ID: 1037062228

View in Genome Browser
Species Human (GRCh38)
Location 8:14528722-14528744
Sequence CAGAAATAGAAATTGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037062228 Original CRISPR CAGAAATAGAAATTGGGCCA GGG (reversed) Intronic
900034792 1:398091-398113 AAGAAATAGAAAGTGGGCAGAGG - Intergenic
900055622 1:627973-627995 AAGAAATAGAAAGTGGGCAGAGG - Intergenic
901978275 1:13012538-13012560 TAGAGAAAGAAATTGGGCCCAGG + Intronic
902003809 1:13216400-13216422 TAGAGAAAGAAATTGGGCCCAGG - Intergenic
902023034 1:13362144-13362166 TAGAGAAAGAAATTGGGCCCAGG - Intergenic
903891860 1:26575094-26575116 CAGTGACAGAAAATGGGCCAGGG + Intergenic
904056249 1:27672265-27672287 CAGAAATAGAAACTCCGACAGGG - Intergenic
904634944 1:31872732-31872754 CAAAAATAGAATGTGGGCCAGGG + Intergenic
905210697 1:36372186-36372208 TAGAAAAAGAAATTGAGCCCGGG + Intronic
905514566 1:38552726-38552748 CAGAACCAGAATTTGGACCATGG - Intergenic
907382706 1:54104530-54104552 AAGAAAAAAAAATTGGGCAAAGG - Intronic
907813659 1:57897364-57897386 CACAATTAAGAATTGGGCCATGG - Intronic
908875810 1:68674185-68674207 CAGAAAGAAAAATTAAGCCATGG - Intergenic
908920976 1:69191749-69191771 CTGAATTAGAAATTGGTCCTAGG + Intergenic
909149496 1:71983708-71983730 CACAAATAGAGATTGGACAAAGG + Intronic
909421828 1:75475847-75475869 CAGATGAAGAAATTGGCCCAGGG - Intronic
910034938 1:82778048-82778070 CAGAAAACAAAATTGGGCCACGG - Intergenic
910074632 1:83263246-83263268 CAGAAATAGACATTTGACCCAGG + Intergenic
910153816 1:84189731-84189753 CAGAAATAGAAATTGCACTTTGG + Intronic
912121682 1:106479437-106479459 CCAAAATAGAGATTGGGCCATGG + Intergenic
914852870 1:151327693-151327715 CAGAAATAGAAAAGGGGGCGGGG + Intronic
916539708 1:165740957-165740979 CAGCAACAGAAAATGGGCTAGGG + Intronic
916937394 1:169643857-169643879 AAGACATAAAAATGGGGCCAAGG + Intergenic
917073874 1:171183106-171183128 CACTAATAGAAAATTGGCCAAGG + Intergenic
917552748 1:176052387-176052409 CAGAAGTATATATTGGGCCTGGG + Intronic
917855509 1:179095998-179096020 CAGAAACAGAAAGTACGCCAAGG - Intronic
918123862 1:181565307-181565329 CAGAATTAGAAAATAGGCCTTGG + Intronic
918298962 1:183185332-183185354 TAGGAATATAAAGTGGGCCAGGG + Intergenic
919750937 1:201037801-201037823 GAGAAATAGAAATGTGGACAAGG + Intergenic
919891653 1:201979875-201979897 CAAAATAAGAAATTGGACCAAGG - Intergenic
920715406 1:208335784-208335806 CAGAAAGAGTAATTGAGCCAGGG - Intergenic
921699871 1:218256580-218256602 CAGAATAAGGAACTGGGCCAAGG - Intergenic
922005351 1:221524891-221524913 CTGAAATAGAAATATGACCATGG - Intergenic
922352378 1:224744718-224744740 CAGAAATAGAAATAGAAACAGGG + Intergenic
923525117 1:234766678-234766700 AAATAATAGAAATTAGGCCAGGG - Intergenic
923885377 1:238149453-238149475 CATAAATAGAAATTGGACAAAGG - Intergenic
924249957 1:242122517-242122539 CAGCAATAGAAAATTTGCCAAGG - Intronic
1063897930 10:10701763-10701785 CAGAAATGGAAAATGGGACGTGG - Intergenic
1064492233 10:15871548-15871570 GGGAAAGAGAAATTGAGCCATGG - Intergenic
1064692646 10:17933682-17933704 CAGAAACAGAATTTGAGCCTGGG + Intergenic
1065013676 10:21442178-21442200 CAAAAATAAAATTTAGGCCAGGG + Intergenic
1065812979 10:29459540-29459562 CAGATTAAGAAATGGGGCCAGGG - Intronic
1066159252 10:32710953-32710975 CACAAAAAGACATTGGGCAAAGG + Intronic
1067707807 10:48623792-48623814 CTGAAATAGCAATTGGCACAGGG + Intronic
1068277941 10:54826908-54826930 CAGACTTAGAATTTGGGACATGG + Intronic
1069065279 10:63936127-63936149 CAGACACAGAAATTGGTCCAAGG - Intergenic
1071056424 10:81515305-81515327 CAGAGATAGAAATTGGGTATGGG + Intergenic
1071779292 10:88825104-88825126 TAGAAACAGGAATGGGGCCATGG + Intronic
1073045101 10:100632541-100632563 CAGAGAGAGAAATTGAGACAGGG - Intergenic
1074915954 10:117955223-117955245 AAGAAATATAAATAGGGCCTGGG - Intergenic
1075860147 10:125668030-125668052 CAGAAATAAATCTTTGGCCAGGG + Intronic
1077042668 11:531449-531471 CAGACCTAGAACTTGGCCCAAGG + Intergenic
1079490301 11:20981655-20981677 GACAAATAGAAATAGGGCCAAGG - Intronic
1079501145 11:21102500-21102522 CAGATAAAGAAATTGAGACATGG - Intronic
1079710342 11:23675650-23675672 CCCAAATAAAAAGTGGGCCAAGG + Intergenic
1080047605 11:27825987-27826009 CAGAAACATAAATTGGGGAATGG - Intergenic
1081053851 11:38383500-38383522 CAGAAATATAAATTATCCCAGGG + Intergenic
1083323334 11:61860909-61860931 TAAAAATAAAAGTTGGGCCAGGG + Intronic
1085880153 11:80457762-80457784 TAAAAAAAGAAATTGGACCAGGG + Intergenic
1085910562 11:80820100-80820122 CAGATGTAGAAATTGGGACTTGG + Intergenic
1087071143 11:94082081-94082103 CAGAGAGAGAAGCTGGGCCAGGG + Intronic
1087362907 11:97183252-97183274 GAGAAATAGAAAATGGGTCTCGG + Intergenic
1087366182 11:97222356-97222378 CAGAAATAGAGATTGGTATAAGG - Intergenic
1087731276 11:101780720-101780742 CAGAAACATAAATTGGGGAAAGG - Intronic
1087862255 11:103174285-103174307 CAACAGTAGAAATTGGGGCAGGG - Intronic
1087907009 11:103709968-103709990 GAGAAAAAGAAATATGGCCAAGG - Intergenic
1088831164 11:113538237-113538259 CAGAAATAAATACTGTGCCATGG - Intergenic
1090031309 11:123209005-123209027 GTGAAATTGAAATTGGGGCATGG + Intergenic
1091160440 11:133414878-133414900 CAGACATAGACATAGGCCCAAGG + Intronic
1091657690 12:2357569-2357591 CAAAATTAGCTATTGGGCCAGGG + Intronic
1091706706 12:2698673-2698695 CAGGAGTAGAAAGTGGGCTAGGG - Intergenic
1091910633 12:4227710-4227732 CAGAAATACAAACTGTGCCCTGG + Intergenic
1093473620 12:19531633-19531655 AAGAAAAAGAAAGTGGGGCAGGG - Intronic
1094058258 12:26287649-26287671 CATAAAGAGAAATTTGGCCATGG - Intronic
1094557529 12:31516521-31516543 AAAAAATAGATAATGGGCCAAGG - Intronic
1095748764 12:45688347-45688369 TAAAAATAGAAATAGTGCCAGGG + Intergenic
1096257627 12:50072880-50072902 CTGAAATAGAGCTGGGGCCAGGG + Intronic
1097289021 12:57898286-57898308 GAGAAAGAGAAGTAGGGCCAGGG + Intergenic
1097946106 12:65369431-65369453 TAGAAATAGAAATTTGTCTATGG + Intronic
1098145286 12:67490840-67490862 CAGAAATAGAATTTGGAATATGG + Intergenic
1098497865 12:71157436-71157458 CAGTAATTGAAAATGAGCCAAGG - Intronic
1099233676 12:80056718-80056740 AATAAATAGAAATGGGGGCAGGG - Intergenic
1099349338 12:81545586-81545608 CAAAAATAGAAGTTGCACCATGG + Intronic
1099351840 12:81581070-81581092 CAGAAGTAGAAAATGGGGAAAGG + Intronic
1099722544 12:86382742-86382764 CAGACATAGAGCTTGGGCCATGG + Intronic
1100506589 12:95226768-95226790 AAGAAATGGGAATTGGGCCTGGG - Intronic
1100987203 12:100213646-100213668 CAGAAGTAGAATTTGGCCCTAGG - Intronic
1101226113 12:102689712-102689734 AATAGATAAAAATTGGGCCATGG - Intergenic
1101435756 12:104662941-104662963 GTGAATTAGAAATTGTGCCACGG + Intronic
1101518236 12:105457265-105457287 CAGAAATAGAATTGGAGTCATGG - Intergenic
1101791340 12:107930449-107930471 CAGATACAGAAATAGGGTCAGGG - Intergenic
1102434518 12:112910626-112910648 GAGAAGTAGAAAGTGGGCAAAGG + Intronic
1103779865 12:123391184-123391206 AAGAAAAAGAAATGGGGTCAAGG - Intronic
1104487678 12:129165633-129165655 TAAAAATAAAAATTTGGCCATGG + Intronic
1105245046 13:18642163-18642185 GAGAACTGGAAATTGTGCCAAGG + Intergenic
1105542900 13:21330049-21330071 CAGAAACAGAAATTGAGCCAAGG + Intergenic
1106176665 13:27337817-27337839 AAGAAAGACAAATTGGGTCATGG - Intergenic
1106690433 13:32109515-32109537 CAGATGAACAAATTGGGCCAGGG + Intronic
1107022892 13:35769498-35769520 AAGAAATTGAAACTGGTCCAAGG - Intronic
1108872828 13:55007707-55007729 TAGAACTAGAAATTGTGTCAAGG - Intergenic
1109716932 13:66230999-66231021 CAGAGATAGAGGTTGGGGCATGG + Intergenic
1109734264 13:66460959-66460981 CTGCAAGAGAAATTGGCCCAGGG + Intronic
1109879579 13:68453313-68453335 CAGAAATATAAATTAGTGCATGG + Intergenic
1112129767 13:96509603-96509625 CAAAAACATAAATTGGGGCATGG - Intronic
1113509363 13:110840025-110840047 CAGAATTAAAAATTGGGCAAAGG - Intergenic
1114060118 14:19010398-19010420 CAGACATAGAATTTGTGCCAAGG + Intergenic
1114060413 14:19012169-19012191 CAGACATAGAATTTGTGCCAAGG + Intergenic
1114060515 14:19012799-19012821 CAGACTTAGAATTTGTGCCAAGG + Intergenic
1114060926 14:19015306-19015328 CAGACATAGAATTTGTGCCAAGG + Intergenic
1114101330 14:19384673-19384695 CAGACATAGAATTTGTGCCAAGG - Intergenic
1114101740 14:19387179-19387201 CAGACTTAGAATTTGTGCCAAGG - Intergenic
1114101940 14:19388437-19388459 CAGACATAGAATTTGTGCCAAGG - Intergenic
1114102429 14:19391373-19391395 CAGACATAGAATTTGTGCCAAGG - Intergenic
1114265729 14:21071492-21071514 AAGAAAGAGGAACTGGGCCAGGG + Intronic
1115391915 14:32863441-32863463 CAAAAATAAAAATTGGACAATGG - Intergenic
1115469912 14:33757784-33757806 CAGAAATAAAGAGTGGTCCAAGG + Intronic
1115895455 14:38081512-38081534 GAGAAATACAATTTGGTCCATGG + Intergenic
1116087740 14:40262954-40262976 GAGAAATAGCAATTGGGCCAAGG - Intergenic
1118144009 14:63116427-63116449 CAGAAACAAAAATTAAGCCAGGG + Intergenic
1119298078 14:73549479-73549501 CAGAAAAAGAAATTGAGGCAAGG + Intronic
1119302367 14:73581663-73581685 CAGAAAAAGAAATTGAGGCAAGG + Intergenic
1119753698 14:77098738-77098760 CAGAACTAGTAACTGGGCGAGGG + Intronic
1120393031 14:83931840-83931862 CAGAAATAGAAATTGTACTGAGG - Intergenic
1120563239 14:86022594-86022616 CAAAACCAGAAATTGGCCCAGGG - Intergenic
1121643816 14:95504023-95504045 CAGAAACAGGCAGTGGGCCATGG - Intergenic
1122148022 14:99705504-99705526 TAAAAAGAGAAATGGGGCCAGGG - Intronic
1122207923 14:100157403-100157425 CAGAAATGCAAACAGGGCCAAGG + Intronic
1202837091 14_GL000009v2_random:86358-86380 CAGACTTAGAATTTGGCCCAAGG + Intergenic
1123552674 15:21398087-21398109 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1123553205 15:21401278-21401300 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1123588920 15:21835475-21835497 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1123589450 15:21838666-21838688 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1123974621 15:25541557-25541579 CAGAGATATAAATTGTGCCCTGG - Intergenic
1125197839 15:37069049-37069071 GAAAAAAAGAAATTGGGCCCTGG - Intronic
1125205700 15:37151628-37151650 CAGATCTAGAAACTGGGCAAGGG - Intergenic
1126109101 15:45165486-45165508 CATACATAGGTATTGGGCCAGGG - Exonic
1127274195 15:57427803-57427825 CAAAAGTAGAAATTAGGCCCTGG - Intronic
1127949435 15:63790068-63790090 CAGATAAGGAAATTGAGCCATGG - Intronic
1129168372 15:73792607-73792629 CACAAATAGAAAGGTGGCCAGGG + Intergenic
1129443700 15:75601219-75601241 CTGAAATAGAAATTAGAACAAGG + Intronic
1129722805 15:77887375-77887397 CAGAGATAGAATCTCGGCCAGGG - Intergenic
1130541512 15:84823590-84823612 CAGGAATAGAAATATGGGCAGGG + Intronic
1130567108 15:85005837-85005859 AAAAAAAGGAAATTGGGCCAAGG + Intronic
1130888121 15:88110783-88110805 CTGAAATGAAAATTGGGCCCAGG - Intronic
1131969437 15:97876793-97876815 CACAATTAGATTTTGGGCCAGGG - Intergenic
1202961024 15_KI270727v1_random:125307-125329 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1202961553 15_KI270727v1_random:128498-128520 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1133889327 16:9863956-9863978 CAGAAACAGGAATTGGGGCTGGG + Intronic
1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG + Intronic
1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136088845 16:27903970-27903992 CAGCAACAGCAAGTGGGCCAGGG - Intronic
1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136470810 16:30478777-30478799 CAGAAAAAGAGATTGGGACTAGG + Intronic
1137279282 16:46961391-46961413 CAAAAATAAAAAGTGGGGCAGGG + Intronic
1139029848 16:62866694-62866716 CAGAAATTGAAATTTGGCAATGG - Intergenic
1139424267 16:66869453-66869475 CAGAAATAGCTCTTGAGCCAAGG + Intronic
1139648977 16:68352293-68352315 CAGAAGTAGAGGTTGTGCCACGG - Exonic
1139798059 16:69498918-69498940 CAGATATGGAAATTGAGGCATGG - Intergenic
1140450954 16:75070361-75070383 CAGAAATATTACTTTGGCCATGG - Intronic
1141928467 16:87184682-87184704 CAAAAATATAAATTGAGCCCGGG + Intronic
1142623121 17:1177490-1177512 CAGAAAAGGGAATTAGGCCAAGG - Intronic
1142883712 17:2899803-2899825 CAAAAATAAAAATAGGACCACGG - Intronic
1143198412 17:5095064-5095086 CAGTAATAGAAACTGTGCAAAGG - Exonic
1143328471 17:6117274-6117296 CATTCATAGAAATTGGGCCCTGG + Intronic
1143909023 17:10232324-10232346 CAGAAATATACATTGGCACATGG + Intergenic
1148453054 17:47793222-47793244 GAGAAAAAAAAATTGGGACATGG + Intergenic
1148619726 17:49025521-49025543 GGGAAATAGAAACTGGGGCAAGG + Intronic
1148766912 17:50044870-50044892 CAGATAGAGAAATTGAGGCATGG + Intergenic
1148854130 17:50569477-50569499 CAGAATTAGGAATAGGGCCTTGG - Intronic
1149389729 17:56176626-56176648 GAGAAAGAGAATTTGGCCCAAGG + Intronic
1149881718 17:60298674-60298696 CAGAAATATAAATTGGCCCCAGG - Intronic
1151135822 17:71945011-71945033 CCAACATAGAACTTGGGCCATGG + Intergenic
1151186880 17:72371229-72371251 CAGACATAGAAACTGGGTCTTGG + Intergenic
1151687732 17:75658966-75658988 CAGAGCTAGAATTTGGGCCTAGG + Intronic
1151920473 17:77150984-77151006 CAGAAATACAAAAAGGCCCAAGG - Intronic
1153608885 18:6861707-6861729 CAGAAATAAAATTGTGGCCATGG - Intronic
1153671424 18:7415856-7415878 CAGATACAGAAATTAGGCCCCGG - Intergenic
1154192379 18:12241443-12241465 CAGAAATAGAAATAGGGTCGTGG - Intergenic
1154443904 18:14417769-14417791 GAGAACTGGAAATTGTGCCAAGG - Intergenic
1154453590 18:14501484-14501506 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1154453891 18:14503395-14503417 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1156554659 18:38053569-38053591 CAGTAATAGTAATAGGACCAAGG + Intergenic
1157217111 18:45793411-45793433 CAGAGATAGGAATTTGCCCAAGG - Intergenic
1157734343 18:50033401-50033423 TATAAATAGAAACTGTGCCACGG - Intronic
1157784678 18:50470941-50470963 CAGAATTACAAACTGCGCCAGGG - Intergenic
1158210290 18:55041197-55041219 CAGGAATAGAAATTGAGGGATGG + Intergenic
1159083792 18:63764290-63764312 CAGACACAGTAATTGGGCTAAGG - Intronic
1159225860 18:65535126-65535148 TAGAAATAGAAATGGGGCTTTGG + Intergenic
1160210213 18:76871452-76871474 CAAAAACAGAAATTGGGACAGGG - Intronic
1160292580 18:77607869-77607891 CAGAAATAAAAATTGGCATATGG - Intergenic
1162142789 19:8594913-8594935 GTGAAATAGAAATTGTTCCAGGG + Intronic
1163920834 19:20287029-20287051 CAGAAGTATAAATGGGCCCATGG + Intergenic
1164022751 19:21322908-21322930 CAGAAATGTAAATGGGCCCATGG - Intronic
1164547689 19:29182725-29182747 CAGAATTAGAAATTAGCACATGG - Intergenic
1164680201 19:30129488-30129510 CAGAAATAGCATTTCTGCCAGGG - Intergenic
1164993036 19:32698261-32698283 CAGAGAGAGAAATTGGGGCCAGG + Intronic
1165225054 19:34348985-34349007 CAGAGAGAGAAGCTGGGCCAGGG - Intronic
1166277523 19:41764578-41764600 CAGAAATGAAAATGGGGGCATGG - Intronic
1166552463 19:43675417-43675439 CAGAAAGAGAAAGAGAGCCATGG - Intergenic
1167143189 19:47666260-47666282 GAAAAAAAGAAATTGGGCGAGGG - Intronic
1202635543 1_KI270706v1_random:40993-41015 CAGACTTAGAATTTGGCCCAAGG - Intergenic
925488420 2:4363582-4363604 CAGAAATACAAAATGGGGAAAGG - Intergenic
926288292 2:11508210-11508232 TAGGGATAGAAATTGGACCAGGG - Intergenic
927530455 2:23793348-23793370 CAGAAATACAATTCTGGCCAAGG + Intronic
928479766 2:31670374-31670396 CAGAAATATAAATTGAGGAAAGG - Intergenic
929615198 2:43301272-43301294 TTGAAAGAGAAATTGGGGCATGG - Intronic
932802399 2:74752543-74752565 CACAAATAGAAATGGAGCTAGGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935434793 2:103018236-103018258 CAGATATAGACATTCAGCCAAGG - Intergenic
937052574 2:118904503-118904525 CAGAGACAGAAATTTGGCCTGGG + Intergenic
937759470 2:125583315-125583337 TAGAAATAAAACTTGGTCCAGGG - Intergenic
938358593 2:130670814-130670836 CAGACTTAGAATTTGTGCCAAGG + Intergenic
938478298 2:131635670-131635692 CAGACTTAGAATTTGTGCCAAGG + Intergenic
939100228 2:137887240-137887262 GAGAACTGGAAATTGTGCCAAGG + Intergenic
939121775 2:138125865-138125887 CAGAAATAGCATTTGGACAAAGG + Intergenic
939377885 2:141393428-141393450 CAGAAATGCTAATTGGGCCTGGG - Intronic
940785824 2:157980290-157980312 CTGAAATAGAGATTGGGCCGTGG + Intronic
940851147 2:158689428-158689450 CAGAACTATAAAGTGGCCCAAGG + Intergenic
942872120 2:180747749-180747771 CAGGAAGAGAAAGTGGGGCAAGG - Intergenic
942888632 2:180960406-180960428 CAGAAATAGCAGTTGGCCCTGGG - Intergenic
943132959 2:183878555-183878577 CAAAAATAGAAAGTGGGAAAAGG - Intergenic
944145514 2:196503484-196503506 CAGAAAAAGAACTAGGGACAAGG + Intronic
945426103 2:209704651-209704673 AAGAAATAGAATTTGGGAGAAGG + Intronic
946604940 2:221393253-221393275 CAGAAATACTAATTGGGTCCTGG - Intergenic
946693540 2:222329120-222329142 CCTAATTAGAAAATGGGCCAAGG - Intergenic
948600914 2:239107047-239107069 AAGAAATGGAAATTTGTCCAAGG + Intronic
1169362257 20:4961001-4961023 CAGAGATGGAAACTGGGACAAGG + Intronic
1169568432 20:6881090-6881112 CAGAAATAGAATTCGGACCCAGG + Intergenic
1169715438 20:8611755-8611777 CAGATATAGAAACAGTGCCAAGG - Intronic
1170616410 20:17956070-17956092 CAAAAATAGAATTTGGGGCTGGG - Intronic
1171992306 20:31705980-31706002 CAGAAATAGCCTTTGGGGCAAGG - Intronic
1173950869 20:46992458-46992480 CAGACATGGAAGTTGGGGCATGG + Intronic
1175055307 20:56192462-56192484 CTGAAGTAGGAATTGGGCAAAGG - Intergenic
1176452186 21:6873457-6873479 GAGAACTGGAAATTGTGCCAAGG + Intergenic
1176820279 21:13649901-13649923 CAGACTTAGAATTTGGGCCAAGG + Intergenic
1176820591 21:13651821-13651843 CAGACTTAGAATTTGGGCCAAGG + Intergenic
1176830358 21:13738506-13738528 GAGAACTGGAAATTGTGCCAAGG + Intergenic
1177320584 21:19514380-19514402 CAGAAATAGAAATCAGACTATGG + Intergenic
1177548911 21:22596000-22596022 CAGGAATTGAAATCGAGCCAAGG + Intergenic
1178244457 21:30937161-30937183 CAGAACAAGAATTTGGGCAAAGG + Intergenic
1180365166 22:11932234-11932256 CAGACTTAGAATTTGGCCCAAGG + Intergenic
1180478599 22:15733010-15733032 CAGACATAGAATTTGTGCCAAGG + Intergenic
1180478894 22:15734781-15734803 CAGACATAGAATTTGTGCCAAGG + Intergenic
1180478997 22:15735411-15735433 CAGACTTAGAATTTGTGCCAAGG + Intergenic
1180479409 22:15737918-15737940 CAGACATAGAATTTGTGCCAAGG + Intergenic
1183070590 22:35393445-35393467 CTGAAAGAGAAAATGGGGCAAGG - Intronic
1183696813 22:39428251-39428273 CAGAAATGGCCATGGGGCCAAGG + Intronic
949464021 3:4325399-4325421 CAGAAAGAGAAAAGGGACCAAGG + Intronic
949602060 3:5610801-5610823 CTGAAATATTAATTGTGCCAAGG + Intergenic
950326406 3:12114271-12114293 CAGAATTAAAAATTGGGCAAAGG - Intronic
950738346 3:15029657-15029679 GAAAAATAGAAATTGGGCCTAGG + Intronic
951692186 3:25408082-25408104 CAGAAACAGACATTGAGACAAGG - Intronic
952041527 3:29267480-29267502 CCCAAATTGAAATTAGGCCAGGG + Intergenic
952163105 3:30715881-30715903 CAGAAATACAAAGTGGGGCCAGG + Intergenic
952204890 3:31171287-31171309 AGGAAACAGAAATTGGGACATGG - Intergenic
952551113 3:34477825-34477847 CAGAAAAAAAAATTGGACCCTGG - Intergenic
953401910 3:42630624-42630646 CATAAAGAGAGATTGGACCATGG + Intronic
955043112 3:55335847-55335869 TAGAAATGGAGATGGGGCCAGGG + Intergenic
956071201 3:65453908-65453930 CATAAATAGAATCTGGACCAAGG + Intronic
956529676 3:70203884-70203906 CAGAAACAGAAGTGGGGACATGG + Intergenic
956624926 3:71257660-71257682 AAGAAAAAGAAATGGAGCCACGG + Intronic
959421754 3:106136686-106136708 CAGAAATAGAATTTGGAACGTGG + Intergenic
959471209 3:106752774-106752796 CACAAATAGAAAGTAGGCAAAGG + Intergenic
960068236 3:113398664-113398686 CAGAAAGAGAACTTAGTCCAGGG - Intronic
961724701 3:128919801-128919823 CAAAATTGGAAATTGTGCCAAGG + Intronic
962462581 3:135628284-135628306 GAGAAATAGAAATTTAGCCTGGG - Intergenic
962700988 3:137999544-137999566 CAGCAATAGAAATCGGGCAGAGG + Intronic
963398448 3:144764209-144764231 CAGCAATAGAAAGTGGCACAAGG - Intergenic
963598049 3:147353616-147353638 CAGAGATAGAAATGGGGTGAAGG - Intergenic
963620973 3:147605932-147605954 GAGAAATCGAAATTGAGACATGG + Intergenic
964635580 3:158854923-158854945 CAGAAATATAAATTGGGGAAAGG - Intergenic
964910303 3:161772885-161772907 CAGAAAAAGAAATGAGGGCATGG - Intergenic
965798151 3:172463150-172463172 CAGAAACATAAATAGGGTCAAGG - Intergenic
966563310 3:181347500-181347522 CAGAAATAGAGATAGGGGCCGGG - Intergenic
969229946 4:5823166-5823188 CAGAAAAGGAAATGAGGCCAAGG - Intronic
969503899 4:7571551-7571573 GAGAAATGGAAAGTGGGTCATGG + Intronic
971721371 4:30249120-30249142 CAGAAATAGAATTTTGGGAAAGG - Intergenic
974109411 4:57510039-57510061 CAGAAATGGAATTTGGCACATGG - Intergenic
974423821 4:61714430-61714452 CCGAAATCAGAATTGGGCCAAGG - Intronic
974490137 4:62554135-62554157 CAAAAATATAAATTGGGGAATGG - Intergenic
974596081 4:64015914-64015936 CACAGTTAGAAATGGGGCCAAGG - Intergenic
975897021 4:79105785-79105807 CAGAAATAGAATTTGGAATATGG - Intergenic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
976652911 4:87455286-87455308 CAGGAATAGAAAATGGTCCCAGG - Intronic
977257987 4:94761015-94761037 CAGAAATAGAAAGTGAGGCTAGG + Intronic
978422515 4:108547800-108547822 CAGAAATTGAACATGGGTCAGGG + Intergenic
980654949 4:135769545-135769567 CAGAAAGAGAGATTGGGAAATGG + Intergenic
980827061 4:138086759-138086781 CAGAAATAGAGTTTGGGGAAAGG - Intergenic
981392253 4:144204876-144204898 GAGAAAGAGAGTTTGGGCCAGGG - Intergenic
981817025 4:148842683-148842705 AAGAAATAGAATTTCAGCCAGGG - Intergenic
984020682 4:174481389-174481411 CAGAAACATAAATTGGGGAAAGG + Intergenic
984363089 4:178762618-178762640 AAGAAACAGAAATTGGAACAGGG + Intergenic
985066989 4:186132332-186132354 CAGAGATAAACAGTGGGCCATGG + Intronic
1202762861 4_GL000008v2_random:126872-126894 CAGACTTAGAATTTGGCCCAAGG - Intergenic
985787464 5:1904953-1904975 CAGAGATACAAAATGGCCCAAGG + Intergenic
986078278 5:4360984-4361006 CAGAAATAAAAATTGTGTGAAGG - Intergenic
986320071 5:6623736-6623758 GAGAAATAGAAAGTGGGCATGGG - Intronic
986669404 5:10129408-10129430 AAAAAATAGAAATTGGGGCCAGG + Intergenic
990027836 5:51217269-51217291 CAGAAATATTAATTGGCCCATGG - Intergenic
990227998 5:53678201-53678223 CAGAAAAAGAAATTGGGCATGGG + Intronic
991650386 5:68846704-68846726 CAGATAAAGAAATTGGGATATGG + Intergenic
991666419 5:69004184-69004206 CAGGAATGGAAATTGGGCGGGGG + Intergenic
992196347 5:74343153-74343175 CAGAAATAGGAATCAGCCCAAGG + Intergenic
993537098 5:89100009-89100031 CAAAAACAGAAATTGGGGAAAGG - Intergenic
995132242 5:108642789-108642811 AAGGAATAGAAATCAGGCCATGG - Intergenic
996025820 5:118644714-118644736 CAGAAATAGAAATTAGGAATTGG + Intergenic
996775873 5:127131753-127131775 CAGATACAGAACTTTGGCCAGGG - Intergenic
996967311 5:129321301-129321323 CAAAGGTAGAGATTGGGCCATGG - Intergenic
1000005733 5:157182808-157182830 CACAAATAGCAGTTGGGCTAAGG - Intronic
1000195755 5:158956082-158956104 CAGATTTAGAAATTTGCCCAAGG + Intronic
1000519591 5:162279994-162280016 CAGAGATAGAGGTTGGGGCACGG + Intergenic
1001253214 5:170164640-170164662 CAGCAACACAAATTGGCCCAGGG - Intergenic
1002739027 5:181420780-181420802 AAGAAATAGAAAGTGGGCAGAGG + Intergenic
1003009482 6:2413294-2413316 CAAAAAAAGAAAGTGGGCAATGG - Intergenic
1003409104 6:5847738-5847760 CAGAAACAGAAATTAAGCCAAGG - Intergenic
1003675296 6:8198673-8198695 CAAAAATATAAATTGGGGAAAGG - Intergenic
1003950055 6:11108560-11108582 CAGAAGTAGCATTTGGGCAAAGG + Intronic
1003992753 6:11502874-11502896 TAAAAATAGAAATTGGGGCTGGG - Intergenic
1003996358 6:11544702-11544724 CAGAAAGAGAATTTTGGCAATGG - Intronic
1004629194 6:17405597-17405619 CAGAAAGTGAAACTGGGCAAAGG + Intronic
1007660350 6:43481183-43481205 CAGAAATAGTAACTGGTGCATGG + Intronic
1008047781 6:46869054-46869076 CAGAAACAGAAATTGGGTCCGGG + Exonic
1008504737 6:52218894-52218916 TAGAACTAGATATTGGGCAAAGG + Intergenic
1009312120 6:62168280-62168302 AAGAAATATAAAGTGGGCCTTGG + Intronic
1009884186 6:69604670-69604692 CGGAATTAGAGATTGGGTCATGG - Intergenic
1010047278 6:71460229-71460251 CAGATATAGACCATGGGCCACGG - Intergenic
1010595394 6:77756686-77756708 CAGAAATAGAAATAGAGAGAAGG - Intronic
1012169507 6:96001689-96001711 CAGGAGAAGAACTTGGGCCAAGG - Intergenic
1013691917 6:112655320-112655342 CAGAAATAGAAATGGGAGAATGG - Intergenic
1014177334 6:118345154-118345176 CAGAAATAGAATCAGGGACAGGG - Intergenic
1016536979 6:145118408-145118430 CAAAAGTAGTCATTGGGCCAAGG + Intergenic
1017195394 6:151694938-151694960 CAAAAACAGAAAGTGTGCCAGGG + Intronic
1017504403 6:155054431-155054453 CAGATATAGAAATTAGGTGAGGG + Intronic
1017545486 6:155446902-155446924 CAGAAATAGAAACTGAGCTTCGG + Intronic
1018597737 6:165501131-165501153 GAGAAAGACAAATTGGCCCAGGG - Intronic
1018606371 6:165602068-165602090 CAGAAATGGACAGTGGGACAGGG - Intronic
1019244137 6:170696332-170696354 AAGAAATAGAAAGTGGGCAGAGG + Intergenic
1020997801 7:15285956-15285978 CAAAAATATAAATTGGGGAAAGG + Intronic
1021514625 7:21470726-21470748 CAAATATAGAAACTGGGCCAAGG - Intronic
1021632299 7:22659290-22659312 CAGATCCAGAAACTGGGCCAGGG - Intergenic
1021770022 7:23990172-23990194 CAAAAATATAAATTGGGGAAAGG + Intergenic
1022183550 7:27944897-27944919 GAGAAATAGAAATTAGGCAAGGG - Intronic
1025144406 7:56492106-56492128 CAAAACTAGAATTTGGCCCAGGG - Intergenic
1025224191 7:57142484-57142506 CATAAATAGGACTAGGGCCATGG - Intergenic
1025260011 7:57412584-57412606 CAAAACTAGAATTTGGCCCAAGG - Intergenic
1027292334 7:76728125-76728147 CAGAAATAGATATTTGACCCAGG + Intergenic
1028329710 7:89575139-89575161 CAGAAATAGAATTTGGAATATGG - Intergenic
1030074438 7:105724276-105724298 CAGAAATGGAAATTAGGGCCGGG + Intronic
1030074688 7:105726195-105726217 CAGAAATGGAAATTAGGGCCGGG - Intronic
1031010770 7:116524529-116524551 CAGAGATGGAACTTGGGCGATGG + Intergenic
1031084825 7:117292069-117292091 AAGAAATAGAAAGCTGGCCAGGG - Intronic
1031112739 7:117631376-117631398 CATAAATAGAAACTGGGGTATGG - Intronic
1031866864 7:127047067-127047089 CAACAATATACATTGGGCCAGGG + Intronic
1032690829 7:134284913-134284935 CAGAAATAAAAATTTTGCAAGGG - Intergenic
1033441678 7:141385794-141385816 CAGAAATAGAAGTGGACCCAAGG - Intronic
1034125289 7:148666036-148666058 AAGATATAGAATCTGGGCCAGGG - Intergenic
1034417559 7:150973076-150973098 CAGAAGTAGAAACAGGCCCAGGG + Intronic
1034754718 7:153605567-153605589 CAGGTCTAGAAAGTGGGCCATGG + Intergenic
1034961038 7:155364572-155364594 GAGGAATAGAAATAGGGCCACGG - Intronic
1035334701 7:158120451-158120473 CTGAAATAGAGATTGGACGAAGG - Intronic
1035503987 8:111828-111850 AAGAAATAGAAAGTGGGCAGAGG - Intergenic
1037062228 8:14528722-14528744 CAGAAATAGAAATTGGGCCAGGG - Intronic
1037228171 8:16620901-16620923 CAGAAATACTGATTGCGCCATGG - Intergenic
1037605826 8:20436382-20436404 CAGCAAGAGAAAGTGGGCCTAGG + Intergenic
1038023942 8:23572706-23572728 CAGCAAGAGAAAATAGGCCAGGG - Exonic
1038859462 8:31371175-31371197 CAGAAACAGAAATTGGCAAATGG - Intergenic
1039266981 8:35836202-35836224 CAAAAATACAAAATGGGCAAAGG + Intergenic
1039398644 8:37248553-37248575 GAGAAGTAGAAATTGGGAAAGGG - Intergenic
1041324759 8:56652517-56652539 CAGAAATAGAGATTTTGCAAAGG + Intergenic
1042321110 8:67476477-67476499 CAGAAATAGAAATAGTACCTGGG + Intronic
1043267213 8:78281232-78281254 CAGAAGCAGAACTTGAGCCAAGG - Intergenic
1044054343 8:87549782-87549804 CAGAAACATAAATTGGGAAAGGG - Intronic
1044323272 8:90830516-90830538 CAGCAATACAAATTTGGCCAAGG + Intronic
1045253000 8:100496867-100496889 CAGAAAGAGAAATTGGGAATTGG - Intergenic
1045916481 8:107477833-107477855 CAGAGAAAGAAATTGGGTCGGGG - Intronic
1047015294 8:120717751-120717773 CAGATACAGAAACAGGGCCAGGG + Intronic
1050245730 9:3688081-3688103 GAGAAATAGAAATGGGGCTTTGG + Intergenic
1050679897 9:8098749-8098771 AAGAAAAAGAAAGTGGGCAAGGG - Intergenic
1050784417 9:9382495-9382517 CCCAAATAGAAACTGGGCAAAGG + Intronic
1051515772 9:17929182-17929204 GAGAAACAGAAATTGTACCATGG + Intergenic
1052147162 9:25063535-25063557 CATAAAAAAAAAGTGGGCCAAGG - Intergenic
1052700226 9:31929173-31929195 GAGAAATAGAATTTGCACCACGG + Intergenic
1053511683 9:38693229-38693251 AAGAAATAGAACTTTGGCAAGGG - Intergenic
1055500305 9:76896409-76896431 CAAAACTAGGAATTGGGCAAAGG - Intronic
1055844301 9:80542972-80542994 CAGAACTAGAACATGGGCCCTGG + Intergenic
1056457081 9:86771045-86771067 CAAAAACAGAAATTGGGGAAAGG + Intergenic
1056499772 9:87197391-87197413 AAGAAGCAGATATTGGGCCAGGG + Intergenic
1056967195 9:91174540-91174562 CAGAAATAGCAATTAGGTAAAGG - Intergenic
1057816488 9:98299728-98299750 CAGAAAAAGAAATTGAGACTGGG - Intronic
1058672698 9:107373954-107373976 CAGAAATAGAAAGAAGGCCAAGG + Intergenic
1058910234 9:109514146-109514168 CTGAAATAGAAAGTGGGGCTTGG - Intergenic
1059954400 9:119500626-119500648 CTAAAATAAAAATTGGGTCATGG + Intronic
1060036516 9:120260536-120260558 CAGAAATAGATCTTAGTCCAAGG + Intergenic
1060036567 9:120261112-120261134 CAGAAATAGATCTTAGTCCAAGG + Intergenic
1203516995 Un_GL000213v1:11058-11080 GAGAACTGGAAATTGTGCCAAGG - Intergenic
1203527080 Un_GL000213v1:99650-99672 CAGACTTAGAATTTGGGCCAAGG - Intergenic
1203543624 Un_KI270743v1:111753-111775 CAGACTTAGAATTTGGCCCAAGG - Intergenic
1203604327 Un_KI270748v1:45556-45578 AAGAAATAGAAAGTGGGCAGAGG + Intergenic
1185866735 X:3630932-3630954 CAGAAGTACAACTTGTGCCACGG - Intronic
1186840788 X:13483121-13483143 AAAAAAAAGAAATGGGGCCAAGG - Intergenic
1187019938 X:15370626-15370648 GACAAATAGCAATTGGGCCCAGG + Intronic
1187270553 X:17776154-17776176 CAGAGATAGCCCTTGGGCCACGG + Intergenic
1187300375 X:18043349-18043371 CAGGGATAGAAACTGGGGCAAGG + Intergenic
1187319955 X:18229571-18229593 CAGAGATAGCCCTTGGGCCACGG - Intergenic
1188268760 X:28112434-28112456 TAGAGATTGAAATTGGTCCACGG - Intergenic
1188688944 X:33105159-33105181 CAAAAACATAAATTGGGCAAAGG + Intronic
1188968661 X:36585559-36585581 CAGTAATACAAATTGGAGCAAGG + Intergenic
1189058265 X:37723409-37723431 CACAGATAGAAATGGGGTCAGGG - Intronic
1189379912 X:40495334-40495356 CAGCAATAGTGATTGGACCAGGG - Intergenic
1189565154 X:42234221-42234243 CAGAACTAGAAATAGAGCCCTGG - Intergenic
1190484412 X:50910549-50910571 CAGAAACAGAAGGTGGGACAAGG - Intergenic
1190522410 X:51293977-51293999 CAGAAAGGAAACTTGGGCCAAGG + Intergenic
1190637367 X:52449319-52449341 CAGAGACAGAATTTGGGCCATGG - Intergenic
1190648663 X:52546940-52546962 CAGAGACAGAATTTGGGCCATGG + Intergenic
1190679690 X:52814480-52814502 CAGAGACAGAATTTGGGCCATGG + Intronic
1191094516 X:56660432-56660454 CAGAAATAGAATTTGGAATATGG - Intergenic
1191097683 X:56690984-56691006 CAAAAATATAAATTGGGGAAAGG + Intergenic
1192666469 X:73093061-73093083 CAGAAACATAAATTGGGAAAAGG - Intergenic
1193616847 X:83699236-83699258 CAGAAACATAAATTGGGGAAAGG - Intergenic
1193629947 X:83872415-83872437 CAGGAGTAGAAATTAGGCTAGGG + Intronic
1193721003 X:84987688-84987710 CAGAAATTAAAATTGGGACCAGG - Intergenic
1194287230 X:92024900-92024922 CAAAAATAGGAATTGGGAAAAGG + Intronic
1194637152 X:96360346-96360368 CAGACATAGAAATTGGTTGAAGG - Intergenic
1195037556 X:100983649-100983671 CAAAAATAACAAGTGGGCCAGGG - Intronic
1195062632 X:101211107-101211129 CAGAAATAGAAAGCAAGCCAGGG - Intergenic
1195073703 X:101305684-101305706 AAGAAAAAGAAATGGGGCTAGGG + Intergenic
1195484212 X:105384368-105384390 CAAAAATAGACATTGGGGAAAGG - Intronic
1196334581 X:114516795-114516817 CTGAAACATAAATAGGGCCAAGG - Intergenic
1197036079 X:121875280-121875302 AAGAAATAGCAATTTGCCCAAGG + Intergenic
1197312829 X:124927370-124927392 CAGGATTAGAAATAGGGCCCAGG - Intronic
1197646043 X:129017823-129017845 CAAAAATATAAATTGGGGAAAGG - Intergenic
1198396708 X:136226443-136226465 TGGAAATATAAATTGGGCTATGG + Intronic
1199467719 X:148158135-148158157 AAGAAATAGAGATTGGGTCATGG + Intergenic
1199792647 X:151169516-151169538 CAGAAATTTAAATTTAGCCAGGG - Intergenic
1200243010 X:154507573-154507595 CAGAAGTAGGGATTGGGCCTGGG + Intronic
1200399600 X:156011373-156011395 CAGAAGTTGATATTAGGCCAAGG + Intergenic
1200604768 Y:5249468-5249490 CAAAAATAGGAATTGGGAAAAGG + Intronic
1202023034 Y:20487479-20487501 CAAAAATATAAATTGGGGAAAGG + Intergenic