATGAAGAGCTAGTAGTAAGAGGG + Exonic
1178975670 21:37219296-37219318 CTGTGTTGGTTGTAGTAAGTTGG + Intergenic
949652146 3:6172067-6172089 GTGTAGAGGTAGGGGTAAGATGG - Intergenic
952866625 3:37859864-37859886 CTGTATTGGGAGGATTAAGAAGG + Intergenic
958485417 3:94700343-94700365 CTGAATAGGTATTACAAAGAAGG - Intergenic
960345764 3:116530360-116530382 CTGTATAGGTAGAAGTTTAAAGG + Intronic
963580642 3:147122717-147122739 CTGGTTTTGTAGTAGTAAGAGGG - Intergenic
964288723 3:155151657-155151679 CTGTCTTGGTAGCAGTAAAATGG - Intronic
967086747 3:186102008-186102030 CTGTACAGCTAGAAGTAAGCTGG + Intronic
968315574 3:197721735-197721757 CTGCAAAAGTAGTACTAAGAGGG - Intronic
971364158 4:25963576-25963598 CTGAGTAGGGAGTAGGAAGATGG - Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
979814352 4:125081485-125081507 TTGTATATGTAGTAGTCATAAGG - Intergenic
980223482 4:129949633-129949655 TTGTATTGGTAGTAGTAAGAAGG + Intergenic
981417039 4:144505482-144505504 GGGTACTGGTAGTAGTAAGAAGG + Intergenic
987874265 5:23658921-23658943 CAGTAAAGGTAGTACTGAGAGGG + Intergenic
989249551 5:39294048-39294070 CAGAAAAGGCAGTAGTAAGAGGG + Intronic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
992880012 5:81098447-81098469 ATGCATAGGTAGAAGTAAGAGGG + Intronic
993416538 5:87639895-87639917 CTGTAAAGCTAGAAGCAAGATGG + Intergenic
994821454 5:104656015-104656037 CAGCAAAAGTAGTAGTAAGAGGG + Intergenic
994839919 5:104910356-104910378 CTGTATAGGTAGTAATAGAAAGG - Intergenic
995307088 5:110665321-110665343 CTGTATAGGTAGTGGTGGCAAGG + Intronic
997793126 5:136780790-136780812 CTCTATAATTAGTGGTAAGAAGG - Intergenic
998452918 5:142248744-142248766 CTGAACAGTTAGTTGTAAGAGGG + Intergenic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1007699378 6:43757792-43757814 CTGTATAGGTATTATTAGCATGG + Intergenic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1015014478 6:128394706-128394728 CTGTGTAGTAAGTAGTAAGTAGG + Intronic
1016922919 6:149313949-149313971 CTGTCTGGTTAATAGTAAGATGG - Intronic
1019072244 6:169356761-169356783 CTGTATAAGTAGTAGAGATATGG - Intergenic
1022030678 7:26489149-26489171 ATGTATAGGTAGTGATAAAAAGG + Intergenic
1023468004 7:40479538-40479560 CTGTATACCTAGAAGTGAGATGG + Intronic
1025790773 7:64685043-64685065 CTGCATATGTAGGAGTTAGAAGG - Intronic
1027924153 7:84438695-84438717 CTGTATGGTAAGTAATAAGATGG + Intronic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1030697764 7:112604186-112604208 CTGTATTTTTAGTAGTAACAGGG + Intergenic
1032925285 7:136597609-136597631 CTGTAGAGATATTAGTAATAAGG + Intergenic
1037058023 8:14469207-14469229 CTGTATAGGTAGTAGTAAGATGG - Intronic
1037489612 8:19385735-19385757 CTGAATAGGTTGCATTAAGAAGG + Intronic
1038345612 8:26729742-26729764 TTGTATTGGTGGTAGTCAGAAGG - Intergenic
1039017937 8:33173693-33173715 ATGTATAGGAAGTAATGAGAAGG + Intergenic
1049909802 9:254558-254580 TTGTTTACATAGTAGTAAGAAGG + Intronic
1051573946 9:18593552-18593574 CAGTATAAGCAGTACTAAGAGGG - Intronic
1053564435 9:39233466-39233488 CTGAATAGCTAGTACAAAGATGG + Intronic
1053589261 9:39494848-39494870 CTGAAAAAGTAATAGTAAGAAGG + Intergenic
1054132715 9:61385570-61385592 CTGAATAGCTAGTACAAAGATGG - Intergenic
1054577037 9:66870445-66870467 CTGAAAAAGTAATAGTAAGAAGG - Intronic
1060335805 9:122720758-122720780 CTGTATATCTATTAATAAGATGG - Intergenic
1187220003 X:17315706-17315728 CAGTAAAAGTAGTACTAAGAGGG + Intergenic
1188145056 X:26601825-26601847 CTGTATAGGTATAACTAAAATGG - Intergenic
1190139379 X:47828966-47828988 CTTTATATGTAGTAGAAAAAGGG + Intergenic
1195638696 X:107149812-107149834 CTGTGGCAGTAGTAGTAAGAGGG - Intronic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic