ID: 1037065990

View in Genome Browser
Species Human (GRCh38)
Location 8:14578093-14578115
Sequence TCACCCAACTTTGATAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037065990_1037065996 8 Left 1037065990 8:14578093-14578115 CCTATTTTATCAAAGTTGGGTGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1037065996 8:14578124-14578146 GGGAGAGCAATATGCATGTTGGG No data
1037065990_1037065997 28 Left 1037065990 8:14578093-14578115 CCTATTTTATCAAAGTTGGGTGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1037065997 8:14578144-14578166 GGGAATACACATGAAGATTTTGG No data
1037065990_1037065995 7 Left 1037065990 8:14578093-14578115 CCTATTTTATCAAAGTTGGGTGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1037065995 8:14578123-14578145 GGGGAGAGCAATATGCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037065990 Original CRISPR TCACCCAACTTTGATAAAAT AGG (reversed) Intronic
907731948 1:57075103-57075125 TCATCAAACTTTGATTTAATAGG - Intronic
908655324 1:66382472-66382494 GCACCCCACTTTGCTAAATTGGG - Intergenic
909920203 1:81372172-81372194 TCAATCAACTTTTTTAAAATGGG + Intronic
913248888 1:116895062-116895084 TCATCAAATTTTGAAAAAATTGG - Intergenic
913452621 1:119002261-119002283 TCACCCCAGTTGGACAAAATAGG - Intergenic
917023477 1:170614971-170614993 TCAGCCATCTTTGATAAAGAGGG + Intergenic
920155648 1:203948605-203948627 TCACCCGACTTTTTTACAATAGG + Intergenic
920863888 1:209735330-209735352 TCACCTAACTATGATTAAATGGG + Intergenic
922874523 1:228929569-228929591 TAAACCAACTTTAAAAAAATGGG + Intergenic
1063333638 10:5187681-5187703 TTTTCAAACTTTGATAAAATTGG + Intergenic
1063794031 10:9490390-9490412 TCACTCTACATTGCTAAAATAGG - Intergenic
1064566282 10:16642003-16642025 TCAGCTAACTTTCATAAACTTGG + Intronic
1065348443 10:24772428-24772450 TCAGCAAACTGTGATTAAATGGG - Intergenic
1070552394 10:77501112-77501134 TCACCCAACAATGCTGAAATGGG - Intronic
1072008527 10:91282550-91282572 ACAGCCAACTTTGACAAAATGGG + Exonic
1073606411 10:104900172-104900194 TAAACCAACTTTGAGAAAAAAGG - Intronic
1075172924 10:120132507-120132529 TAGCCCAAATGTGATAAAATGGG + Intergenic
1080974300 11:37318376-37318398 TTAATCAACTTTTATAAAATTGG + Intergenic
1083094502 11:60235728-60235750 TCTCCCAAGTTTAACAAAATTGG + Intronic
1087567606 11:99882080-99882102 TCAGTCATCTTTGCTAAAATAGG - Intronic
1089968049 11:122670220-122670242 GCTCCCAACTGTGAGAAAATGGG + Intronic
1091322144 11:134659231-134659253 TCTTCCAGCTTTGATAAGATTGG + Intergenic
1094170081 12:27481750-27481772 TTTGACAACTTTGATAAAATGGG - Intronic
1096447647 12:51708312-51708334 TTTCCCAACTTTGATAAATAAGG + Intronic
1098203327 12:68080184-68080206 TCACCCAAATTGAAGAAAATAGG - Intergenic
1100624283 12:96314825-96314847 TCTCACAAAGTTGATAAAATAGG - Intronic
1101311895 12:103588227-103588249 GCAGCCAACTGTAATAAAATTGG - Intronic
1102392255 12:112558650-112558672 TCATCTATCCTTGATAAAATAGG - Intergenic
1102763043 12:115406191-115406213 TAACCCAATTTTAAAAAAATGGG + Intergenic
1105340443 13:19518418-19518440 CAACCCAACTTTTAAAAAATGGG + Intronic
1108635008 13:52324548-52324570 CAACCCAACTTTTAAAAAATGGG + Intergenic
1108652796 13:52498644-52498666 CAACCCAACTTTTAAAAAATGGG - Intergenic
1109094008 13:58087991-58088013 AAAACCAACTTTGAAAAAATAGG - Intergenic
1110573311 13:77028701-77028723 TCACCCAACTTTAAATAAATGGG - Intergenic
1115327061 14:32151813-32151835 TGACCCAGCATTGACAAAATGGG - Intronic
1117183161 14:53213160-53213182 TCACCCAAGTTTGAGAACACTGG + Intergenic
1118121243 14:62846066-62846088 TCACCAACCTTTGCTAAGATTGG + Intronic
1118400775 14:65377418-65377440 AAACCCAAATGTGATAAAATGGG + Intergenic
1121005626 14:90489080-90489102 TCTCCCAACTTTGGAAAAAAGGG + Intergenic
1121710386 14:96033948-96033970 TGATCCAACTTTTAAAAAATAGG + Intergenic
1121736432 14:96221119-96221141 TCCTCCAATTTTTATAAAATTGG + Intronic
1124528008 15:30475268-30475290 TCATCCAAATTTCTTAAAATAGG + Intergenic
1124649423 15:31463989-31464011 ACACCCAACAGTAATAAAATTGG - Intergenic
1124770650 15:32532438-32532460 TCATCCAAATTTCTTAAAATAGG - Intergenic
1125118747 15:36127239-36127261 TCACCAAAATTCAATAAAATAGG + Intergenic
1130070378 15:80642066-80642088 TCACCCTATTTTTATATAATAGG + Intergenic
1131837224 15:96402879-96402901 ACACCCAAATCTGATACAATTGG + Intergenic
1136648868 16:31648239-31648261 ACAACCAACATTGATAACATGGG + Intergenic
1141413064 16:83849355-83849377 TAACCCCACTTTTAAAAAATGGG - Intergenic
1143207520 17:5155181-5155203 AAACCCAAGTTTGATAGAATAGG + Intronic
1144717370 17:17443828-17443850 TCACCCAACTATGCTTAAAATGG + Intergenic
1146701229 17:34961960-34961982 ACCACCAACTTTGACAAAATAGG + Exonic
1149478546 17:56983714-56983736 CAACCTAACTCTGATAAAATTGG - Intronic
1149872838 17:60198666-60198688 AAACCCAAATTTGATAGAATAGG - Intronic
1150957742 17:69879912-69879934 TCATCCGACTTTGACCAAATAGG + Intergenic
1159197904 18:65142345-65142367 TCACCCATTTTTCATAATATTGG - Intergenic
1159416319 18:68153152-68153174 TCTCTCACCTGTGATAAAATCGG + Intergenic
926422042 2:12709267-12709289 TCAACCAACTATCATTAAATAGG - Intergenic
927167711 2:20341537-20341559 TCACTCAACTTTGGTAAAGAAGG + Intronic
928662737 2:33520130-33520152 CCCACCAACTTTGTTAAAATTGG + Intronic
928775060 2:34750599-34750621 TCAGACAACTTGTATAAAATAGG - Intergenic
929542973 2:42836547-42836569 CCACCCGACTCTGATAAAACAGG + Intergenic
935681298 2:105639886-105639908 TCACCCAAATGTGCTAAATTAGG + Intergenic
938946956 2:136221376-136221398 TCTCTCAGCTTTGATAAAATTGG - Intergenic
947055808 2:226101896-226101918 TAACCCAATTTTTAAAAAATGGG - Intergenic
1169883250 20:10370034-10370056 TCACCCAACTTTCACAAGAAAGG - Intergenic
1173977588 20:47198698-47198720 TCACCCAAGTTTTATATAATCGG - Intergenic
1178774410 21:35535734-35535756 TCCCACAATTTGGATAAAATAGG + Intronic
1180123754 21:45772126-45772148 TCACCCTACTCTGATATTATTGG + Intronic
1180561440 22:16618144-16618166 CAACCCAACTTTTAAAAAATGGG - Intergenic
1182569399 22:31225203-31225225 TCAACCAACATTGAATAAATTGG - Intronic
1183534218 22:38386870-38386892 CAACCCAACTTTTAAAAAATGGG + Intronic
952140448 3:30473147-30473169 TCATCCACCTTTGATAAATATGG - Intergenic
956594708 3:70953799-70953821 ACACACAACTTTGCTAATATGGG + Intergenic
956853880 3:73257028-73257050 TCACCCCACATTGATGGAATTGG + Intergenic
957133963 3:76260919-76260941 TCCCACAATTTTCATAAAATAGG + Intronic
957677828 3:83393310-83393332 TCACCCAACTTTCATAGACTTGG - Intergenic
960186904 3:114653871-114653893 TTCAACAACTTTGATAAAATAGG - Intronic
960519899 3:118642625-118642647 TCACACAAATTTGTTAAATTGGG + Intergenic
962680094 3:137790110-137790132 GTAACCAACTTGGATAAAATAGG - Intergenic
963260509 3:143187111-143187133 TCACACAATTTTCATATAATGGG - Intergenic
965470984 3:169091083-169091105 TCACCATTCTTTGATAAAAGAGG - Intronic
970390452 4:15605078-15605100 TCTCCCAAATTTGATGACATAGG + Exonic
971051246 4:22865098-22865120 CCACCCAAGTTTGATAACAAAGG + Intergenic
973570274 4:52231815-52231837 TCTCCCAACTTTTAAAATATTGG - Intergenic
974212624 4:58799990-58800012 TCAGCCAACATTGGAAAAATAGG + Intergenic
977402862 4:96555753-96555775 TCACCCAACTTCTATCTAATGGG + Intergenic
977747612 4:100568847-100568869 TCACCCATCTTTTATATGATAGG - Intronic
977759032 4:100708483-100708505 TAAACCATCTTTGATAACATTGG - Intronic
979026331 4:115581976-115581998 TCACCCAATCTTTCTAAAATAGG + Intergenic
981667391 4:147245383-147245405 TCAAGGAACTCTGATAAAATGGG + Intergenic
984459293 4:180012703-180012725 TCACCCACCTTTAATAAAATAGG - Intergenic
985626905 5:993784-993806 TCAACCAAGTCTGAAAAAATGGG - Intergenic
986424196 5:7614242-7614264 TGACCAAACTTTAAAAAAATGGG - Intronic
987105080 5:14630516-14630538 TAACCCAACTTTTAAAACATGGG - Intergenic
987548410 5:19344801-19344823 TCTCTAAACTTTGATCAAATAGG + Intergenic
987739723 5:21891490-21891512 TCTCCCAACTGTGATAGTATAGG - Intronic
987898434 5:23979506-23979528 TCACCCAACTCTGATCTTATTGG - Intronic
987917719 5:24237239-24237261 TGACACAACTTTGAAAAAGTAGG - Intergenic
988502258 5:31793190-31793212 TTAGCCAATGTTGATAAAATAGG + Intronic
992008966 5:72508484-72508506 TCACCCAACTGTGAAAAAAATGG + Intergenic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
994364980 5:98904194-98904216 TCACCTCACACTGATAAAATAGG - Intronic
999349380 5:150853542-150853564 TAACCAAGCATTGATAAAATTGG - Intronic
1000462666 5:161542430-161542452 TCACCCAAGATAGGTAAAATGGG + Intronic
1000568599 5:162882694-162882716 TCACCAAACTGGGAAAAAATAGG + Intergenic
1000725741 5:164768712-164768734 TCACCCAAATATTACAAAATTGG + Intergenic
1002138545 5:177124161-177124183 TTACCCAATTTTTAAAAAATGGG + Intergenic
1003042824 6:2703586-2703608 TGACCCTACTTTGAGAAAACAGG + Intronic
1003319801 6:5040855-5040877 TCCCCAAATTTTGACAAAATTGG - Intergenic
1004984110 6:21060301-21060323 ACTCCCAACTTAGATAAAATGGG - Intronic
1007332694 6:41126031-41126053 TTTCCCTACTTTGATAAAAGAGG + Intergenic
1007494445 6:42250010-42250032 TCACTGAACTGTGATAAAAAGGG + Intronic
1007908302 6:45486798-45486820 TCAATCAACTTTCATAAAAATGG + Intronic
1008792076 6:55248045-55248067 TCACCCACATTTTATAAAAGAGG - Intronic
1012378030 6:98586000-98586022 TCACCCCACTTCCCTAAAATAGG - Intergenic
1012621732 6:101353005-101353027 TCTCCCACCTTTTTTAAAATGGG - Intergenic
1013689593 6:112625570-112625592 ACAGTCAACTTTGATAAAAGTGG - Intergenic
1014158200 6:118136484-118136506 TGACTCAACTATGATAAAATTGG - Intronic
1015245242 6:131067239-131067261 ACACCAAACTTTAATAAAAGTGG + Intergenic
1016125204 6:140393316-140393338 TGACCCAATTTAAATAAAATAGG + Intergenic
1022318762 7:29268184-29268206 TCATCCATTTTTGATAACATAGG + Intronic
1023201927 7:37707287-37707309 TAAGCCTACATTGATAAAATGGG - Intronic
1024836490 7:53525811-53525833 ACACGCAACTTGCATAAAATGGG - Intergenic
1027760569 7:82273729-82273751 GCACACAACTTTTATTAAATTGG - Intronic
1028435460 7:90797963-90797985 TCACCCTACTTGCAAAAAATAGG + Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1032959709 7:137017243-137017265 TCACCTGACTTTAATAAACTTGG - Exonic
1033137181 7:138795293-138795315 TCACATAACAATGATAAAATAGG + Intronic
1034952380 7:155307860-155307882 TCACCATGCTTTGATAAAATTGG + Intronic
1036187887 8:6640379-6640401 TCACCCAATATTGAAAATATGGG - Intronic
1037065990 8:14578093-14578115 TCACCCAACTTTGATAAAATAGG - Intronic
1040921068 8:52617860-52617882 GCACCCAACTTTGAACAAACAGG + Intergenic
1041096714 8:54357584-54357606 CTACCCAACCTTGATAAAATGGG - Intergenic
1041370596 8:57155867-57155889 TCAGCCTACTTTGATATGATAGG + Intergenic
1041687313 8:60656370-60656392 TCATCCAAGTTTGATATATTTGG + Intergenic
1041709759 8:60883788-60883810 TGACCCAACCTTTATAGAATAGG - Intergenic
1041996791 8:64071386-64071408 TCAGCCAGCTTTGTTACAATGGG + Intergenic
1042831197 8:73030750-73030772 TCAAGTAACTTTCATAAAATTGG - Intronic
1043657932 8:82695776-82695798 TCACCGAATTTTGTAAAAATCGG + Intergenic
1051211010 9:14743722-14743744 TCACCTAACCTTGATAACTTTGG + Intronic
1053093687 9:35305264-35305286 TCACCAAACTTAGAAAAGATTGG + Intronic
1055201544 9:73668516-73668538 TCAAGCAATTTTGATAAATTTGG - Intergenic
1055442863 9:76353874-76353896 TCACCCAACACAGTTAAAATGGG + Intronic
1056529564 9:87474868-87474890 TCACACAACTGTGATAGAAATGG + Intergenic
1185941437 X:4324654-4324676 ACACCAAAATTTTATAAAATTGG + Intergenic
1186585317 X:10867157-10867179 GCAGACAACTCTGATAAAATAGG + Intergenic
1187758770 X:22556791-22556813 TCACCCATCTTTGAATAAACAGG - Intergenic
1189740525 X:44113131-44113153 TGACACAACTTTTAGAAAATGGG - Intergenic
1190949686 X:55131021-55131043 TCAGACAACATGGATAAAATAGG + Intronic
1193745740 X:85278009-85278031 TCACAAAATATTGATAAAATTGG + Exonic
1194665740 X:96675683-96675705 TCTCCAAACTTTGATTAAAATGG - Intergenic
1195152122 X:102082728-102082750 TCACTCTAGTTTGAGAAAATTGG - Intergenic
1196965551 X:121050915-121050937 TGATCCAACTTTCACAAAATTGG + Intergenic
1197939529 X:131774831-131774853 TAACCCAATTTTTAAAAAATAGG - Intergenic
1199388751 X:147255035-147255057 TCAGGCAACTTTGTAAAAATAGG + Intergenic
1199552836 X:149076980-149077002 GCACCCCACTTTGCTAAAGTGGG - Intergenic
1200758550 Y:7014892-7014914 TCAACAAACTATGAGAAAATGGG - Intronic
1202591739 Y:26492138-26492160 CAACCCAACTTTTAAAAAATGGG - Intergenic