ID: 1037080469

View in Genome Browser
Species Human (GRCh38)
Location 8:14779155-14779177
Sequence GTTCCTCACATATTAAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037080467_1037080469 -8 Left 1037080467 8:14779140-14779162 CCATGCCTTTTTTGAGTTCCTCA 0: 1
1: 0
2: 1
3: 28
4: 342
Right 1037080469 8:14779155-14779177 GTTCCTCACATATTAAATCATGG No data
1037080465_1037080469 15 Left 1037080465 8:14779117-14779139 CCGTGATCCTTGTCTTTTGGTCT 0: 1
1: 0
2: 1
3: 34
4: 335
Right 1037080469 8:14779155-14779177 GTTCCTCACATATTAAATCATGG No data
1037080464_1037080469 16 Left 1037080464 8:14779116-14779138 CCCGTGATCCTTGTCTTTTGGTC 0: 1
1: 0
2: 1
3: 20
4: 256
Right 1037080469 8:14779155-14779177 GTTCCTCACATATTAAATCATGG No data
1037080466_1037080469 8 Left 1037080466 8:14779124-14779146 CCTTGTCTTTTGGTCTCCATGCC 0: 1
1: 1
2: 1
3: 27
4: 286
Right 1037080469 8:14779155-14779177 GTTCCTCACATATTAAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037080469 Original CRISPR GTTCCTCACATATTAAATCA TGG Intronic
No off target data available for this crispr