ID: 1037087812

View in Genome Browser
Species Human (GRCh38)
Location 8:14874834-14874856
Sequence TTGAATGGATAACTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037087812 Original CRISPR TTGAATGGATAACTGGAGGA AGG (reversed) Intronic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498758 1:2989422-2989444 ATGGATGGATAACTGGATGGTGG - Intergenic
900896801 1:5488328-5488350 ATGAATGGATAGTTGAAGGATGG - Intergenic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
901289688 1:8114230-8114252 TTGGTTGGATAACTGGAAGACGG + Intergenic
901922188 1:12545268-12545290 TTGAATGAATGAAGGGAGGAAGG - Intergenic
902412888 1:16221777-16221799 ATGGATGGATGAATGGAGGATGG + Intergenic
904660713 1:32082682-32082704 ATGAATGGATCACTTGAGGTTGG - Intronic
906070899 1:43015723-43015745 ATGAAGGGAGAAATGGAGGAGGG - Intergenic
906132072 1:43466340-43466362 TTGATTGAATAACTGGGAGAAGG - Intergenic
907552906 1:55319371-55319393 TTCCATGGATAACTGGGGAAGGG - Intergenic
908480245 1:64532570-64532592 TTGAGTGGCAAACTGGAGGCCGG + Intronic
911093205 1:94034217-94034239 TTTATTGGGTAACAGGAGGAAGG - Intronic
911529535 1:99028231-99028253 TTTAAGGGATTAATGGAGGAAGG - Intergenic
912262010 1:108120057-108120079 TTGGATGAATAACTGAAAGAAGG - Intergenic
912509804 1:110181415-110181437 TTGAATGAATAAGTGAATGATGG - Intronic
913439447 1:118882408-118882430 TTGAATGCATCACTGCAGCATGG - Intergenic
913509075 1:119546233-119546255 TTTAATGCTTAACTGGAGGGAGG + Intergenic
915900031 1:159840274-159840296 TTGAGTGGTTAACTGCAGGTGGG - Intronic
917143093 1:171857411-171857433 TTGAGTAGATCCCTGGAGGAAGG + Intronic
917521734 1:175753420-175753442 CTGAATTGATAAGTGCAGGAAGG + Intergenic
918742664 1:188154759-188154781 TTGAATTTAAAACTGGAGAAGGG - Intergenic
921788956 1:219267635-219267657 GTGAATGAATAACTGAATGAAGG - Intergenic
922792858 1:228319739-228319761 ATGAATGGATGAATGGTGGATGG - Intronic
922995023 1:229949833-229949855 TTGTATGTGTAACTTGAGGAAGG - Intergenic
923273053 1:232374565-232374587 GAGAATGGAAAGCTGGAGGAAGG - Intergenic
1063270006 10:4497653-4497675 TTGAAAGGTTAACTGGATGATGG + Intergenic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1064999627 10:21326899-21326921 TTAAATGGACAACTGGAGGCTGG + Intergenic
1067709622 10:48637580-48637602 ATGGATGGATAAATGGTGGATGG + Intronic
1068874189 10:61979429-61979451 TCGATGGGAGAACTGGAGGAGGG + Intronic
1070259479 10:74840654-74840676 TTTATTGGATAACTAGAGGTTGG + Intronic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1073192183 10:101659336-101659358 TTGAGTGGCTTAGTGGAGGAAGG + Intronic
1073323839 10:102631272-102631294 ATGAATGGATACAGGGAGGATGG - Exonic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073564633 10:104524723-104524745 TCGAATGGAAGACTGAAGGAAGG + Intergenic
1074184109 10:111086391-111086413 TTGAATGAATAAAGGAAGGAAGG - Intergenic
1074247512 10:111709793-111709815 TTGAACTGAGAACTGAAGGAGGG - Intergenic
1075326862 10:121540078-121540100 TAGAAAGGATCACTGGATGAAGG + Intronic
1076122067 10:127944322-127944344 TTGAATGGCTAAATGGTGGGTGG + Intronic
1077150330 11:1070259-1070281 ATGAGTGGATAAATGGAGGGAGG - Intergenic
1077719186 11:4609814-4609836 ATGAGTGGCTAACTGTAGGATGG + Intergenic
1083257359 11:61504938-61504960 TTGAATGAATACCTGAAAGATGG + Intergenic
1083918449 11:65765870-65765892 TTGGATGGATAATTGGAAGGGGG + Intergenic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085564574 11:77501543-77501565 TTGTATGGATCACTGGAACAGGG - Intergenic
1085789057 11:79480260-79480282 ATGAATGAATAAATGGGGGAAGG + Intergenic
1085894504 11:80622328-80622350 TTGAATGAATGACTGGATAAGGG - Intergenic
1086257936 11:84902132-84902154 TTGAATGGAAATCTGGACGCAGG + Intronic
1087710734 11:101546827-101546849 TAGAATGGATAAATAAAGGATGG + Intronic
1088057663 11:105604702-105604724 GTGAATGGATGAGTGAAGGAGGG + Intergenic
1088901060 11:114117580-114117602 TGGCTTGGATAACTGGTGGATGG + Intronic
1090072265 11:123554260-123554282 TTGGAGGAATAACTTGAGGAAGG + Intronic
1090612259 11:128481968-128481990 CTGAATGGATGAGTGGAGGAAGG - Intronic
1090728224 11:129546653-129546675 TTGAATGGATTAGTGGAAAAAGG + Intergenic
1093536413 12:20228996-20229018 TTGACTGAATAACTGGAACAAGG - Intergenic
1094355590 12:29574194-29574216 GTGAATGAATGAATGGAGGAAGG - Intronic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1096413889 12:51396218-51396240 TTGAAGGGAGGAATGGAGGAAGG - Intronic
1096842817 12:54389874-54389896 TTGAATGGATGACTGAACGAAGG - Intronic
1098076993 12:66742453-66742475 TAGAATGGATTACTACAGGAAGG + Intronic
1098087558 12:66863493-66863515 TTGAACAGAGATCTGGAGGAAGG + Intergenic
1098369410 12:69740043-69740065 ATGATTGCATAATTGGAGGAGGG + Intronic
1099135880 12:78900617-78900639 GAGCATGGAGAACTGGAGGAAGG + Intronic
1099305391 12:80948268-80948290 ATGAATGGATAAATGGCGGTAGG + Intronic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1100571291 12:95845406-95845428 TCGAAGGGTTAAATGGAGGAAGG - Intergenic
1100671990 12:96823736-96823758 TTGAATGGATAAATGGTGAAAGG + Intronic
1101116563 12:101537669-101537691 TTGGTTGGATAACTGGAGAAGGG - Intergenic
1102222969 12:111207042-111207064 ATGAATGGATAAATGGATGGTGG + Intronic
1102396970 12:112594503-112594525 TCGAATGAATAAATGGAGGGAGG - Intronic
1102452758 12:113053935-113053957 TGGAATGGATGGATGGAGGATGG + Intergenic
1103070052 12:117933868-117933890 GTGGATGGAGAACTGGAGCACGG - Intronic
1103248244 12:119476870-119476892 TTAACTGGGTAAATGGAGGAGGG - Intronic
1103762082 12:123257944-123257966 TTTTATGGAGAACTGGAGAATGG + Exonic
1104296049 12:127514551-127514573 TTTAATGGAGAACTGGATGAGGG + Intergenic
1104557545 12:129814836-129814858 TTAAATGGATAGCAGGAGAAAGG - Intronic
1104793397 12:131498666-131498688 TTGAATCATAAACTGGAGGATGG - Intergenic
1104926017 12:132314173-132314195 GTGGATGGATAAATGGATGATGG - Intronic
1105328477 13:19391814-19391836 GTGAGAGGATAACTGGAGGCCGG - Intergenic
1108290416 13:48954646-48954668 ATGAATGGATAAATGTAAGATGG - Intergenic
1108618261 13:52157209-52157231 TTAAATGGACCAGTGGAGGAGGG + Intronic
1109928526 13:69181833-69181855 TGGTATGGATACCTGGAGGCTGG - Intergenic
1110174921 13:72544784-72544806 TTGAATGGATAACTAGATGGAGG + Intergenic
1110702296 13:78562837-78562859 TTGACTGAATAAATAGAGGATGG + Intergenic
1111157430 13:84346799-84346821 TTGAATGGATAAATGTACAATGG - Intergenic
1112025010 13:95403901-95403923 TTGGATGGATCGCGGGAGGAGGG - Intergenic
1114165671 14:20216240-20216262 TTGAAGGGATAACTGGCCCATGG - Intergenic
1114405601 14:22453189-22453211 TTGAGTGGAGACCTGGAGGAGGG - Intergenic
1114738684 14:25070538-25070560 TTGACTGAATAACTGGAAAAAGG + Intergenic
1115052023 14:29073969-29073991 TTGAATGGATAACTGTCCCATGG - Intergenic
1115159242 14:30374519-30374541 TTGAATGAATACCTGAATGAAGG + Intergenic
1115857022 14:37641043-37641065 TTGAGTGTAAAACTAGAGGAAGG + Intronic
1116749813 14:48869081-48869103 TTGATTGATTAACTGGAAGAAGG + Intergenic
1117219602 14:53589814-53589836 TTGACTGGATTAAGGGAGGAGGG + Intergenic
1120443950 14:84569852-84569874 TTGAATGGATAAATAAAAGACGG - Intergenic
1121180623 14:91926032-91926054 TTGAATGAATGAATGGCGGAAGG - Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121627165 14:95394346-95394368 ATGAATGGATGGCTGGATGATGG + Intergenic
1121944263 14:98104289-98104311 ATGGATGGATAAGTGGATGATGG - Intergenic
1122364531 14:101186747-101186769 TTGGATGGATTAGCGGAGGAGGG + Intergenic
1122838811 14:104444563-104444585 TTGAATGGGTAAGTGGTGAATGG - Intergenic
1122924812 14:104894700-104894722 TGGCATTGATAACTGGAGGTGGG - Exonic
1123126066 14:105947088-105947110 ATGCATGGATAAGTGGTGGACGG - Intergenic
1124651880 15:31480080-31480102 TTGGAAGGGTAACTGGAGGTGGG - Exonic
1125748292 15:42012146-42012168 GTGAATGGATAAGTGTGGGAGGG - Intronic
1127051858 15:55091891-55091913 TTGACTGGTTATCTTGAGGAGGG - Intergenic
1128248201 15:66147329-66147351 TTGAGTGAATGACTGGATGAAGG - Intronic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1129805480 15:78453226-78453248 TTAGAAGGAAAACTGGAGGATGG + Intronic
1130052708 15:80497120-80497142 TTGATTGAATAACCAGAGGATGG - Intronic
1130733832 15:86527932-86527954 TTGGATGGATGAATGGATGATGG - Intronic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1134435074 16:14249124-14249146 TTGAATGGATGATCGGAGGATGG - Intronic
1135183970 16:20298745-20298767 TTGAATGGGTAGGTGGATGATGG - Intergenic
1135630106 16:24029783-24029805 GTGAATGGATGAATGAAGGAAGG + Intronic
1136071353 16:27789391-27789413 ATGAATGGATGAGTGGATGATGG + Exonic
1137242381 16:46666970-46666992 TTGAATGCATAACTAGATGTGGG + Intronic
1137558434 16:49488093-49488115 CTGAATGGATGAGTAGAGGAAGG + Exonic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1140154376 16:72407480-72407502 TTGGGTGGATCACTGGAGGTCGG + Intergenic
1140908168 16:79427937-79427959 GTGAATGAATAAGTGAAGGAGGG + Intergenic
1141184870 16:81779690-81779712 TTGAATGGGGACCGGGAGGAAGG + Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141483927 16:84326185-84326207 GTGAATGGATAAATGATGGATGG - Intronic
1141483935 16:84326224-84326246 GTGAATGGATAAATGATGGATGG - Intronic
1141658065 16:85426598-85426620 ATGGATGGATAAATGGAAGAAGG + Intergenic
1142889975 17:2936927-2936949 CTGAATGAATAACTGAAGAAAGG - Intronic
1142996104 17:3761509-3761531 TTGAATGCATATCTGTGGGAGGG + Exonic
1143301220 17:5911977-5911999 ATGCATGGATCATTGGAGGATGG - Intronic
1143301454 17:5913653-5913675 ATAGATGGATCACTGGAGGATGG - Intronic
1143301482 17:5913812-5913834 ATGGATGGATCACTGGAGGTTGG - Intronic
1143301503 17:5913923-5913945 ATGGATGGATCATTGGAGGATGG - Intronic
1143301508 17:5913946-5913968 ATGGATGGATCATTGGAGGATGG - Intronic
1144248490 17:13392309-13392331 ATGAATGAATAACTGAAGGAGGG - Intergenic
1146466475 17:33090547-33090569 GAGAATGGATAAATGCAGGAAGG + Intronic
1147212279 17:38878677-38878699 TTGAAGGAACCACTGGAGGAAGG - Intronic
1147323406 17:39659139-39659161 TGGAATGGGTGCCTGGAGGAGGG + Intronic
1147403033 17:40192333-40192355 TTGAAAGGAAAGCTTGAGGAAGG - Intronic
1148742269 17:49899461-49899483 GAGAAGGGATAACTGGGGGAAGG + Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1153128612 18:1828095-1828117 TAGAATGGATCACTGGTGGAAGG - Intergenic
1153195035 18:2585524-2585546 TTGTATGGATACTTGAAGGATGG + Intronic
1153360926 18:4196067-4196089 TTGAATGAAGCACTGGATGAAGG - Intronic
1153971291 18:10229428-10229450 TGGAATTCATAACTGGGGGAGGG + Intergenic
1155127377 18:22891701-22891723 TTGACTGCATAACTGGACAAAGG - Intronic
1155506903 18:26542543-26542565 TTTATTGGATAACTGAAGTAGGG + Intronic
1155587683 18:27386428-27386450 ATGAATGGAAAAAAGGAGGAAGG - Intergenic
1157134033 18:45036698-45036720 TGGAATGGAGAATAGGAGGAAGG + Intronic
1157316561 18:46594667-46594689 TTGAATAGCTAATTGGAAGATGG - Intronic
1159514561 18:69441547-69441569 TTGAATGAATCATTGGAGGTAGG - Intronic
1159892069 18:73962343-73962365 TTGACTGAATAACTGGAAGAAGG + Intergenic
1160366415 18:78329683-78329705 GTGGCTGGAGAACTGGAGGAAGG - Intergenic
1161451724 19:4350112-4350134 TTGAACGGAGAACTGAAGGTGGG + Intronic
1161934503 19:7363323-7363345 GTGAATGGATAAATGGATGATGG + Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162827840 19:13264649-13264671 GTGACTGGAGAAGTGGAGGAAGG - Intronic
1163183087 19:15617778-15617800 TAGAATGTAAAAGTGGAGGAAGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163703619 19:18799553-18799575 ATGAATGGATGTATGGAGGATGG + Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164936513 19:32219090-32219112 ATGAATGAATAAATGAAGGAAGG + Intergenic
1166299883 19:41907547-41907569 ATGAATGAACAACTGGAGGGAGG - Intronic
1166327596 19:42060771-42060793 TGGAATAGAGACCTGGAGGAGGG - Intronic
1166956342 19:46468008-46468030 CTGGCTAGATAACTGGAGGATGG + Exonic
926001083 2:9333235-9333257 TTGAATGAATAACTTAATGAAGG - Intronic
926912554 2:17864522-17864544 TTGAAGGGATAAGGGAAGGAAGG + Intergenic
927984709 2:27400894-27400916 TTGGATGGATACCAGCAGGATGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929124493 2:38510915-38510937 TTGAAGGCATTTCTGGAGGATGG - Intergenic
931819680 2:65938773-65938795 ATGAATGGAAAAGTGGAGAAGGG + Intergenic
933216785 2:79639350-79639372 ATGGATGGATAACTGAATGAAGG + Intronic
935782309 2:106518991-106519013 TTGAAAGGATGAAGGGAGGATGG - Intergenic
937521575 2:122719189-122719211 TTGACTGAATAACTGGGAGAAGG + Intergenic
938152271 2:128897642-128897664 TTGATTGAATAACTGGGAGATGG + Intergenic
938183135 2:129202686-129202708 CTGATTTGATAACTGGAGCAGGG + Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939261212 2:139812070-139812092 TTGAATGGCTGACTGGATCAGGG - Intergenic
941092195 2:161190570-161190592 ATGAATGGATAACTGTAAGGTGG + Intronic
941138624 2:161747797-161747819 TTGAATGTACACCTGGAAGAGGG + Intronic
941771096 2:169346881-169346903 TTCAATTGCTAACTAGAGGAAGG + Intronic
941948015 2:171121690-171121712 TTGACTTGATAACTGGTTGATGG + Intronic
942188519 2:173447585-173447607 TTGATTGAATAACTGGGAGAAGG + Intergenic
942346757 2:175011356-175011378 TTGAATGGATAAAGGATGGATGG - Intergenic
942635127 2:177995523-177995545 TTGAATAGCAAACTTGAGGAGGG + Intronic
943189493 2:184657874-184657896 TCAAATGGATAATTGGAGTATGG + Intronic
947403688 2:229753088-229753110 TTTAATGGCTAACCGGATGAAGG - Intergenic
948085870 2:235247163-235247185 TAGAATGGACAACTGGATGAGGG + Intergenic
948409508 2:237748299-237748321 TTAAATGGATAACATGAAGATGG - Intronic
1170348610 20:15415770-15415792 TTGCATGGATATATGGATGATGG - Intronic
1170801994 20:19598264-19598286 TTGAATGGAAACCTGGAGCCTGG + Intronic
1172203985 20:33148945-33148967 TTGGATGGATGAATGAAGGATGG + Intergenic
1172216496 20:33239375-33239397 AAGGATGGATAACTGGATGATGG - Intronic
1172417226 20:34779610-34779632 TAGAATGTATAACTGAATGAAGG - Intronic
1172619596 20:36310253-36310275 TTGCATGGATAAAGGCAGGAAGG + Intronic
1173028592 20:39333185-39333207 TTGAATGGGTACTTGAAGGACGG + Intergenic
1173896876 20:46557845-46557867 TTGAATGAATAAATGGAAGAAGG + Exonic
1174358166 20:50011835-50011857 ATGAGAGGATGACTGGAGGAAGG + Intergenic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1174748031 20:53083808-53083830 TTGCATTGATAACTTGAAGAGGG + Intronic
1174948085 20:55010954-55010976 TTGAAAGGAGAAATGGAGGTTGG + Intergenic
1175063802 20:56268091-56268113 TTGAATGAATGAATGGATGAAGG - Intergenic
1175817390 20:61890444-61890466 ATGGATGGATAAATGGATGATGG + Intronic
1176878499 21:14162295-14162317 GTGAATGGATACCGGGGGGATGG + Intronic
1177218049 21:18154671-18154693 TTGATTGAATAACTAAAGGAAGG + Intronic
1177759054 21:25382239-25382261 TTGAATTGCTAATTGGGGGAGGG - Intergenic
1177907026 21:26983931-26983953 TTGAAAGTATAACTGGTAGAAGG - Intergenic
1179482411 21:41686546-41686568 GTGAATGGAAAAAGGGAGGAAGG + Intergenic
1181737415 22:24892590-24892612 TTGAGTGGATAGGTGGGGGAAGG + Intronic
1182047390 22:27285991-27286013 ATGAATGGATGAATGGATGATGG + Intergenic
1182941577 22:34282193-34282215 TTGAATGGCTAACTGGACTTAGG - Intergenic
1183141129 22:35940704-35940726 ATGAATGGATAAATGAAGTATGG + Intronic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1184906636 22:47491852-47491874 TAGCATGGATAGCTGGACGAAGG + Intergenic
1184996753 22:48212786-48212808 ATGAATGGATGAATGGATGATGG - Intergenic
1184996781 22:48213024-48213046 ATGAATGGATTAATGGATGATGG - Intergenic
1185104360 22:48858915-48858937 ATGAATGGATGAATGGATGATGG - Intergenic
1185263246 22:49882771-49882793 TTGAATGGGTGACAGGAGGATGG + Intronic
950064967 3:10104674-10104696 TTGAATGGGTGCTTGGAGGAAGG + Exonic
950686813 3:14624373-14624395 TTGTAGGGACAACTGGAAGAGGG + Intergenic
952743310 3:36755688-36755710 TAGGATGGAGAAGTGGAGGATGG + Intergenic
952904462 3:38130655-38130677 TGGCATGGATAACTTGAGAAGGG - Intronic
954954869 3:54510234-54510256 ATGAATGGATGAATGGATGAAGG + Intronic
954985593 3:54788454-54788476 TTGAATGGATACTAAGAGGAAGG - Intronic
955376173 3:58399038-58399060 TTTCAAAGATAACTGGAGGAAGG - Intronic
956586494 3:70870872-70870894 TTTACAGGATATCTGGAGGAAGG - Intergenic
958266123 3:91439265-91439287 TTGAATGGATAACTGATAGTTGG - Intergenic
959927008 3:111933891-111933913 ATAAATGGATAACCAGAGGAAGG - Intronic
960268418 3:115647866-115647888 TTGCATGGAAGACTGGAGGCAGG + Intronic
960896208 3:122508475-122508497 TTGAAGGGATTACTGAAGGATGG - Intronic
961240420 3:125405936-125405958 TTGAATGGGTAAATTGATGAAGG - Intergenic
961920622 3:130421582-130421604 TTGAGAGGATACCTGGAGGTAGG - Intronic
962261637 3:133912905-133912927 ATGAATGTATAAATGGTGGATGG + Intergenic
962274626 3:134002659-134002681 CTGAATGAAAAACTGGAGGTGGG - Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
964633655 3:158838458-158838480 TTGAATGGGTAAATTCAGGAAGG + Intergenic
966681227 3:182644000-182644022 TTGAATAGAAATCTGCAGGAGGG + Intergenic
967106218 3:186256821-186256843 TGGCATGGAGATCTGGAGGAGGG - Intronic
967196678 3:187032464-187032486 TTGAATGAATAAATGGGTGACGG - Intronic
968931204 4:3580433-3580455 ATGGATGGATGATTGGAGGATGG - Intronic
969370618 4:6728970-6728992 TTGCATGAATGAGTGGAGGACGG - Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
970613177 4:17744254-17744276 TTGACTGAATAACTGGGAGAAGG + Intronic
970833118 4:20366669-20366691 GTGAATGGATAAATGGGAGAGGG + Intronic
970907080 4:21228500-21228522 TTGAGTGGTTGACTGCAGGATGG - Intronic
971470381 4:27018600-27018622 TTGATTGGAAAACTGGAAGAAGG + Intronic
972067203 4:34963025-34963047 ATGAATGGATAACTAGATTAAGG + Intergenic
973225895 4:47784375-47784397 TAGAATGGCTAAATGGAGAAAGG - Intronic
974090720 4:57307958-57307980 TTGGATGGATAAATGGTTGATGG - Intergenic
976763479 4:88574790-88574812 TTGAATGGATAAATGAAAGGTGG - Intronic
977124318 4:93145345-93145367 TTGACTAGATAAATGAAGGAGGG + Intronic
979119672 4:116881886-116881908 TTGATATGATACCTGGAGGAGGG - Intergenic
979708165 4:123746227-123746249 TTTGATGGATCACTGGAAGATGG + Intergenic
980009319 4:127578776-127578798 TTGAATGGAAAACGGGGGGGCGG + Intergenic
980015162 4:127641505-127641527 TTGAAAGGATAAATGAAGGAGGG - Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
982788741 4:159566055-159566077 ATGTGTGGATAGCTGGAGGATGG - Intergenic
983969015 4:173848579-173848601 GTGAAAGGATCACTGGAGCATGG - Intergenic
984428310 4:179615941-179615963 TTGAAGGGAGAACTGGAGGATGG + Intergenic
985275472 4:188233753-188233775 TTGACTGAATAACTGGAAGGAGG - Intergenic
985957654 5:3276876-3276898 TTGAGTTGATAGCAGGAGGAAGG - Intergenic
986272295 5:6243897-6243919 CTGCATGGAGCACTGGAGGAAGG - Intergenic
987689162 5:21244753-21244775 GTTATTGGAAAACTGGAGGAAGG + Intergenic
987770732 5:22300538-22300560 TTCAATTGAAAACTGGAGTATGG - Intronic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988603576 5:32661593-32661615 TTGCATGGACACCTGAAGGAAGG + Intergenic
989013184 5:36897475-36897497 TTATTTGGAAAACTGGAGGAGGG - Intronic
990061646 5:51657550-51657572 TTGACTAGATAACTGGATGCTGG - Intergenic
990944542 5:61236054-61236076 TCAAATTGATAACTAGAGGAGGG - Intergenic
990966481 5:61454051-61454073 TTGAATAAATAAATGGGGGAAGG - Intronic
993441419 5:87961498-87961520 TTTAAAGGATAACTAGAAGAAGG - Intergenic
995132181 5:108642337-108642359 GAGAATGGAGAACTGGAGAAGGG - Intergenic
996890158 5:128409399-128409421 CTGAATGGATAAATGTAGGGAGG - Intronic
997000286 5:129751434-129751456 TTGGATGGATACCTTGAGGCAGG - Intronic
997201935 5:132015650-132015672 TTGAATGAATAAATGAATGATGG + Intergenic
997490777 5:134274108-134274130 CAGAATGAATCACTGGAGGAGGG - Intergenic
998155691 5:139785737-139785759 TTGAATGAATCAGTGAAGGAAGG + Intergenic
998602586 5:143600272-143600294 TTGAATGAATAAATGGATTAAGG + Intergenic
1000193278 5:158934247-158934269 TTGAATGAATGAATGAAGGAAGG - Intronic
1000299832 5:159946067-159946089 TTCATTGGGTAAGTGGAGGATGG + Intronic
1001422578 5:171598961-171598983 GTGAGTGGATAAGAGGAGGATGG + Intergenic
1001781194 5:174370466-174370488 TTGAATGAATAGCTGAATGAGGG - Intergenic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002365364 5:178705572-178705594 TTGATTGGATACCTGGGTGAGGG + Intergenic
1002411820 5:179085228-179085250 GTTATTGGAAAACTGGAGGAAGG + Intergenic
1003464335 6:6364127-6364149 TCAAATGGATATCTGGGGGAAGG + Intergenic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003967566 6:11267743-11267765 TTTATTGGAGAACTGGAGAAAGG - Intronic
1003967570 6:11267781-11267803 TTTATTGGAGAACTGGAGAAAGG - Intronic
1004781023 6:18908867-18908889 TTGAATGAATAAATGCAGTAAGG + Intergenic
1005031042 6:21509490-21509512 TTGAATGGATAAATGAATTAGGG - Intergenic
1005149190 6:22728945-22728967 TAGAAGTGAAAACTGGAGGAGGG + Intergenic
1005733939 6:28727325-28727347 TGGAATGGATAGGTGGAGGAGGG + Intergenic
1005851357 6:29825340-29825362 TTGGTTGAATAACTGGGGGAAGG - Intergenic
1005858736 6:29885265-29885287 TTGATTGAATAACTGGAGGATGG - Intergenic
1005866287 6:29940088-29940110 TTGGTTGAATAACTGGAGGAAGG - Intergenic
1005874961 6:30004022-30004044 TTGGTTGAATAACTGGGGGAAGG - Intergenic
1007938079 6:45751623-45751645 TTGATTGGAAAACTGAGGGAAGG - Intergenic
1008966578 6:57318682-57318704 TTGAATGGATTGCTGAATGAAGG - Intronic
1008966581 6:57318731-57318753 TTGAATGGATTGCTGAATGAAGG - Intronic
1008989153 6:57582708-57582730 TTGAATGGATAACTGATAGTTGG + Intronic
1009177686 6:60480949-60480971 TTGAATGGATAACTGATAGTTGG + Intergenic
1009762178 6:68021735-68021757 TTGAAAGTATAGTTGGAGGAAGG - Intergenic
1010288608 6:74109179-74109201 TTGAATGAATGAATGAAGGAAGG + Intergenic
1010329030 6:74600351-74600373 TTCAGTGGATAAAAGGAGGAGGG - Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1011851787 6:91638453-91638475 ATGAATGGATAGCTAAAGGAAGG + Intergenic
1012188988 6:96257955-96257977 TTGAATTCATAATTAGAGGAGGG - Intergenic
1015800064 6:137051762-137051784 TTTAATGAACAAATGGAGGATGG + Intergenic
1017195433 6:151695176-151695198 TTGAATGCATACCTGGAGCTTGG + Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1018646300 6:165951822-165951844 TTGAATGAATAAATGGAAGAAGG - Intronic
1019826698 7:3290453-3290475 TTGAAAGAATAAATGGTGGAAGG - Intergenic
1021597957 7:22336935-22336957 GTGAATGGATATCTTGAGAAAGG + Intronic
1023072784 7:36453942-36453964 TTGAATGCATAAGTGAATGAAGG + Intergenic
1025120095 7:56294577-56294599 ATGAATGGATGACTGGTGGATGG + Intergenic
1025120113 7:56294674-56294696 ATGAATGGATGAGTGGTGGATGG + Intergenic
1025120117 7:56294697-56294719 ATGAATGGATGAGTGGTGGATGG + Intergenic
1025120134 7:56294787-56294809 ATGAATGGATGAATGGTGGATGG + Intergenic
1026333078 7:69370121-69370143 TTGAATGAATAAATGAAGGAAGG - Intergenic
1026794949 7:73360009-73360031 TTGAAGGGAGCACTGGGGGAGGG - Intergenic
1030312541 7:108082900-108082922 TTGGATGGATCACTGGCAGACGG + Intronic
1030848362 7:114451560-114451582 ATGAATGAATAAGTGAAGGAAGG - Intronic
1030896610 7:115069016-115069038 CTGAATGGTGAACTAGAGGAAGG + Intergenic
1031440261 7:121786068-121786090 TTGCCTGGATCACTGGAAGATGG - Intergenic
1031828723 7:126599952-126599974 ATGAATGGATGAATGGTGGATGG + Intronic
1031922588 7:127612751-127612773 ATGGATGGATGAATGGAGGATGG + Intronic
1032704904 7:134413317-134413339 TTGAACGGAAAGGTGGAGGAGGG - Intergenic
1032859276 7:135862186-135862208 TTGAATAGAGAACAGGATGAAGG - Intergenic
1034214825 7:149397434-149397456 TTGCACTGATATCTGGAGGAAGG + Intergenic
1034671269 7:152860253-152860275 GTGTCTGGATAACTGTAGGACGG + Intergenic
1035278888 7:157765154-157765176 TTGGATGGATAAAAGAAGGATGG - Intronic
1037087812 8:14874834-14874856 TTGAATGGATAACTGGAGGAAGG - Intronic
1037476046 8:19258693-19258715 TAGAAATTATAACTGGAGGAAGG + Intergenic
1037773701 8:21818733-21818755 ATGCATGGATAACTGTAGCAGGG + Intergenic
1039070136 8:33642185-33642207 TTGATTGGACAACTGGGAGAAGG + Intergenic
1041015064 8:53584904-53584926 TTGATTGGATGAGTGGAAGATGG - Intergenic
1043394073 8:79819522-79819544 TTGAGTGGATAAGAGGAGAATGG + Intergenic
1044928367 8:97228537-97228559 TTAAATGGATAACTAGAAGTTGG - Intergenic
1045695208 8:104801499-104801521 TAGAATGCATAACTGAAGGAGGG - Intronic
1045767181 8:105687190-105687212 TTGAATGGCTTTATGGAGGAAGG + Intronic
1045832637 8:106482316-106482338 TTGAATGGATCCCTTGGGGAGGG - Intronic
1047306889 8:123659670-123659692 ATGAATGGATAAATGATGGATGG - Intergenic
1049474926 8:142792728-142792750 GTGAATGGATGAATGGAGGATGG - Intergenic
1049629163 8:143642909-143642931 CTGAATGAGTAACTGGAAGAAGG - Intronic
1052119643 9:24696220-24696242 TTTAATGGAAAATTGGAAGATGG + Intergenic
1052572502 9:30244741-30244763 TTGATTGAATGACTGGGGGAAGG - Intergenic
1053017072 9:34667934-34667956 GTGAATGGAGACCTGGATGATGG + Intergenic
1054458919 9:65451493-65451515 ATGGATGGATGATTGGAGGATGG + Intergenic
1054458951 9:65451637-65451659 ATGGATGGATGATTGGAGGATGG + Intergenic
1057399805 9:94713039-94713061 GAGAATGGATGACGGGAGGATGG - Intergenic
1057644913 9:96864950-96864972 GTGAATGGATCACTTGAGGCTGG + Intronic
1058764719 9:108170490-108170512 TTGTATGGATACTTGAAGGATGG - Intergenic
1059162483 9:112048267-112048289 TTGAATGAATAACTGAGAGAAGG + Intronic
1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG + Intergenic
1059316008 9:113426383-113426405 TTGAGTGGAGAATGGGAGGAGGG + Intronic
1060748012 9:126150466-126150488 GTGAATGGATAATGGGTGGATGG + Intergenic
1061244879 9:129396423-129396445 TTGAGAGGATGATTGGAGGATGG + Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062201235 9:135303907-135303929 ATGGATGGATAAATGGAGGGTGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1202630930 M:15660-15682 TTGTTTGGATATATGGAGGATGG - Intergenic
1185498480 X:578416-578438 ATGAATAGATAACTGGTAGATGG + Intergenic
1185503921 X:618696-618718 ATGAATGGATGAATGGATGAAGG + Intergenic
1185840705 X:3388111-3388133 ATGAATGGATAAATAGATGATGG - Intergenic
1185850260 X:3479120-3479142 TTGAATGGATAAATAAAGCATGG + Intergenic
1186686903 X:11934603-11934625 TTGAGATGATAACTTGAGGAAGG + Intergenic
1186935525 X:14446591-14446613 TTGGATGGATAAGTGATGGATGG + Intergenic
1186943607 X:14540419-14540441 GAGAATGGAAAACAGGAGGAGGG - Intronic
1187111628 X:16307645-16307667 TTGATTGAATAACTGGGAGAAGG - Intergenic
1189365261 X:40383265-40383287 TTGAATGGATGCCTGGAGCAGGG - Intergenic
1192479569 X:71473306-71473328 CTGAATGGATAACAGGGGGTTGG + Intronic
1192549532 X:72042866-72042888 TTGAATAAATAAATGAAGGAAGG + Intergenic
1194142341 X:90221585-90221607 ATAAATATATAACTGGAGGATGG - Intergenic
1194360085 X:92939239-92939261 TTGAATGGTTAAATGAATGAAGG + Intergenic
1195502404 X:105617236-105617258 TTGAATGGCCAACTCGATGAGGG + Intronic
1197695834 X:129548892-129548914 TAGAATTGATAATTGTAGGAAGG + Intronic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1197970496 X:132110241-132110263 TTTAAGGGATAGGTGGAGGAGGG + Intronic
1198053462 X:132970986-132971008 TTGATTGGATAACTGGGAGACGG + Intergenic
1199807617 X:151316081-151316103 TTGAATGGTGAACAGGAGGTAGG - Intergenic
1200488094 Y:3790686-3790708 ATAAATATATAACTGGAGGATGG - Intergenic
1200668285 Y:6055060-6055082 TTGAATGGTTAAATGAATGAAGG + Intergenic