ID: 1037069315

View in Genome Browser
Species Human (GRCh38)
Location 8:14623875-14623897
Sequence GTGGGTATTGAGTACAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037069315_1037069320 -2 Left 1037069315 8:14623875-14623897 CCTGGACTGTACTCAATACCCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1037069320 8:14623896-14623918 ACTTCTGGACTTTTCTGTGAGGG No data
1037069315_1037069321 20 Left 1037069315 8:14623875-14623897 CCTGGACTGTACTCAATACCCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1037069321 8:14623918-14623940 GAGAAATAAACTATTTTGTTAGG No data
1037069315_1037069319 -3 Left 1037069315 8:14623875-14623897 CCTGGACTGTACTCAATACCCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1037069319 8:14623895-14623917 CACTTCTGGACTTTTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037069315 Original CRISPR GTGGGTATTGAGTACAGTCC AGG (reversed) Intronic
904195848 1:28784891-28784913 GTGGATATGGAGGACAGGCCTGG + Intergenic
907820897 1:57967370-57967392 GTGGGTAGCAAGTACAGTTCAGG - Intronic
908764397 1:67541007-67541029 GTGGTTATTGATGACAGTCATGG - Intergenic
909780054 1:79533283-79533305 GTATGTATTGGGTACAGTCAAGG - Intergenic
912184797 1:107262323-107262345 GTGGGTAATGAGGGCAGTTCAGG + Intronic
924277215 1:242400987-242401009 GTGGGCAGTTAGAACAGTCCAGG - Intronic
1062861894 10:816728-816750 TTGGAGATTGAGTACATTCCAGG - Intronic
1062971643 10:1653363-1653385 GAGGGTGTTGATGACAGTCCAGG + Intronic
1065114765 10:22474469-22474491 GTCTGTAGAGAGTACAGTCCAGG - Intergenic
1067249586 10:44575548-44575570 GTGGGCATCAAGCACAGTCCAGG - Intergenic
1069677657 10:70260174-70260196 GTGGGGATTGAGTACAGCCTGGG + Intronic
1084894493 11:72255729-72255751 GTGGGTAGGGAGTCCAGTGCTGG + Intergenic
1085654347 11:78299044-78299066 GTAGGTCTGGAGTACAGTCCAGG + Intronic
1086027511 11:82312465-82312487 TTGGGTATTGAGTAGAGGCTGGG - Intergenic
1087788300 11:102380584-102380606 GTGTGAATTGTATACAGTCCAGG + Intergenic
1090626727 11:128614837-128614859 ATGGGCATTGAGTAGGGTCCTGG + Intergenic
1098061928 12:66572279-66572301 GTGTTTATTGAGTACAGTCTAGG + Intronic
1101898108 12:108770591-108770613 GTGGCTATTGGGTGCAGACCCGG - Intergenic
1102299475 12:111760527-111760549 CTGGGTATTTAGTACATACCAGG + Intronic
1112799896 13:103099082-103099104 GTGGGAACTGAGTACATGCCTGG + Intergenic
1114962578 14:27912213-27912235 GTGGATGTTGAGTAGAGTCATGG + Intergenic
1119925177 14:78486841-78486863 GGGGGTATTGATTATAGTCATGG + Intronic
1121909998 14:97781459-97781481 CTGAGTATTGATTACATTCCAGG - Intergenic
1122305280 14:100761919-100761941 GGGGGTATTGAGTGCAGTTTTGG - Intergenic
1122667353 14:103340578-103340600 GAGGGTATTGGATACAGTGCTGG + Intronic
1123145152 14:106122612-106122634 GAGGGGATTGAGTCCAGTCAAGG - Intergenic
1123150249 14:106174681-106174703 GAGGGGATTGAGTCCAGTCAAGG - Intergenic
1123184900 14:106507336-106507358 GAGGGGATTGAGTCCAGTCAAGG - Intergenic
1123196545 14:106622697-106622719 GAGGGGATTGAGTCCAGTCAAGG - Intergenic
1123205023 14:106704190-106704212 AAGGGGATTGAGTACAGTCAAGG - Intergenic
1123210021 14:106750631-106750653 AAGGGGATTGAGTACAGTCAAGG - Intergenic
1125185651 15:36926869-36926891 GTGATTATAAAGTACAGTCCTGG - Intronic
1126694511 15:51314642-51314664 GTGGGTAGAGAGGACATTCCAGG - Intronic
1127460161 15:59191279-59191301 GTGGATATTTAGTACAGACGGGG - Intronic
1132289265 15:100688161-100688183 GGGGGGATTGAGGAGAGTCCTGG + Intergenic
1133510190 16:6450562-6450584 GTGGGTATTAACTTCATTCCTGG + Intronic
1136679803 16:31952107-31952129 GAGGGGATTGAGTTCAGTCAAGG + Intergenic
1136693951 16:32059159-32059181 GAGGGGATTGAGTCCAGTCAAGG + Intergenic
1136794443 16:33002408-33002430 GAGGGGATTGAGTCCAGTCAAGG + Intergenic
1136875466 16:33851972-33851994 GAGGGGATTGAGTCCAGTCAAGG - Intergenic
1136890258 16:33965994-33966016 GAGGGGATTGAGTTCAGTCAAGG - Intergenic
1138324566 16:56153496-56153518 GTGGGTCTGGAATAGAGTCCAGG - Intergenic
1140132041 16:72171376-72171398 GTGGGTATTGCTAACAGTTCAGG - Intronic
1140290032 16:73644733-73644755 GAGGGTAATGCGTGCAGTCCTGG - Intergenic
1203082773 16_KI270728v1_random:1157620-1157642 GAGGGGATTGAGTTCAGTCAAGG + Intergenic
1203096707 16_KI270728v1_random:1264075-1264097 GAGGGGATTGAGTCCAGTCAAGG + Intergenic
1150520191 17:65858910-65858932 GTGGTTATTGATGACAGTCCGGG - Intronic
925003458 2:424506-424528 GGGGGTATAGAGTCCAGTCAGGG + Intergenic
925502515 2:4522089-4522111 GTGAGTATTGGGTGCAGACCCGG - Intergenic
926207394 2:10843642-10843664 GTGCATATTCAGTACAGTCAGGG + Intergenic
927185194 2:20477238-20477260 GTGGGGTTGGAGTACTGTCCAGG - Intergenic
932181245 2:69648278-69648300 GTGGGTTTTGAGGTCAGTCTTGG - Intronic
932592649 2:73076361-73076383 GTGGGAATTGAGGCCAGCCCAGG - Intronic
938395632 2:130945604-130945626 GCTGGTATTGAGTTCAGACCAGG + Intronic
942367322 2:175241257-175241279 TTGGATATTCAGTACAGCCCTGG - Intergenic
944809599 2:203315271-203315293 GTGGGTTTAGAGAACAGTTCTGG + Intergenic
945665497 2:212736299-212736321 GTGAGGATAGAGTACAGACCAGG + Intergenic
948054117 2:234998607-234998629 GTGGGCATTGAGTACATTCTTGG + Intronic
948481937 2:238255587-238255609 GTTGGTACTGAGTCCAGTGCTGG - Intronic
1174547691 20:51337984-51338006 GTGGGTATTGAGGAGGTTCCTGG - Intergenic
1184165768 22:42726735-42726757 CTGGGTGTTGTGAACAGTCCAGG - Intergenic
1184493446 22:44823808-44823830 GTGGGTACTGGGTGCAGTCTAGG + Intronic
1184505093 22:44895730-44895752 GTGGGTATTGTGCATAGTCATGG + Intronic
960173158 3:114486886-114486908 GTGGGTATTGAGAACAGATCAGG - Intronic
964192662 3:154022759-154022781 GTGTGTATTGAGTACAATAGAGG + Intergenic
967240763 3:187437127-187437149 GTGGGTGTTGAGGACGGTTCAGG + Intergenic
967356856 3:188581543-188581565 GTGGTCAATGAGTAAAGTCCAGG - Intronic
969557754 4:7924849-7924871 GTTGGTTTTGAGTCAAGTCCTGG - Intronic
973090677 4:46132509-46132531 GTGGTTATTACGTACAGGCCAGG + Intergenic
979046665 4:115874196-115874218 CTGAGTACTGAGAACAGTCCAGG - Intergenic
979463662 4:121011450-121011472 GTGAGAATTGAGTAAAGTCATGG + Intergenic
980236580 4:130114968-130114990 GTTGCTATTGAGTAAATTCCTGG + Intergenic
981706138 4:147661015-147661037 GTGGGTATTAAGGACATTGCTGG - Exonic
994994778 5:107046078-107046100 TTGGGTAATGTGTACAGTTCTGG - Intergenic
998292874 5:140933032-140933054 GTGAATATGGATTACAGTCCAGG + Intronic
1001801223 5:174545913-174545935 GAGGGTATGGAGTACAGGTCGGG - Intergenic
1005892878 6:30154295-30154317 GTGGGTGGTGAGTATAGACCTGG - Exonic
1006954413 6:37854893-37854915 GTTAGTAATGAGTACAGTCTAGG + Intronic
1007750467 6:44067958-44067980 GTGGGTATTGACCACAAGCCTGG - Intergenic
1008367707 6:50702014-50702036 GTGGCTATTGAGGACTGTCATGG - Intergenic
1026652135 7:72224912-72224934 GTGTGTATTTAGTAGAGACCGGG - Intronic
1026762007 7:73133913-73133935 GTTGGTTCTGAGTACAGTTCTGG - Intergenic
1027038348 7:74942737-74942759 GTTGGTTCTGAGTACAGTTCTGG - Intergenic
1027085215 7:75258745-75258767 GTTGGTTCTGAGTACAGTTCTGG + Intergenic
1030386617 7:108874649-108874671 GTGGGACTGGAGTAAAGTCCTGG + Intergenic
1034091804 7:148370693-148370715 GGGGCTATTGAGTTCAATCCTGG - Intronic
1034534710 7:151719618-151719640 GTGTGTGTTGAGTCCTGTCCTGG + Intronic
1035569149 8:660553-660575 GTGGGGATTCAGTACAGCCCGGG - Intronic
1037069315 8:14623875-14623897 GTGGGTATTGAGTACAGTCCAGG - Intronic
1037377145 8:18243200-18243222 GTGAGTAGTAAGTACAGTCATGG + Intergenic
1042756787 8:72223084-72223106 TGGGGTATTGTGTCCAGTCCTGG - Intergenic
1043466850 8:80517268-80517290 GTGGCTACTGAAGACAGTCCAGG + Intronic
1046858983 8:119069017-119069039 GTAGGTATTCAGTACATTCCAGG - Intronic
1052138354 9:24944195-24944217 GTAGGTCTTGAGTAAAGCCCAGG + Intergenic
1052301142 9:26953963-26953985 GTGGGTACTCAGTAGAGTCAAGG - Intronic
1055724046 9:79208548-79208570 GTGGGTATTGAGCGCAGTGAAGG - Intergenic
1058143995 9:101390348-101390370 GTGGGTTTAGAGAACAGTTCTGG + Exonic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060676692 9:125521672-125521694 GTGGGTTTTGAGTACTGGACTGG - Intronic
1197758625 X:130013191-130013213 TTGGGTGTTGAGTGGAGTCCAGG - Exonic
1197859014 X:130949844-130949866 GGGGCTAGTGAGCACAGTCCTGG + Intergenic