ID: 1037086325

View in Genome Browser
Species Human (GRCh38)
Location 8:14855357-14855379
Sequence CTTGATACCCAGATCAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037086325 Original CRISPR CTTGATACCCAGATCAAGAA TGG (reversed) Intronic
902432534 1:16374452-16374474 CTTGATACCCAGAGCACGCTGGG - Intronic
903942550 1:26941771-26941793 CATGAGGCCCAGCTCAAGAACGG + Exonic
904494387 1:30878462-30878484 CTGGATCCCCAGAACAAGAAGGG - Intronic
906692511 1:47801849-47801871 GTTGAGACCCAGAGCAGGAATGG - Intronic
907399687 1:54217222-54217244 CTGGAGAACCAGTTCAAGAACGG - Intronic
908867279 1:68563262-68563284 CCTGATACCAAAATCAGGAAAGG - Intergenic
909861847 1:80616260-80616282 CTTGATACCAAAATCAGGCAAGG + Intergenic
912045023 1:105443253-105443275 CATAATACCTAGTTCAAGAAGGG - Intergenic
916337662 1:163691753-163691775 CTTTATTCCCACATTAAGAATGG - Intergenic
916533587 1:165681696-165681718 CTTAAGACCCAAATGAAGAAAGG + Intronic
917053361 1:170950209-170950231 CTTGATACCCAGAGCAGGCAAGG - Intronic
917944624 1:179955456-179955478 CCTGATCGCCAGATGAAGAAGGG - Intronic
918466229 1:184824180-184824202 TTTGATACCTTGATCATGAAGGG - Intronic
918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG + Intergenic
921418879 1:214923103-214923125 CTTGAGAGCCAGATAAAGAATGG + Intergenic
923011686 1:230093149-230093171 CTTGGTAGCCAAAGCAAGAAAGG + Intronic
923971061 1:239203769-239203791 GCTGATACCCAAATCAACAATGG + Intergenic
1063496189 10:6511113-6511135 TTTGATGCCCATATCAACAAGGG - Exonic
1066327807 10:34382539-34382561 CTTAATATCCAGCTTAAGAAAGG - Exonic
1072871727 10:99126869-99126891 CTTGATAGCGAGACCCAGAAGGG + Intronic
1072871996 10:99130292-99130314 CTTCATACCAAAACCAAGAAAGG + Intronic
1073023870 10:100471399-100471421 CGTGCTACCCAGATAAAGCAGGG + Intronic
1074582795 10:114736337-114736359 CTTGATAATCAAACCAAGAATGG - Intergenic
1075798060 10:125135097-125135119 AGTGATACCTGGATCAAGAAGGG - Intronic
1078836847 11:15038477-15038499 CTCAATACCAAGATCATGAAAGG - Intronic
1078926357 11:15879091-15879113 AGTGATGCCCAGTTCAAGAAAGG - Intergenic
1079376740 11:19899810-19899832 ATTAACACCCAGATCAGGAAGGG - Intronic
1079461199 11:20679656-20679678 ATTAAGACTCAGATCAAGAAAGG - Intronic
1080670089 11:34367956-34367978 CCTAATACCCAAATCAGGAAAGG + Intergenic
1083519686 11:63296778-63296800 CTATAAACCCAGATCAACAATGG + Intronic
1086082498 11:82919574-82919596 CCTAATACCCAAATCAGGAAAGG - Intronic
1091009945 11:131991735-131991757 CTAATTACCCAGATAAAGAAAGG + Intronic
1091206905 11:133827881-133827903 TTTTGTACCCAGATCATGAAGGG + Intergenic
1093118836 12:15243736-15243758 CTTCATCCCCAGATCTAGAAAGG - Intronic
1093533635 12:20197477-20197499 CCTGATACCAAAATCAGGAAAGG - Intergenic
1093604231 12:21070514-21070536 CCTAATACCCAAACCAAGAAAGG - Intronic
1095042576 12:37458994-37459016 CCTGATACACAGAGCAACAATGG + Intergenic
1095603580 12:44041921-44041943 CTTGAGAACCAGAGCAAGACAGG + Intronic
1095924571 12:47565388-47565410 TTTGATAACAAGAGCAAGAAAGG + Intergenic
1096876801 12:54635719-54635741 CTAGAGTCCCAGATCAGGAAAGG - Intergenic
1098786181 12:74758846-74758868 CCTAATACCCAAATCAGGAAAGG - Intergenic
1098959698 12:76727074-76727096 TTTAATACCCAAAGCAAGAAAGG + Intergenic
1099432317 12:82602535-82602557 GTTGAGAGCCAAATCAAGAATGG + Intergenic
1100473063 12:94910942-94910964 TTTGATACTCAGATCAGCAATGG + Intronic
1101991498 12:109489342-109489364 CTAGAGACCCAGACCAAGCAAGG - Intronic
1102765316 12:115427888-115427910 CTTTAGGCCCAGATCAAGGAGGG + Intergenic
1103424656 12:120822671-120822693 CTTGAGCCCCAGAGCAAGGAGGG + Intronic
1105354669 13:19648389-19648411 CATGATATCCAAAACAAGAATGG - Intronic
1108884436 13:55162881-55162903 ATTGATTCCTAGATCACGAATGG + Intergenic
1109199975 13:59419520-59419542 ATTGAAACCCAGATAAAGTAAGG - Intergenic
1109483836 13:62992891-62992913 CCTGATACCAAAATCAGGAAAGG - Intergenic
1110635421 13:77761802-77761824 CATGATATCCAGTTCAAGAAGGG - Intronic
1111560087 13:89933001-89933023 CCTAATACCAAAATCAAGAAAGG - Intergenic
1112251175 13:97781995-97782017 AGTGATACCTAGACCAAGAATGG - Intergenic
1112342876 13:98566888-98566910 CTTGAACTCCAGATGAAGAAAGG - Intronic
1113100411 13:106711540-106711562 CTTGATATAAAGGTCAAGAAAGG + Intergenic
1116076434 14:40117195-40117217 CCTGATACCCAAACCAGGAAAGG - Intergenic
1117400447 14:55354506-55354528 CATGAAAACCAGATCAAGAGTGG - Intronic
1117615832 14:57532785-57532807 CTTGATACCCAGGGCAATTAGGG + Intergenic
1118065976 14:62190517-62190539 TTTGACACCGAGTTCAAGAAGGG - Intergenic
1118452514 14:65917005-65917027 CTTGACACCCACTTCAAGGAGGG + Intergenic
1119611685 14:76068638-76068660 CTTGATTCCAAGAGCAAGAATGG - Intronic
1120829963 14:88989257-88989279 CTTGATATCCAGAGAGAGAAGGG + Intergenic
1121482530 14:94290214-94290236 ACTGAAACCCAGATCAAGAGAGG - Exonic
1129064640 15:72890533-72890555 CTTCATGCCAAGGTCAAGAAGGG + Intergenic
1130605194 15:85309497-85309519 CCTGATACCAAAACCAAGAAAGG + Intergenic
1130810557 15:87373291-87373313 CATAATACCAAAATCAAGAAAGG - Intergenic
1131414238 15:92238783-92238805 CTTGATACCAAAACCAGGAAAGG + Intergenic
1135660301 16:24290869-24290891 CTTGATACCAAGATCAGATAGGG + Intronic
1137759948 16:50932579-50932601 CTTGATTGCAAAATCAAGAAGGG + Intergenic
1137759952 16:50932610-50932632 CTTGATTGCAAAATCAAGAAGGG + Intergenic
1140953262 16:79839267-79839289 CTGGATACCCAGAGCAACTAGGG - Intergenic
1144482383 17:15638729-15638751 AATGAGACCCAGATCAAAAAGGG + Intronic
1144916300 17:18726303-18726325 AATGAGACCCAGATCAAAAAGGG - Intronic
1148408297 17:47440524-47440546 CTTATTGCCCAGATCTAGAAAGG + Exonic
1149090020 17:52766782-52766804 CCTGATACCAAAATCAGGAAAGG + Intergenic
1151176756 17:72294982-72295004 TTTGATACACATCTCAAGAAGGG - Intergenic
1152061991 17:78083741-78083763 CATGAAACCCCGGTCAAGAATGG + Intronic
1153905670 18:9659345-9659367 CTTGATGTACAGATCAAGGAAGG + Intergenic
1157997226 18:52572670-52572692 CTGGATCCCCACGTCAAGAATGG - Intronic
1158614638 18:58975360-58975382 CTTCATACCCAGATCTGGCAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
927146044 2:20167384-20167406 CTTGCTCCCCATCTCAAGAATGG - Intergenic
927174540 2:20396317-20396339 CCTGAGACCCAGATGATGAAGGG - Intergenic
929181928 2:39050008-39050030 CTTGAAAACAAGATCAGGAATGG - Intronic
933836974 2:86253628-86253650 TTTGATAACCAGGTCAAGACAGG + Intronic
937105241 2:119306200-119306222 ATTGCTACCCAGAAAAAGAAAGG + Intronic
937576638 2:123430536-123430558 CTTGATACCAAAACCAGGAAAGG - Intergenic
937602821 2:123759480-123759502 CCTGATACCAAAACCAAGAAAGG + Intergenic
938834600 2:135087949-135087971 CTTGATACCAAGTTCCAGTAAGG - Intronic
940322278 2:152390030-152390052 CATGAGGCCCAGCTCAAGAACGG + Intronic
942678718 2:178454812-178454834 CATGAGGCCCAGATCAAGAATGG + Intronic
1173270689 20:41532297-41532319 CTAGATAAACAGATCAGGAATGG + Intronic
1173828419 20:46062388-46062410 CTGGATACCCTGATCCAGAGTGG - Exonic
1174928724 20:54789755-54789777 CCTGAGAGCCAAATCAAGAATGG - Intergenic
1175240751 20:57546526-57546548 TGTCATACCCAGATGAAGAAAGG + Intergenic
1177601144 21:23316428-23316450 ATTGACACCCAGATCAAGAAAGG - Intergenic
1178712261 21:34928378-34928400 CTTGATACCCATCTCTATAAGGG + Intronic
1180851737 22:19025277-19025299 CTTGTTACCCACATCAGGCAAGG + Intergenic
1181464953 22:23105961-23105983 CTTCACACCCAGACCCAGAAAGG - Intronic
1185270593 22:49927893-49927915 CTTCATTCCCAGATGAGGAACGG - Intergenic
949486810 3:4547642-4547664 CATAATATCCACATCAAGAAAGG + Intronic
951134718 3:19091748-19091770 CTTGATACCCAAAACCAGCAAGG + Intergenic
951709164 3:25572047-25572069 CTTGATACACAGCTCAATACAGG - Intronic
951956447 3:28260306-28260328 CTTGATACTAAAAGCAAGAACGG - Intronic
954778690 3:53044140-53044162 CTTGGTAGCTAGATCCAGAATGG - Intronic
954805989 3:53221018-53221040 GGTGAGACCCAGATCAAGGAGGG + Intergenic
954903401 3:54039685-54039707 CTTGATACCCTGATCCACACAGG - Intergenic
955886392 3:63603409-63603431 CTTGAAAACCAGAACAAGACAGG - Intronic
957176078 3:76811654-76811676 CTTGACATTCACATCAAGAAAGG + Intronic
957476237 3:80727975-80727997 CCTAATACCCAAAGCAAGAAAGG - Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
959039829 3:101408449-101408471 CTTAATACCAAAACCAAGAAAGG + Intronic
959275022 3:104267794-104267816 CTTAATACCAAAACCAAGAAAGG - Intergenic
963622599 3:147630996-147631018 CTTGTTAGCCAGATCAACACAGG - Intergenic
964316719 3:155452595-155452617 CTTTATGGCCAGATCAAGTATGG + Intronic
964491639 3:157242211-157242233 CTTCATCCTCAGATCTAGAATGG + Intergenic
965722998 3:171682555-171682577 CTTGAAACCCAAATTAAGCATGG - Intronic
966261154 3:177981034-177981056 CTTGGAACTGAGATCAAGAAGGG + Intergenic
966991831 3:185240244-185240266 CTTGATACCAAAATCAGGCAAGG - Intronic
970841994 4:20484531-20484553 CTAGAGACCCAGATCATGCATGG - Intronic
970996420 4:22272345-22272367 CCTAATACCAAAATCAAGAAAGG + Intergenic
971541428 4:27821800-27821822 CTTGACAGCCAGATAGAGAAAGG - Intergenic
972473286 4:39427506-39427528 CTTGATACCAAAATAGAGAAGGG + Intronic
973788985 4:54361420-54361442 CTTGATACCCAAAGCAGGAGTGG - Intergenic
974286291 4:59871890-59871912 CATGAGACATAGATCAAGAAAGG + Intergenic
974614583 4:64265438-64265460 TTTTTTACCCAGATAAAGAATGG - Intergenic
974812381 4:66961003-66961025 CTTGATCCCCAGGTCAGGAAAGG + Intergenic
977302419 4:95282729-95282751 CCTGACACCCAGATGAAGGAAGG - Intronic
977623955 4:99169640-99169662 CCTGATACCAAAATCATGAAAGG - Intergenic
977896045 4:102366272-102366294 CTTGAAAGCCAGAACAAGACAGG + Intronic
979903083 4:126248252-126248274 CTTGATACCAAGATCAGACAAGG - Intergenic
979976149 4:127198211-127198233 CTTGATACCAAAATCAGGCAAGG + Intergenic
980595955 4:134954267-134954289 CCTAATACCAAAATCAAGAAAGG - Intergenic
981137782 4:141232056-141232078 CTTAATAGCCATATGAAGAATGG - Intronic
983900620 4:173129420-173129442 TTTCATAACCAGATGAAGAAGGG - Intergenic
985586225 5:737466-737488 CTTAATACCCAAACCATGAAAGG + Intronic
985600813 5:829654-829676 CTTAATACCCAAACCATGAAAGG + Intronic
989460559 5:41693092-41693114 CGTGATACCAAAATCAAGCAAGG - Intergenic
990712532 5:58601320-58601342 CTTAATACCAAAATCAGGAAAGG - Intronic
993450306 5:88065446-88065468 CTTGATACCAAAACCAAGCAAGG + Intergenic
993694519 5:91045203-91045225 CCTGATACCAAGACCAGGAAAGG + Intronic
994385233 5:99123086-99123108 GTTGATACCCAGATCAACTTTGG - Intergenic
994777840 5:104057802-104057824 CTTAATACCAAAATCAGGAACGG - Intergenic
994923968 5:106089499-106089521 CTTGAAAACCAGATCCACAAGGG + Intergenic
995595098 5:113739159-113739181 CTTGGTTCCCATTTCAAGAATGG + Intergenic
996655768 5:125934119-125934141 CCTGATACCCAAACCAGGAAAGG + Intergenic
997564075 5:134874047-134874069 CTTCATTCCCAGAGCCAGAAAGG - Exonic
998880004 5:146636039-146636061 TTTGGAACCTAGATCAAGAATGG - Intronic
999058092 5:148603079-148603101 CTTGATACCAAAATCCAAAAGGG + Intronic
1000258779 5:159565965-159565987 CCTGAAACACAGATCAAGAAGGG + Intergenic
1001248380 5:170123877-170123899 CTTGTTTCCCTGAACAAGAAAGG - Intergenic
1008259949 6:49353239-49353261 CCTGATACCAAAATCAAGCAAGG + Intergenic
1008651364 6:53566620-53566642 CTTGCAACCCAGATCAACACTGG - Intronic
1010164797 6:72902817-72902839 CCTAATACCCAAATCAGGAAAGG - Intronic
1012408948 6:98933897-98933919 CTTGATACAGAGATAAAGAGAGG + Intronic
1012710513 6:102597295-102597317 CTTTATATCCAGATCACGAGAGG + Intergenic
1019863913 7:3686980-3687002 CTTGATCTGCAGCTCAAGAAGGG + Intronic
1020996709 7:15274551-15274573 CCTGATACTCAAATCAAGAAAGG - Intronic
1021086824 7:16430519-16430541 CTTGACAGCCAGATTAAGTAGGG - Intergenic
1022199916 7:28106569-28106591 CTTGATCCCCATAGCAAGAAAGG - Intronic
1027838323 7:83275172-83275194 CCTGATACCCAAACCAGGAAAGG - Intergenic
1028059110 7:86287490-86287512 CTTAATACCCAAACCAAGAAAGG - Intergenic
1028961921 7:96758627-96758649 CCTAATACCCAAATCAGGAAAGG - Intergenic
1036221207 8:6922949-6922971 CCTGAGACCCAGATGATGAAAGG - Intergenic
1037086325 8:14855357-14855379 CTTGATACCCAGATCAAGAATGG - Intronic
1045392251 8:101727042-101727064 CTTCATGCCCAGTTCAAGACTGG + Intronic
1045603167 8:103742196-103742218 CTTTATATCCATCTCAAGAATGG - Intronic
1047148115 8:122228978-122229000 CCTGATACCCAAACCAGGAAAGG + Intergenic
1047606158 8:126476814-126476836 CCTGATACGCAGGCCAAGAATGG + Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1052638407 9:31132304-31132326 CCTAATACCCAAATCAGGAAAGG - Intergenic
1052715513 9:32111528-32111550 CTGGGTTCCAAGATCAAGAATGG + Intergenic
1058030288 9:100188663-100188685 CCTGATACCAAGACCAGGAAAGG - Intronic
1058446686 9:105061280-105061302 CTTGATACCCACTCCAAGACTGG - Intergenic
1059175518 9:112166712-112166734 CTTGGTACCCACGTCAAGGATGG + Intronic
1060776775 9:126380353-126380375 TTTGATACTCAGATCAAGGCTGG + Intronic
1187185941 X:16985726-16985748 GTAGATACCCAGATCAATCAAGG + Intronic
1189802450 X:44704511-44704533 CTTGATACCAATAACAAAAAAGG + Intergenic
1191839986 X:65505679-65505701 CTTCCTACCAAGATCATGAATGG + Exonic
1192216620 X:69163849-69163871 TTTCATACCCACATCCAGAATGG - Intronic
1192408697 X:70912980-70913002 CTGGAAACCCAAATCAAAAAGGG + Intergenic
1193237029 X:79119963-79119985 CTTGATACCAAAATCAAACAAGG - Intergenic
1193281935 X:79661662-79661684 CATAATACCCAAAACAAGAAAGG - Intergenic
1194278491 X:91916827-91916849 CCTAATACCAATATCAAGAAAGG + Intronic
1194891244 X:99382784-99382806 CTTGAAAACAAGATCCAGAATGG - Intergenic
1195333355 X:103825410-103825432 CTTGTTACCCAGAACTACAAAGG + Exonic
1200179714 X:154143078-154143100 CTGGCTACCCATAGCAAGAATGG - Intergenic
1200595825 Y:5138906-5138928 CCTAATACCAATATCAAGAAAGG + Intronic
1202303722 Y:23445291-23445313 CATGATAACCAGGTCAAGAATGG - Intergenic
1202567088 Y:26225302-26225324 CATGATAACCAGGTCAAGAATGG + Intergenic