ID: 1037082074

View in Genome Browser
Species Human (GRCh38)
Location 8:14799642-14799664
Sequence CCTACTAGGCAGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037082064_1037082074 21 Left 1037082064 8:14799598-14799620 CCCCTTCTGAACTAAGAAGTGAA 0: 1
1: 0
2: 0
3: 36
4: 226
Right 1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG No data
1037082069_1037082074 -10 Left 1037082069 8:14799629-14799651 CCACAGGACTTCACCTACTAGGC 0: 1
1: 0
2: 1
3: 11
4: 88
Right 1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG No data
1037082065_1037082074 20 Left 1037082065 8:14799599-14799621 CCCTTCTGAACTAAGAAGTGAAT 0: 1
1: 0
2: 0
3: 16
4: 223
Right 1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG No data
1037082066_1037082074 19 Left 1037082066 8:14799600-14799622 CCTTCTGAACTAAGAAGTGAATT 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037082074 Original CRISPR CCTACTAGGCAGAGGAAGGA GGG Intronic
No off target data available for this crispr