ID: 1037087794

View in Genome Browser
Species Human (GRCh38)
Location 8:14874506-14874528
Sequence ATTTAAGCCAATATTTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 1, 2: 2, 3: 67, 4: 423}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037087794 Original CRISPR ATTTAAGCCAATATTTATGT GGG (reversed) Intronic
901615192 1:10533750-10533772 TTTTAAGCCATTATGCATGTTGG + Intronic
901721543 1:11202450-11202472 ATTTAAAACAATATTTTTTTTGG + Intronic
902052132 1:13572090-13572112 ATTTAAGTCAATATGTTGGTGGG + Intergenic
903688575 1:25152029-25152051 TTTTAAGGCAATAATTATGATGG + Intergenic
904569782 1:31454710-31454732 ATGTAAGTCAATATTTTGGTGGG - Intergenic
904637325 1:31892767-31892789 ATATCAACCAACATTTATGTTGG + Intergenic
904712809 1:32443695-32443717 ATTTGAGTCAATATTTTGGTGGG - Intergenic
906919048 1:50043852-50043874 ACATAAGCCAATTCTTATGTTGG + Intergenic
907167899 1:52431143-52431165 ATTTAGGCCAATATTGCTGGGGG + Exonic
907225869 1:52945755-52945777 ATATATGCCATTATTTTTGTTGG + Intronic
907621120 1:55981862-55981884 GTTAAAGCCAATATTTAAATAGG + Intergenic
907888736 1:58618393-58618415 GTTTAAGCCACTGTTTATTTGGG - Intergenic
908486784 1:64602732-64602754 ATGTAAACCATTATTTTTGTTGG + Intronic
909037954 1:70616044-70616066 ATTTAAGCCATTATCAATCTAGG + Intergenic
909755227 1:79217647-79217669 ATATAAGTCAATATTTCTGAAGG - Intergenic
909910962 1:81257153-81257175 ATATTAGCCAGTATTTATGGTGG - Intergenic
910476866 1:87616726-87616748 ATTAAATCTAATATTTTTGTGGG + Intergenic
910737687 1:90479679-90479701 CATTAAGACAATATTTATATAGG + Intergenic
910807972 1:91207580-91207602 ATTTGAGTCTATATTTTTGTGGG - Intergenic
912045961 1:105457792-105457814 ATTTGAGCCATTACATATGTTGG + Intergenic
912069108 1:105785890-105785912 AATCAACCCAATTTTTATGTAGG + Intergenic
914329549 1:146654004-146654026 ATTTCAGCCGAGATTTTTGTTGG + Intergenic
915029437 1:152864851-152864873 TTTAAAGCCAATTTTTATGAAGG - Intergenic
915425272 1:155820813-155820835 ATTTAAAACAATTTTTTTGTAGG - Intronic
915858728 1:159419263-159419285 ATTTAAGCTAAGATTTGGGTAGG - Intergenic
916466939 1:165082121-165082143 ATTGAAGGCAAGATTTAGGTAGG + Intergenic
916867015 1:168871075-168871097 AATTAATCCAATATTTAAATGGG + Intergenic
917311605 1:173684909-173684931 ATTCAAGTCAATATTTTGGTAGG - Intergenic
917694839 1:177511734-177511756 ATTTAAGCCAATTTGTCAGTAGG - Intergenic
917880968 1:179335508-179335530 ATTGAAGCCATTTTTTATGAAGG + Exonic
917887570 1:179401592-179401614 ATTTAAGACAATATTTGGGTGGG - Intronic
918709770 1:187712517-187712539 ATTTAAGACCATATTTCTGCTGG + Intergenic
918910659 1:190563783-190563805 ATTTCAAGCAATATTTATGAAGG + Intergenic
919235670 1:194838903-194838925 CTTTAAGCCTATATTTATTTTGG - Intergenic
919490545 1:198200118-198200140 ATTAAAACCAATATTTAATTAGG + Intronic
920578966 1:207086700-207086722 TTTTATGTCCATATTTATGTAGG + Intronic
920730518 1:208479501-208479523 ATTTCAGCCCTTATTTGTGTGGG - Intergenic
921074748 1:211691326-211691348 ATTTGAGTCAATATTTTAGTAGG + Intergenic
921275013 1:213510813-213510835 ATATAAGCCCTTATTTGTGTGGG + Intergenic
921585073 1:216936769-216936791 ATATAAGCCAAAATTTACATGGG - Intronic
921848938 1:219913527-219913549 ATTTCAACCAATGTTTATGTAGG + Intronic
921941995 1:220851552-220851574 ATTTAAGTCAGTATTTTTATTGG + Intergenic
922680653 1:227592631-227592653 ATTTAAGTCAATATTTTAGTGGG - Intronic
922690262 1:227683472-227683494 ATTTAGGTCAATATTTTAGTGGG + Intergenic
923188997 1:231602095-231602117 ATTTATGCCAATGTTTACATGGG - Intronic
924390236 1:243546876-243546898 ATGTCAACCAATATTCATGTTGG - Intronic
924735088 1:246748636-246748658 ATTTAAGTCAATATTTTTACAGG - Intronic
924858967 1:247901575-247901597 ATTTAAGTCAATATTTTGGTGGG - Intergenic
1063012866 10:2042373-2042395 ATATTTGCCAATATTTATTTAGG + Intergenic
1064740943 10:18433845-18433867 ATTTAAGACAATAGTTTTGATGG - Intronic
1064756598 10:18577023-18577045 ATTTGAGTCAATATTTTGGTAGG + Intronic
1064760356 10:18612732-18612754 ATTTAAGCCAATTATTATTCAGG + Intronic
1065655979 10:27950241-27950263 CTCTAAGCCAATCTTTATGCTGG - Intronic
1065931117 10:30479941-30479963 ATTTAAGTCAATATTTTAGTAGG + Intergenic
1066335192 10:34469658-34469680 TTATAAGCAAATATTTATATTGG - Intronic
1066393220 10:34995520-34995542 ATTTAAGCCAAAACATAAGTGGG + Intergenic
1068319063 10:55386667-55386689 ATGTATGCAAGTATTTATGTAGG - Intronic
1068671693 10:59729721-59729743 ATTTGAGTCAATATTTTGGTAGG - Intronic
1068675691 10:59767198-59767220 ACTTAAGTCAATATTTTAGTGGG - Intergenic
1069176201 10:65291983-65292005 ATGAATGCTAATATTTATGTAGG - Intergenic
1070960224 10:80493975-80493997 ATTAAAGCCAATGCTTGTGTTGG - Intronic
1071282979 10:84119654-84119676 ATTTAAGTCAATATTTTGGTAGG - Intergenic
1071390601 10:85171634-85171656 AGTGAAGCCAACTTTTATGTTGG + Intergenic
1072334910 10:94389343-94389365 ATTTGAGTCAATATTTTGGTAGG + Intergenic
1077738913 11:4823021-4823043 TTTTAAACCAAGATTTATCTTGG + Intronic
1079644631 11:22848045-22848067 ATTTCTGCCAATACTGATGTAGG - Intronic
1079906203 11:26250527-26250549 TTTTATGCCAAAATTTCTGTTGG + Intergenic
1080226830 11:29971368-29971390 ATGTATGCAAATATTTTTGTAGG - Intergenic
1080938900 11:36892469-36892491 ATTTCAGCCTTTATTTGTGTGGG - Intergenic
1083082111 11:60104623-60104645 ATTTGAGTCAATATTTTAGTAGG - Intergenic
1085998852 11:81954700-81954722 ATTTAAGTCAATATTTTAGTAGG + Intergenic
1086259969 11:84927616-84927638 GTTTAAGTAGATATTTATGTAGG - Intronic
1086479702 11:87221888-87221910 ATTTCAGCCAATATTAAAATTGG + Intronic
1086973351 11:93106764-93106786 ATTTGAGTCAATATTTTGGTAGG - Intergenic
1086987702 11:93268005-93268027 ATTTAAGTCAATATTTTAGTGGG + Intergenic
1087456666 11:98395473-98395495 ATTTGAGTCAATATTTTGGTAGG - Intergenic
1087549032 11:99623239-99623261 ATTTATGCCACAAATTATGTGGG + Intronic
1087639917 11:100745871-100745893 ATTTGAGTCAATATTTTGGTGGG - Intronic
1087684619 11:101249031-101249053 ATTTAAGGCAATATTTTAGTAGG + Intergenic
1087894924 11:103576534-103576556 ATTTGAGTCAATATTTTGGTAGG + Intergenic
1088497483 11:110445827-110445849 ATATTAGCTAATATTTATTTAGG - Intronic
1089121514 11:116138861-116138883 ATTTATACCAATAATTATGTCGG - Intergenic
1089946768 11:122482928-122482950 CTTTAAGCCACTAGTTATTTAGG - Intergenic
1090696653 11:129251005-129251027 ATTTAAGCCAAATTTGAGGTTGG - Intronic
1091814408 12:3425615-3425637 ATTTAAGTCAATATTTTGGTAGG - Intronic
1092505507 12:9094645-9094667 ACATCAGCCAATATTTATGTTGG - Intronic
1093356900 12:18177442-18177464 ATTTGAGTCAATATTTTGGTGGG + Intronic
1094045735 12:26164582-26164604 ATATAAGCCAATATAAATTTAGG - Intronic
1094132467 12:27089183-27089205 CTTGAAGCCCATTTTTATGTTGG - Intergenic
1094282723 12:28757894-28757916 ATTTAAGACAAGATTTGAGTGGG - Intergenic
1095122465 12:38436142-38436164 ATTTAAGTTAATATTTTTCTAGG + Intergenic
1096023155 12:48338824-48338846 CTCTAATCCAATTTTTATGTTGG + Exonic
1096207827 12:49738248-49738270 ATTTGAGTCAATATTTTGGTAGG + Intronic
1098248496 12:68544705-68544727 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1098531937 12:71551678-71551700 ATTATAGCCACTGTTTATGTTGG + Intronic
1098687759 12:73446555-73446577 ATTTAACCCAATGTTTATTTTGG - Intergenic
1098828071 12:75324190-75324212 ATATTAACCAATATTCATGTTGG + Intronic
1099566606 12:84256535-84256557 CTCTAAGTCAATATTTATTTGGG - Intergenic
1101006253 12:100403907-100403929 ATTTAAGCATCTAATTATGTGGG - Intronic
1102127804 12:110499750-110499772 AATAAAGCAAATATTTATTTTGG - Intronic
1103143413 12:118572214-118572236 ATTTAAGTCAATACATGTGTAGG - Intergenic
1104238742 12:126965815-126965837 ATGTAAGCCAATTTGTATGAAGG + Intergenic
1104323695 12:127775468-127775490 ATTTATACTAATATTTATATTGG - Intergenic
1105569579 13:21588889-21588911 ATTTAAGTCAATATTTTGATAGG + Intronic
1105714085 13:23044269-23044291 ATTGAAGTCTATATTTTTGTTGG - Intergenic
1105994548 13:25657584-25657606 ATCTAATCCAAGATTTATTTGGG - Intronic
1106288769 13:28341568-28341590 ATTATAGCCAACATTTATGGAGG - Intronic
1106476954 13:30107398-30107420 ATTTAAGGAAGTATTTCTGTGGG - Intergenic
1107368707 13:39716639-39716661 ATTTAAACATATATGTATGTGGG + Intronic
1107425241 13:40286520-40286542 AATTAACCCAATATTTATTGGGG + Intergenic
1108103718 13:46986017-46986039 ATCTAAGCCAATATTTCTCAAGG - Intergenic
1108358572 13:49649812-49649834 ATTTAACTAAATATTTATATTGG + Intergenic
1108783099 13:53860737-53860759 ATTTCAGCCAATATATATTTTGG - Intergenic
1109238430 13:59852363-59852385 ATTTCAGCCAAGAATTATGAAGG - Intronic
1109250123 13:60009557-60009579 ATTTAAGGCCATATAAATGTTGG - Intronic
1109403423 13:61865462-61865484 ATTTGGGCCATTATTTATGAAGG + Intergenic
1109556504 13:63982686-63982708 ATGTAAACAAATACTTATGTAGG - Intergenic
1109909342 13:68889849-68889871 ATTTGAGTCAATATTTTGGTAGG - Intergenic
1110604388 13:77414702-77414724 AATTAAGCTAACATTTCTGTCGG - Intergenic
1110653609 13:77971675-77971697 ATTTAAGTCAATATTTTAGTGGG - Intergenic
1111028050 13:82560105-82560127 ATTTAAGACAATATGTATTATGG - Intergenic
1112769967 13:102784121-102784143 TTTTAAGCCCATATTATTGTGGG - Intergenic
1112970787 13:105259352-105259374 ATTTAAGCCATGAGTTATTTGGG - Intergenic
1114133922 14:19824995-19825017 ATTTAAGGAAATTTTTATATAGG + Intronic
1114146263 14:19981138-19981160 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1114235926 14:20823797-20823819 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1114868290 14:26624723-26624745 AATTAAGCCTAAAATTATGTAGG - Intergenic
1116093906 14:40342934-40342956 ATTTCAGCCAGTATTTCTGGAGG + Intergenic
1116144400 14:41045243-41045265 ATTTAAAACATAATTTATGTCGG + Intergenic
1116147416 14:41092618-41092640 CTGTAAGCAAATATTTCTGTAGG - Intergenic
1116347472 14:43812819-43812841 ATTTAGGGCAATAATTATGTAGG + Intergenic
1117460875 14:55943395-55943417 ATTCAAGTCAAGATTTAGGTGGG - Intergenic
1117579436 14:57137305-57137327 AATTAAGCCAATATTCCTGAAGG + Intergenic
1118131653 14:62971698-62971720 ATTTATGCCTATATTTATGTGGG - Intronic
1118229638 14:63936188-63936210 ATTTCAGAAAATATTTATTTAGG + Intronic
1121288931 14:92758787-92758809 GTTTAAGCCATTATATATTTTGG + Intergenic
1122906580 14:104804461-104804483 ATTTAAGACACTAATTGTGTGGG + Exonic
1123576988 15:21680579-21680601 ATTTAAGGAAATATTTATATAGG + Intergenic
1123613610 15:22123047-22123069 ATTTAAGGAAATATTTATATAGG + Intergenic
1124155642 15:27223139-27223161 TTTTAATCCAATATTAATGTGGG + Intronic
1124785826 15:32679699-32679721 ATTTCAACCAATATTTATTCAGG - Intronic
1124934296 15:34155834-34155856 ATTTGAGTCAATATTTTGGTGGG - Intronic
1125279743 15:38031063-38031085 AATTCAGCCAATATTTATGGTGG - Intergenic
1126853242 15:52811975-52811997 ATATAAGCCTCTATTTATCTAGG + Intergenic
1126999637 15:54486953-54486975 ATATAAGCCAAGATTCAAGTAGG + Intronic
1129289525 15:74553647-74553669 ATTTAAGATATTCTTTATGTTGG + Intronic
1129972724 15:79794210-79794232 ATATAGGCCAATATATTTGTAGG - Intergenic
1130201659 15:81834827-81834849 ATATTAACCAATATTTTTGTTGG - Intergenic
1132013461 15:98296014-98296036 ATTTCAGAGAATATCTATGTTGG + Intergenic
1202985856 15_KI270727v1_random:414824-414846 ATTTAAGGAAATATTTATATAGG + Intergenic
1135090449 16:19510217-19510239 ATTTAAGCAAAATTTTATCTAGG + Intronic
1135520502 16:23173368-23173390 TTTTGATCCAATATTTATTTGGG - Intergenic
1136236488 16:28917015-28917037 ATTTAAGCCACTGTTAATTTGGG + Intronic
1140004012 16:71056934-71056956 ATTTCAGCCGAGATTTTTGTTGG - Intronic
1140287982 16:73622606-73622628 TTTTAAGTAAATATTAATGTTGG - Intergenic
1141024808 16:80536178-80536200 ATATAAGTCAATAATTATGTGGG + Intergenic
1141062858 16:80890607-80890629 ATATCAACCAACATTTATGTTGG + Intergenic
1142783312 17:2199603-2199625 ATTTAAAAAAATATTTTTGTAGG + Intronic
1146663943 17:34684099-34684121 ATTCAAGACAAGATTTAGGTAGG + Intergenic
1146764276 17:35505107-35505129 ATTTGAGTCAATATTTCGGTGGG + Intronic
1147280148 17:39353184-39353206 ATTTAAGCCACTTTTAATTTGGG + Intronic
1147810202 17:43163448-43163470 ATTTAAGTCAATATTTTAGTGGG - Intergenic
1148828857 17:50415961-50415983 ATTTGAGTCAATATTTTGGTAGG - Intergenic
1148955314 17:51348940-51348962 ATAAAAGCAAATATTTATATAGG - Intergenic
1149798736 17:59546432-59546454 TTATAAGCAAATATTTATGAGGG + Intergenic
1153149338 18:2072818-2072840 ATTTCATTCAATATTTATCTGGG + Intergenic
1153826262 18:8877947-8877969 ATTTGAGTCAATATTTCAGTGGG - Intergenic
1153830486 18:8918087-8918109 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1154029361 18:10738318-10738340 ATTTAAGCTAATGTTGATTTTGG - Intronic
1154065014 18:11099228-11099250 ATTTGTGCCAGTATTTCTGTAGG + Intronic
1154463389 18:14618724-14618746 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1156082830 18:33359920-33359942 ATTTAAGTCTATATTTTTATTGG + Intronic
1156117196 18:33799868-33799890 TTTTAATGCAATAATTATGTAGG + Intergenic
1156921297 18:42525312-42525334 TTTTAAGGTAATATTTATATAGG + Intergenic
1157281625 18:46350099-46350121 ATTTAAGCCTGTATTTCTCTGGG - Intronic
1158219329 18:55134034-55134056 ATATAAGACAATATATTTGTAGG + Intergenic
1159306430 18:66649195-66649217 ATTTAAACCTCTTTTTATGTAGG - Intergenic
1159461775 18:68730926-68730948 ATTTAAATTAATATTTATTTGGG + Intronic
1159722798 18:71914052-71914074 ATTTGATCCAATATTTGAGTGGG + Intergenic
1162267650 19:9589072-9589094 ATTTAAGTCAATATTTTGGTAGG - Intergenic
1162282002 19:9706283-9706305 ATTTAAGTCAATATTTTAGTTGG + Intergenic
1163929464 19:20374978-20375000 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1163991963 19:21007122-21007144 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1164587684 19:29486363-29486385 ATTTAACCCAAGAGTTTTGTAGG - Intergenic
1165277170 19:34764431-34764453 ATATAAACCCATATTTCTGTTGG - Intronic
1167412024 19:49349998-49350020 ATTTAAGGCACTTTTAATGTGGG + Intronic
1167497067 19:49825948-49825970 AATTAAGCCAATATTTTCCTGGG - Intronic
926378322 2:12257764-12257786 ATCTAAGCAATTATTTATGCTGG - Intergenic
926452914 2:13027590-13027612 ATGCAAGCCAATATTTATAAAGG - Intergenic
926472817 2:13282342-13282364 ATTTATGCAGATAATTATGTAGG + Intergenic
926879027 2:17520279-17520301 ATTGAAACCACTATTTATGTGGG + Intergenic
928382918 2:30836126-30836148 ATTTAAGGAATTATATATGTGGG - Intergenic
929306873 2:40373417-40373439 ATTTAAGTCATTATTCATATCGG - Intronic
929950022 2:46402049-46402071 ATTTATTCTAAAATTTATGTGGG + Intergenic
930273798 2:49287695-49287717 ATTTCAGCCAATATTTAGGTTGG - Intergenic
931027311 2:58125791-58125813 ATGTCAGCAAATATATATGTGGG - Intronic
931701396 2:64912094-64912116 ATTTAATACAAATTTTATGTGGG - Intergenic
931718094 2:65045379-65045401 ATTTAAGTCAATATTTTGATGGG - Intergenic
932160642 2:69456410-69456432 ATTCCAGCCAATATATATATTGG - Intergenic
932953685 2:76325485-76325507 ATTTATGCCAATAAATATTTTGG + Intergenic
933389314 2:81650998-81651020 ATTTGAGTCAATATTTTGGTGGG - Intergenic
935048530 2:99503433-99503455 ATTTGAGTCAATATTTTGGTAGG + Intergenic
935721380 2:105982355-105982377 ATTTGAGTCAATATTTTGGTGGG - Intergenic
935970687 2:108528203-108528225 ATTTGAGTCAATATTTTGGTAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936419494 2:112349682-112349704 ATTTGAGTCAATATTTTGGTAGG - Intergenic
936716171 2:115190207-115190229 ATTTAAGTCAATATTTTGGTGGG - Intronic
938881824 2:135597808-135597830 ATTTAAGTTAATTTATATGTGGG - Intronic
939546599 2:143562045-143562067 CTTTAAGCCAATATCTAATTTGG - Intronic
940173800 2:150856667-150856689 ATTGAATCCAACATTTATGATGG + Intergenic
940433593 2:153623909-153623931 ATTTAAGCCAATTTGTATATTGG - Intergenic
940795215 2:158070585-158070607 AATTAAGCCACTGTTTATGGGGG + Intronic
941725049 2:168851770-168851792 TTTTAAGCCATTATTTTGGTGGG - Intronic
941949925 2:171144560-171144582 ATTTGACCCATTATTTATTTAGG - Intronic
941989685 2:171542928-171542950 ATTTAAGCCTATATTCCTCTGGG - Intronic
942318564 2:174716334-174716356 TTTCAAGTCAATATTTGTGTTGG + Intergenic
942511238 2:176704361-176704383 ATTTCTGCCAGTATTTATTTTGG + Intergenic
943038614 2:182776288-182776310 ATTGAAACCCATATTTGTGTTGG + Intronic
943110164 2:183594812-183594834 ATTTATGGCAATTTTTATGCAGG + Intergenic
943408209 2:187514869-187514891 ATTTGAGTCAATATTTTGGTGGG + Intronic
943895572 2:193354327-193354349 ATTTAAGCAAATATTTATGTAGG + Intergenic
944531925 2:200675586-200675608 ATTTGAGCAAGTATTTCTGTTGG - Intronic
945289847 2:208116262-208116284 ATTTGAGTCAATATTTTGGTGGG + Intergenic
945720395 2:213411323-213411345 ATTTGAGTCAATATTTTGGTGGG + Intronic
946099268 2:217305215-217305237 GTTCAAGCTAATATTTATGTAGG + Intronic
946624731 2:221598894-221598916 ATTTAAAACAACATTTATTTGGG - Intergenic
946861354 2:224002828-224002850 AATTAAGCCAATATTTACTGAGG + Intronic
946971625 2:225099244-225099266 GTTTAAGCAACTATTTCTGTAGG + Intergenic
946980423 2:225207908-225207930 ATTTAAATCTAAATTTATGTGGG - Intergenic
947556440 2:231097649-231097671 ATTTGAGTCAATATTTTGGTGGG - Intronic
1168822569 20:785446-785468 ATTTAAGTCAATATTTTCATGGG - Intergenic
1169512351 20:6277950-6277972 ATTTAAATCAACATTTCTGTTGG + Intergenic
1171161559 20:22929234-22929256 ATTGAAGCCATTATTTTTGGTGG - Intergenic
1172030429 20:31978273-31978295 TTTTAAGACAATTTTTTTGTAGG + Intronic
1172420046 20:34808344-34808366 ATTTATCCAAATATTTATGGGGG + Intronic
1174395458 20:50244213-50244235 ATGTAAGCCATTATTATTGTGGG - Intergenic
1174970426 20:55269011-55269033 ATTTAAGTCAATGTTTATCTGGG - Intergenic
1175041989 20:56061371-56061393 AAATAGGCCAATATTTATTTTGG - Intergenic
1175513779 20:59554823-59554845 ATTTAAGTCAATATTTTAGTAGG - Intergenic
1176811137 21:13539648-13539670 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1177526410 21:22297014-22297036 ATTTATGAGAATATTTATGGAGG - Intergenic
1177602366 21:23332696-23332718 ATTTGAGACAATATTAATATTGG - Intergenic
1178837211 21:36108806-36108828 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1179670775 21:42946019-42946041 ATTTGAGTCAATATTTTGGTAGG - Intergenic
1179938813 21:44625121-44625143 ATTTCAGCCCATTTTTATGAAGG + Intronic
1181505982 22:23357532-23357554 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1181794216 22:25292594-25292616 ATTTAAGCAAATATTTTAATAGG - Intergenic
1182542772 22:31053982-31054004 AATTGAGCCAATATAAATGTAGG - Intergenic
949373436 3:3360886-3360908 ATTTAAGGCAATATGTAGGTTGG + Intergenic
949811281 3:8009143-8009165 TTGTAAGCCATTATTTATGTGGG + Intergenic
950279247 3:11692372-11692394 ATTTAAGCCATTCTCTAAGTGGG - Intronic
950845982 3:16016654-16016676 ATTTGAGTCAATATTTTGGTGGG - Intergenic
951248445 3:20367228-20367250 ATTTGAGTCAATATTTTGGTAGG - Intergenic
951453940 3:22869869-22869891 ATGTAAGCCACAATTTATATAGG + Intergenic
952123442 3:30271964-30271986 ATTCAAGCCAAGATGGATGTCGG + Intergenic
953486817 3:43307272-43307294 ATTTAAGGCAATATGTATCAAGG - Intronic
955107470 3:55912123-55912145 GTTTAAGCCAATATTTATACCGG - Intronic
955559265 3:60171160-60171182 ATTTAGGGCAATATTTCTGAGGG + Intronic
955663488 3:61326151-61326173 TTTTAAGACAAGATTTATCTGGG - Intergenic
955852549 3:63236371-63236393 ACTTATGCTAATATATATGTAGG - Intronic
955857164 3:63285497-63285519 ATTTAAAGCTATATTAATGTGGG + Intronic
956242339 3:67143998-67144020 ATATAAGCAGATATTTCTGTGGG - Intergenic
956541237 3:70341961-70341983 ATGTAAGCAAATATTTACTTTGG - Intergenic
957277988 3:78113597-78113619 GTTTAACCCAAAATTGATGTAGG - Intergenic
957594012 3:82237130-82237152 ATTTAAACCACTATTTATTCAGG + Intergenic
957617343 3:82547633-82547655 AAATATGCCAATATTTAAGTAGG + Intergenic
957694888 3:83623052-83623074 ATCTAAGCCTATTTTTATGATGG - Intergenic
957828038 3:85475408-85475430 TTTTAATTCAATATTTTTGTAGG - Intronic
957999806 3:87736820-87736842 ATTTGAGTCAATATTTTGGTAGG - Intergenic
960720203 3:120618082-120618104 ATTTGAGTCAATATTTTGGTGGG - Intergenic
961676240 3:128568722-128568744 ATTTATACCATTGTTTATGTGGG - Intergenic
962096639 3:132299330-132299352 ATTTAAGTCTATATTTTAGTGGG - Intergenic
962097479 3:132307148-132307170 ATTTGAGTCAATATTTTGGTAGG + Intergenic
962277170 3:134024365-134024387 ATTTGAGTCAATATTTTTGTGGG + Intronic
963181441 3:142361373-142361395 ATTTAAGCCCTTATTTCTCTTGG + Intronic
963626288 3:147678234-147678256 ATTCAGGCCAATATGTATCTTGG - Intergenic
963682643 3:148399018-148399040 ATTTATGGTAATATTTATTTTGG + Intergenic
963693835 3:148539832-148539854 ATGAAAATCAATATTTATGTAGG + Intergenic
964391769 3:156205313-156205335 ATTTAAGCCAAAATATTTTTTGG + Intronic
965004793 3:163006242-163006264 GTTTAAGTCAGTATTTATTTTGG - Intergenic
965128684 3:164666095-164666117 ACTTAATCCAGAATTTATGTAGG + Intergenic
965787727 3:172353429-172353451 ATTTAAGCCACTGTTAAGGTCGG - Intronic
965789536 3:172372844-172372866 AGTCAATGCAATATTTATGTTGG - Intronic
966017238 3:175155504-175155526 ATTAATGGCAATCTTTATGTTGG + Intronic
966280626 3:178222466-178222488 ATTTTAGCAAGTATTAATGTAGG - Intergenic
966364329 3:179166647-179166669 AATTGAGCTAATATTTATGTAGG + Intronic
967834688 3:193951023-193951045 TTTTAAGCTAATCTTTATTTGGG - Intergenic
968250576 3:197207498-197207520 ATTTATTCAAATATTTATGCAGG + Intronic
970078017 4:12247247-12247269 AATTCAGCCAATATTTATTTAGG - Intergenic
970877835 4:20893296-20893318 ATTAAAGCTAACATTTATGATGG + Intronic
970924116 4:21430595-21430617 AATTTAGCCATTATTTATGAAGG + Intronic
971893193 4:32553272-32553294 ATTTAAGAAAATATTTATACAGG - Intergenic
972217158 4:36910113-36910135 ATTTGAGTCAATATTTTGGTGGG + Intergenic
972785141 4:42319525-42319547 ATTTGAGTCAATATTTTGGTGGG + Intergenic
973093061 4:46162621-46162643 ATTAAAGCCACTTTTTATTTTGG + Intergenic
973200384 4:47494815-47494837 TTTTATGCCTATACTTATGTAGG - Intronic
973655106 4:53039005-53039027 GTTTAAGGAAATATTTTTGTCGG - Intronic
974620582 4:64348407-64348429 ATTCAAGGCAAGATTTGTGTGGG + Intronic
975168356 4:71203816-71203838 ATTTAAGCAAACATTTATTCAGG - Intronic
975205753 4:71642725-71642747 ATTTGAGTCAATATTTTGGTGGG + Intergenic
975911885 4:79276861-79276883 ATTTGAGTCAATATTTTGGTGGG + Intronic
976220131 4:82750148-82750170 ATGAAAGCAAATATTTTTGTGGG - Intronic
976244282 4:82992038-82992060 ATTTTAGCAAATATTTAAGGAGG - Intronic
976344700 4:83986815-83986837 ATTTATGTGAATATTTATATGGG + Intergenic
977043458 4:92041658-92041680 ATTTGAGTCAATATTTTGGTTGG - Intergenic
977411708 4:96674482-96674504 TGTTAATCAAATATTTATGTGGG - Intergenic
978314332 4:107418798-107418820 ATTTGAACCAATATTTTGGTAGG + Intergenic
978988348 4:115045268-115045290 AATCAAGCCAATCTTTATATAGG + Intronic
979231629 4:118353496-118353518 ATTTCAGCCAATGTTTATTGGGG - Intergenic
979894543 4:126143497-126143519 ATTTAAGTCAAGATTTATTCAGG - Intergenic
980073112 4:128264403-128264425 ATTTGAGTCAATATTTTGGTGGG + Intergenic
980200410 4:129649939-129649961 ATTTAATACAATAATTATCTGGG - Intergenic
980252120 4:130330977-130330999 ATTTATGCCAATATTTAACTTGG - Intergenic
980273018 4:130611473-130611495 ACTTTAGCCTATATTTATTTGGG - Intergenic
980279343 4:130699429-130699451 ATGTAAGCCAAAAAGTATGTGGG + Intergenic
980298314 4:130954561-130954583 ATTTAACTCAATGTTTATATAGG - Intergenic
980438641 4:132813689-132813711 ATTTCAGTCAATATTTTGGTGGG - Intergenic
981020236 4:140019828-140019850 CTTTAATACAATATTTAGGTAGG + Intronic
981686976 4:147465711-147465733 TTTTAAGCCAATATTTCTGGGGG + Intergenic
982155107 4:152511529-152511551 ATGTATGCCAATATTTCTGCAGG - Intronic
982211674 4:153042018-153042040 ATTTCTCCCAATATTTATGCAGG - Intergenic
982353232 4:154439226-154439248 ATTTATGCCAGTATTTTTGTAGG + Intronic
982662661 4:158225440-158225462 ATTTAAGTCAATATTTTAGTGGG - Intronic
983194088 4:164785518-164785540 ATTTAAGGAATTATTTATGTAGG + Intergenic
983306071 4:165988764-165988786 ACTTAAGTCAATATTTATTTAGG - Intronic
983795893 4:171862732-171862754 ATTTAAGCAAATATTTACAAAGG - Intronic
983898077 4:173102990-173103012 ATTTCAGTCAATATTTTGGTAGG + Intergenic
984302986 4:177947810-177947832 ATTTAAGCAATTATTTATGATGG + Intronic
984429543 4:179630252-179630274 AATTAATTCAATACTTATGTTGG + Intergenic
984805571 4:183748348-183748370 TTCTAGGCTAATATTTATGTGGG + Intergenic
985917538 5:2934379-2934401 CTTCAAGCCAATATTGATGAGGG + Intergenic
986109809 5:4702581-4702603 ATTCTAGCCAAAATTTATTTTGG + Intergenic
986818606 5:11440015-11440037 ATTTCTGCCAATAGTTATGCAGG + Intronic
987629044 5:20443575-20443597 ATTGATGTCAATATTTCTGTGGG + Intronic
987930435 5:24394079-24394101 ATTTAAGTCAATATTTTAGTAGG - Intergenic
989613371 5:43316307-43316329 ATTTGAGTCAATATTTTGGTGGG - Intergenic
990627259 5:57628237-57628259 ATTTTCGCCACTGTTTATGTGGG + Intergenic
990728494 5:58783165-58783187 TTATAAGCGTATATTTATGTGGG - Intronic
990929324 5:61070110-61070132 ATTTAATCCAATATATGTGTAGG - Intronic
991306186 5:65178373-65178395 ATTTGAGTCAATATTTTGGTGGG + Intronic
993054876 5:82970223-82970245 ATTTGAGTCAATATTTTAGTGGG - Intergenic
993484078 5:88460797-88460819 ATTTAAGCCCATAATAATGAAGG + Intergenic
993827986 5:92716410-92716432 ATTAATGCCTATATTTGTGTTGG - Intergenic
994849377 5:105035247-105035269 ATTCAAGACAAGATTTGTGTAGG + Intergenic
994985724 5:106931237-106931259 ATTTAAAAAAATATTTATTTAGG - Intergenic
995560678 5:113377836-113377858 ATTTATTCCAATATTTAATTGGG - Intronic
995867528 5:116707425-116707447 ATTTAAGTCAATATTTCAGTAGG + Intergenic
996206714 5:120746912-120746934 ATTTTATCCAATAACTATGTTGG - Intergenic
996226872 5:121010041-121010063 ATATAAGCCCCTAGTTATGTTGG - Intergenic
996435221 5:123426688-123426710 ATTTAAGCTTAAATTTATGAGGG + Intergenic
997810215 5:136960361-136960383 ATTTAAACCAATATTAATTATGG - Intergenic
998691271 5:144591255-144591277 ATTATAGCCTATATTTCTGTGGG + Intergenic
999641937 5:153681038-153681060 ATTTTAGCTAATAGTTTTGTAGG + Intronic
1000146322 5:158456677-158456699 ATTTAGGCATCTATTTATGTTGG - Intergenic
1000236929 5:159370613-159370635 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1001558327 5:172651751-172651773 ATTTGAGTCAATATTTTGGTGGG - Intronic
1002999005 6:2313646-2313668 ATTTGAGTCAATATTTTGGTAGG - Intergenic
1003300174 6:4873282-4873304 ATTTAAATCAATTTTTATTTGGG + Intronic
1004002310 6:11606608-11606630 AATTAAGCCATTATATCTGTTGG + Intergenic
1005116751 6:22346840-22346862 ACTTAAGCCAAAAGTTATGTTGG + Intergenic
1005300700 6:24467535-24467557 CTTAAATCAAATATTTATGTAGG + Intronic
1005329761 6:24738497-24738519 ATATAAGACTATATTTATATAGG + Intergenic
1005462046 6:26078490-26078512 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1006049401 6:31329970-31329992 ATTTAAGTCATTATTCAGGTGGG - Intronic
1006325666 6:33351940-33351962 ATTTAAGTCAACATTTTGGTGGG - Intergenic
1007564857 6:42842157-42842179 ATTTAAGTCAGAATTTATGTGGG - Intronic
1008123579 6:47644919-47644941 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1008240445 6:49103341-49103363 ATTTTAGCTATTATTTATTTTGG + Intergenic
1009177381 6:60477060-60477082 ATGTATTCCATTATTTATGTTGG + Intergenic
1010712881 6:79195725-79195747 ATTTAAGAAAATATTTCTGTTGG - Intergenic
1011449694 6:87479798-87479820 ATTTGAGTCAATATTTTGGTGGG - Intronic
1012119760 6:95351581-95351603 ATTTTTGCCAATATTTATTTTGG + Intergenic
1012568093 6:100685408-100685430 TTTTAAATCACTATTTATGTAGG - Intronic
1012691030 6:102311401-102311423 ATTATAGCAAATAATTATGTTGG - Intergenic
1013259517 6:108427475-108427497 ATACGAGCCAATATTTCTGTAGG + Intronic
1013658112 6:112266410-112266432 ATTCAAGCTAAAATTCATGTCGG - Intergenic
1015078721 6:129196664-129196686 ATTTAATCCAAGATTTAAATAGG - Intronic
1015083517 6:129258170-129258192 ACTAAAGCCAGTACTTATGTTGG - Intronic
1015172033 6:130264686-130264708 ATTTAAGTCAATATTTTAGTGGG + Intronic
1016088255 6:139942849-139942871 ATTGAAGCCCATATTTGTCTCGG - Intergenic
1016571063 6:145513393-145513415 ATTCATGCCAATATTTTTTTTGG - Intronic
1017076966 6:150627989-150628011 ATTTAAATAAATATTAATGTAGG - Intronic
1017280752 6:152622130-152622152 ATTTTACACAATATTTATGTGGG + Intronic
1017304937 6:152906457-152906479 ATTTAAGCGAAAATTGATATTGG + Intergenic
1020043786 7:5024426-5024448 ATTTAAGTCAATATTTTAGTAGG - Intronic
1020544826 7:9513824-9513846 ATTTAAACCAACCTTTATGATGG - Intergenic
1020950077 7:14664443-14664465 ATTTAAGCTCATATTTATATTGG + Intronic
1021181835 7:17516034-17516056 TTTTAAGTCAACATTTATGAAGG - Intergenic
1021787004 7:24162619-24162641 ATTTAAGCTAAGATTTGGGTGGG - Intergenic
1022278812 7:28884084-28884106 ATTTAAGCCACTATATTTGGTGG - Intergenic
1022731775 7:33033103-33033125 ATTCAAACTAATTTTTATGTGGG - Intronic
1023102787 7:36736057-36736079 ATTTAGGCATATATTTATGGTGG - Intergenic
1023436182 7:40142952-40142974 ATTTGAGTCAATATTTTGGTGGG - Intronic
1023504513 7:40885863-40885885 ATTTAAGCTAATGTTGGTGTTGG + Intergenic
1023799663 7:43822825-43822847 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1024809870 7:53196419-53196441 AAATCAACCAATATTTATGTTGG + Intergenic
1027686929 7:81289835-81289857 ATTTAAGCCAATTTTCACTTAGG + Intergenic
1027737381 7:81951046-81951068 ATTTGAACCATTGTTTATGTTGG + Intronic
1027816494 7:82979046-82979068 TTTTAAGTCAATATTTAAGAAGG + Intronic
1028167425 7:87553861-87553883 ATTACAGCCAATATTTCTATAGG - Exonic
1028233574 7:88333275-88333297 ATTTAAGTGAACATTTATTTGGG - Intergenic
1028334133 7:89629867-89629889 ATTTAAGTAAATATTTTGGTAGG + Intergenic
1028358750 7:89941502-89941524 ATGTAAAACAATATTTATGGAGG + Intergenic
1028793858 7:94882276-94882298 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1029663784 7:101980978-101981000 ATTTCAGGCAATATTTAGTTTGG + Intronic
1029927517 7:104333116-104333138 CTTTAAGTCAATATTTCAGTTGG + Intronic
1030090746 7:105856160-105856182 ATATCAACCAATACTTATGTGGG + Intronic
1030795722 7:113784624-113784646 ATTCAAGATAATATTTGTGTGGG + Intergenic
1031213861 7:118865407-118865429 ATTTAAAGCAATATTTATTTAGG + Intergenic
1032170658 7:129581974-129581996 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1032292100 7:130597777-130597799 ATTGAACCCAATATTGATGCTGG + Intronic
1032979465 7:137265137-137265159 ATTTAATTCAATATTTTAGTAGG - Intronic
1033995319 7:147338777-147338799 ATATTAGCAAATATTTGTGTTGG - Intronic
1034727069 7:153346264-153346286 TTTTTGGCCAATATTTATATAGG + Intergenic
1035965496 8:4187045-4187067 ATTTGAGCAAACATTTATATGGG - Intronic
1036420396 8:8590218-8590240 ATTTAAGCCAATATGTTCATTGG - Intergenic
1037061706 8:14519926-14519948 ATTTAAACCATGGTTTATGTTGG - Intronic
1037087794 8:14874506-14874528 ATTTAAGCCAATATTTATGTGGG - Intronic
1038023610 8:23570475-23570497 ATGTAAGCGAATGTTTATTTGGG - Intronic
1038603799 8:28977321-28977343 ATTTAAGAGAATATTTATTCAGG - Intronic
1040570773 8:48607387-48607409 ATTTTAGCCATTCTTTAGGTAGG - Intergenic
1040993303 8:53375336-53375358 ATTTAAGTCAATATTTTAGTGGG - Intergenic
1041227239 8:55712784-55712806 ATTTGAGTCAATATTTTGGTAGG + Intronic
1041515575 8:58695596-58695618 ATTTGAGTCAATATTTTGGTGGG + Intergenic
1041542870 8:59006852-59006874 AGTTAAGCCCATTTTGATGTAGG + Intronic
1041808159 8:61877229-61877251 ATTTAAGAGAATATGTATTTTGG + Intergenic
1042087735 8:65127343-65127365 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1042706772 8:71671751-71671773 ATGAAAGTTAATATTTATGTAGG + Intergenic
1043276204 8:78397162-78397184 ATTTGACCCATTATTTATTTAGG + Intergenic
1043620290 8:82182455-82182477 ATTTAAGATAATATTTAGGTGGG - Intergenic
1043818096 8:84828457-84828479 TTTCAAGCCAGTATTTATGGAGG + Intronic
1043931525 8:86096795-86096817 ATATTAGCCAACATTTATGTTGG - Intronic
1044184433 8:89235300-89235322 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1044631955 8:94288754-94288776 ATTTGGGTCAATATTTCTGTAGG + Intergenic
1045612811 8:103867425-103867447 ATTTAAGCCAATATTTAAAATGG - Intronic
1046403692 8:113742933-113742955 ATTTGAGAAAATAATTATGTAGG - Intergenic
1046619242 8:116510597-116510619 ATTTAAAGAAATATTTATGTGGG - Intergenic
1047316001 8:123733526-123733548 ACTGGAGACAATATTTATGTTGG + Intronic
1048320591 8:133396854-133396876 ATTTAAGCCATTATTATTTTAGG - Intergenic
1048676397 8:136787463-136787485 ATTTAAGCATATACTTGTGTTGG - Intergenic
1049633989 8:143676178-143676200 ATTTACGTCAATATTTTAGTAGG + Intergenic
1050184652 9:2960224-2960246 ATTTAAGCCAGTGTTAATTTGGG + Intergenic
1051090847 9:13405914-13405936 TTTTAAGAGAATATATATGTAGG - Intergenic
1051241728 9:15063987-15064009 ATTTAAGCAAATCTTCAGGTTGG + Intergenic
1051258730 9:15240578-15240600 ATTTAAGTCTATATTCATGAAGG + Intronic
1051775824 9:20632769-20632791 AGTTTAGCCAATATATATTTAGG - Intergenic
1052312111 9:27078635-27078657 ATTTAAGATAATATTTACATTGG + Intergenic
1052424748 9:28290229-28290251 TTCTAGGCTAATATTTATGTGGG + Intronic
1052508195 9:29381640-29381662 ATTTGAGTCAATATTTTAGTGGG + Intergenic
1053110578 9:35456511-35456533 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1055330820 9:75181713-75181735 ATTTAAGGATATATTTAAGTAGG - Intergenic
1055403504 9:75949477-75949499 TATTTTGCCAATATTTATGTTGG + Intronic
1055765113 9:79654463-79654485 ACTTAAACAAATATTTTTGTAGG - Intronic
1056200710 9:84273390-84273412 ATTTATGCATTTATTTATGTTGG + Intergenic
1056292657 9:85159263-85159285 ATTTGATCCAATCTTTATGGTGG + Intergenic
1059004824 9:110390749-110390771 AATTAATTCAATATTTCTGTGGG - Intronic
1059266785 9:113040631-113040653 ATTTAAGCACATATTTCTTTGGG + Intronic
1059816901 9:117926821-117926843 ATTTAAAACAATACCTATGTGGG - Intergenic
1060085148 9:120692403-120692425 ATTTAATCCAAAATTAATGATGG + Intronic
1061455307 9:130693170-130693192 ATTTACTCCAATATTTCTTTTGG - Intergenic
1061615536 9:131776368-131776390 CTTTATGCCAATATTTTTGTGGG + Intergenic
1186355544 X:8785603-8785625 ATCTCAGCAAATATTTATGGTGG + Intergenic
1186889010 X:13941802-13941824 GTTTAAGCCATTATGTATTTTGG + Intergenic
1187574604 X:20541261-20541283 ATTCAAGACAAGATTTGTGTGGG - Intergenic
1188140532 X:26545033-26545055 AATCAATCCAATATTAATGTAGG + Intergenic
1189034716 X:37483681-37483703 ATTTAAGTCAATATTTTGGTAGG + Intronic
1189566362 X:42245624-42245646 ATTTAAGAAAACATGTATGTGGG + Intergenic
1189632345 X:42968396-42968418 ATTTAAGCCATAATTTTTTTGGG - Intergenic
1189833704 X:45000264-45000286 ATTTAAGTCAATATTTTGGTAGG - Intronic
1189896635 X:45663623-45663645 ATTTTAGCCACTATTTATTAAGG - Intergenic
1190270377 X:48858542-48858564 ATTTGAGTCAATATTTTGGTCGG + Intergenic
1190486246 X:50927799-50927821 AATTATGCCAATACTTATTTAGG - Intergenic
1190924784 X:54893564-54893586 TTTTGAGCAAATATTTATGTAGG - Intergenic
1191616921 X:63179347-63179369 ATTTAAACGATTATGTATGTTGG + Intergenic
1191619376 X:63199576-63199598 ATTTAAACGATTATGTATGTTGG - Intergenic
1191639338 X:63413452-63413474 ATTTGAGTCAATATTTTGGTAGG + Intergenic
1191889809 X:65928381-65928403 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1191917866 X:66221804-66221826 ATTTGAGTCAATATTTTGGTAGG - Intronic
1192336339 X:70223417-70223439 ATTTAAGCCATATTTTATTTTGG + Intergenic
1192915361 X:75645930-75645952 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1193717437 X:84949207-84949229 ATTTTAGTCAATATTTTGGTGGG + Intergenic
1193947595 X:87757198-87757220 ATTTATGCCAATAAATAAGTGGG - Intergenic
1196106202 X:111898654-111898676 ATTTTAGTCTATATGTATGTGGG + Intronic
1196459975 X:115919685-115919707 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1196869512 X:120099514-120099536 ATTTAAGTCAATATTTTGGTAGG + Intergenic
1197034476 X:121857708-121857730 ATTTTATTCCATATTTATGTTGG + Intergenic
1197340863 X:125265370-125265392 ATTCAAGACAATATTTGGGTGGG - Intergenic
1197408765 X:126089432-126089454 TTTTAAGACAAGACTTATGTTGG - Intergenic
1197912775 X:131502924-131502946 ATTTAAGCAAATAAATAAGTGGG - Intergenic
1197916634 X:131542728-131542750 ATTTACGGCATTATTTATGGTGG + Intergenic
1198797448 X:140414053-140414075 ATTTCAGCCAGTATTTTTGCTGG + Intergenic
1200106702 X:153717907-153717929 ATTTATGCAAATACTTCTGTGGG - Intronic
1201259982 Y:12149444-12149466 ATTTGAGTCAATATTTTGGTGGG - Intergenic
1201309017 Y:12577653-12577675 ATTTGAGTCAATATTTTGGTGGG + Intergenic