ID: 1037069365

View in Genome Browser
Species Human (GRCh38)
Location 8:14624652-14624674
Sequence TACTTGACCCCGGGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244710
Summary {0: 2, 1: 180, 2: 11450, 3: 69596, 4: 163482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037069365_1037069371 8 Left 1037069365 8:14624652-14624674 CCTCCGCCTCCCGGGGTCAAGTA 0: 2
1: 180
2: 11450
3: 69596
4: 163482
Right 1037069371 8:14624683-14624705 ACCTCAGCCTCCCAAGTAACTGG 0: 548
1: 16514
2: 118605
3: 229726
4: 286624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037069365 Original CRISPR TACTTGACCCCGGGAGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr