ID: 1037092874

View in Genome Browser
Species Human (GRCh38)
Location 8:14944789-14944811
Sequence GTACACTCCTTGACTTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 7, 3: 32, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037092874 Original CRISPR GTACACTCCTTGACTTAAAA TGG (reversed) Intronic
902538506 1:17135878-17135900 GTACACTCCTGGACTTACAATGG - Intergenic
905157465 1:35997672-35997694 AGATGCTCCTTGACTTAAAACGG - Intronic
905951811 1:41958321-41958343 GTATAATCCTTTACTTACAATGG - Intronic
909275477 1:73679756-73679778 GTACATGCCTTGTCTTCAAAGGG - Intergenic
910217681 1:84858763-84858785 GTACAGTCCCTGACTTCGAAGGG + Intronic
910472312 1:87567953-87567975 GGTCACTCCTTGACTTACAATGG - Intergenic
911403238 1:97403274-97403296 CTACACTCCTCGACTTACAATGG - Intronic
913009145 1:114665510-114665532 GTACCCTCCTTAACTTATGATGG + Intronic
915777669 1:158508530-158508552 GTATACTCCTTGACATATGATGG + Intergenic
916060424 1:161094613-161094635 ATACAATCCCTGACTTACAATGG - Intergenic
917157331 1:172018526-172018548 GTACACTTCTTGACTTATTATGG + Intronic
918507267 1:185269831-185269853 GCACAATCCTTGACTTACCATGG + Intronic
920148669 1:203885596-203885618 GTACACTCCTTGACTTACTATGG + Intergenic
922578100 1:226676723-226676745 TACCACACCTTGACTTAAAAAGG + Intronic
923768608 1:236916599-236916621 GTACATTCCTTGACTAATGATGG - Intergenic
923974428 1:239245568-239245590 GGATACTCCTTGACTTATGATGG + Intergenic
924034917 1:239925813-239925835 CTAAACTCCTTAACTCAAAAGGG - Intergenic
1066652718 10:37673773-37673795 GTAAACTCCCTAACATAAAAAGG - Intergenic
1067784545 10:49235213-49235235 AGATACTCCTTGACTTACAATGG + Intergenic
1068213113 10:53948116-53948138 GTATGCTCCTGGACTTACAACGG + Intronic
1071889345 10:89985638-89985660 GTATGCTCCTTGATTTAAGAAGG + Intergenic
1072931458 10:99666925-99666947 GTACAGTCATTGACTTACAATGG - Intronic
1073090027 10:100928189-100928211 GGACACTCCTTGAATTAACAAGG - Intronic
1075232758 10:120697079-120697101 GTACACTCCTTGACTAATGATGG + Intergenic
1077832474 11:5889387-5889409 GTACTTTCCTTGACTTACAATGG + Intronic
1081474941 11:43420019-43420041 GTATATTTCTTTACTTAAAAGGG + Intronic
1086155865 11:83665314-83665336 GCACACTACTTGACATAAGAAGG - Intronic
1087143580 11:94790265-94790287 GTACACTGCCTGTCTTCAAAGGG + Intronic
1087759307 11:102088879-102088901 GCACACCCTTTGACTTACAAGGG - Intergenic
1088350500 11:108881799-108881821 AGATACTCCTTGACTTACAAAGG - Intronic
1089266827 11:117269812-117269834 GTGTACTCCTTGACTTACTATGG + Intronic
1091107275 11:132934436-132934458 GTTCTCGCCTTGACTTAGAATGG + Intronic
1092907152 12:13111770-13111792 CTACACTCCTTGATTTTAAAGGG - Intronic
1093227152 12:16498888-16498910 GAACCATCTTTGACTTAAAAAGG + Intronic
1093641662 12:21534159-21534181 GTACACTCCTTGACTTACCATGG + Intronic
1094443039 12:30500556-30500578 TTCCACTCCTTGACTTTAAATGG + Intergenic
1096209176 12:49749794-49749816 GTACACTCCTTGATTTGCGATGG - Intronic
1097918977 12:65051393-65051415 GCACACGCCTTCACTTAAAAAGG - Exonic
1098784925 12:74741085-74741107 ATATGCTCCTTGACTTGAAATGG + Intergenic
1099155024 12:79163842-79163864 ATACTCCCCTTGATTTAAAAAGG - Intronic
1099265280 12:80438550-80438572 GTACACTCCTCAACTTACATTGG + Intronic
1100834713 12:98555341-98555363 GTATACTCCTTGACTTATGATGG - Intergenic
1101857972 12:108459870-108459892 GTACATTCCTTGATTCACAATGG + Intergenic
1101962737 12:109262085-109262107 GTACACTCTTAGACCTGAAAGGG + Intronic
1103852018 12:123939533-123939555 GTACACTCCTCGACTTACCATGG - Intronic
1104753879 12:131256881-131256903 AGACACTCCTTGACTTATGATGG + Intergenic
1106047750 13:26160797-26160819 CTTCTCTCCTGGACTTAAAATGG + Intronic
1106400597 13:29426362-29426384 GAAAACTCCTTGACTTACAATGG - Intronic
1108995219 13:56722975-56722997 ATACACCCCTTCACTTACAAAGG - Intergenic
1111757487 13:92417073-92417095 GTGCACTCCTTGACTTACAACGG - Intronic
1111905746 13:94253891-94253913 GTACATTCCTTGAATTTTAAAGG + Intronic
1112712734 13:102149241-102149263 GAACACTCATTGATATAAAATGG + Intronic
1113429335 13:110235974-110235996 GTACAGTCCCTGTCTCAAAAAGG + Intronic
1115146288 14:30229653-30229675 GTACGCTCCTTGACTCACTATGG - Intergenic
1115181490 14:30631532-30631554 AGACACTCCCTGACTTACAATGG - Intronic
1116411120 14:44625276-44625298 GCCCACTCCTTGACCTAGAAAGG + Intergenic
1116531046 14:45974067-45974089 GCATACTCCTTGACTTAGGATGG - Intergenic
1117200365 14:53383915-53383937 GTTCACTGCTTGCCTTATAAAGG - Intergenic
1118046776 14:61978658-61978680 CTTCCCTCCCTGACTTAAAAGGG - Intergenic
1120478128 14:85014734-85014756 CTACCCTCCTTGATTTAAATAGG + Intergenic
1120613967 14:86678465-86678487 GTACACTCCTCAACTTATGATGG - Intergenic
1120744065 14:88137946-88137968 GTTTACGCCATGACTTAAAAGGG - Intergenic
1120756886 14:88252967-88252989 GTACTCTCCTTGGCTTGACACGG - Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1125263952 15:37857946-37857968 ATACGCTCCTTGACTTACGATGG - Intergenic
1128945430 15:71816874-71816896 GTATGCTCCTTGACTTAAGATGG - Intronic
1131477342 15:92751339-92751361 CTTCACTCCATGGCTTAAAATGG + Intronic
1135392905 16:22108799-22108821 AGACAGTCCTTGACTTAGAATGG + Intronic
1136076671 16:27822023-27822045 ATACACTCCCTGCCTGAAAAGGG - Intronic
1137740050 16:50760524-50760546 CTACACTTCTTGAATTAAAAGGG - Intronic
1139019908 16:62735935-62735957 GTATACTCTTTGACTTATTATGG + Intergenic
1140331267 16:74059276-74059298 GTACAATCCTTCACTTTTAAAGG + Intergenic
1146805577 17:35862656-35862678 GTACACTCCTTAACTTACTATGG - Intronic
1147467788 17:40624684-40624706 TTAAACTCCTTGACTTTAAGGGG - Intergenic
1148018364 17:44538322-44538344 GTACACTACAATACTTAAAATGG + Intergenic
1148982294 17:51588396-51588418 AGATACTCCTTGACTTACAATGG + Intergenic
1154499235 18:14986798-14986820 GTGTATTCCTTTACTTAAAATGG + Intergenic
1156995554 18:43462191-43462213 GTACACACCTAGAGGTAAAATGG + Intergenic
1157187819 18:45555380-45555402 GTACACTCTTTGACTTAAGATGG + Intronic
1159420484 18:68212588-68212610 CAACTCTCCTTGACTTGAAATGG - Intergenic
1159542922 18:69802324-69802346 GTACGCTCCTTGACTGATAATGG + Intronic
1160071173 18:75629235-75629257 AAATACTCCTTGACTTAGAATGG - Intergenic
1160453888 18:78982555-78982577 GGGCATTCCTTGACTTAACACGG - Intronic
1161275983 19:3417556-3417578 GTACACACCCAGCCTTAAAATGG - Intronic
1162962080 19:14134325-14134347 GTAGACTCCTTAATTTAAAAAGG + Intronic
1163292718 19:16391023-16391045 AGACACTCCTTGACTTATGATGG + Intronic
1165660196 19:37571636-37571658 GTATGCTCCTTGACTTACCAAGG + Intronic
1166021061 19:40030059-40030081 GTATGCTCCTTGACTTAAAATGG - Exonic
926596253 2:14792214-14792236 AGACACTCCTCGACTTACAATGG + Intergenic
930245607 2:48980257-48980279 GCACTCCCCATGACTTAAAAAGG - Intronic
931725629 2:65107753-65107775 GTACAGTCCTTTACTTCAACTGG - Intronic
933707818 2:85304729-85304751 GTACTCTCCTTGACCTAGATGGG - Intronic
940773793 2:157865954-157865976 GGACAGTCCCTGAATTAAAACGG + Intronic
940990669 2:160092903-160092925 GTACTCTACTTGTCTCAAAAGGG + Intergenic
941460149 2:165761088-165761110 GCAGACTCCTTGGCATAAAAAGG - Intronic
943542469 2:189233918-189233940 ATATGCTCCTTGACTTACAATGG - Intergenic
946342971 2:219083919-219083941 ATACACTCCTTGACCTATGATGG + Intronic
946901199 2:224373442-224373464 GGACACACCTTGGCTTACAAAGG - Intergenic
947201095 2:227615338-227615360 GCACAGTCCCTGACTTCAAAGGG + Intronic
947971093 2:234325781-234325803 ATACATTCCTTGACTTGCAAAGG - Intergenic
1171350614 20:24499763-24499785 GTTCACTCCTTGCCTTACCAAGG - Intronic
1174729494 20:52901929-52901951 GTATAGTCCCTGACTTACAATGG - Intergenic
1174932248 20:54828727-54828749 GTATACTCCTTGGTTTACAATGG + Intergenic
1177193758 21:17880763-17880785 GCACAGTCCTTGCCTTACAAAGG - Intergenic
1178040757 21:28638505-28638527 GTCCTCTCCTTTGCTTAAAACGG - Intergenic
1182348201 22:29681886-29681908 TAACACCCCTTGGCTTAAAAGGG - Intronic
950290091 3:11776781-11776803 GCAGGCTCCTTGACTTACAATGG - Intergenic
951915312 3:27794630-27794652 GTAAAGTTCTTGACTTAAAAAGG + Intergenic
952593466 3:34986720-34986742 GTACACTCCTTGACTTACAATGG - Intergenic
956981134 3:74639568-74639590 GCACACTCCTTGACTTACAATGG + Intergenic
957839115 3:85643197-85643219 GTATACTTCTTGGCTTAACATGG + Intronic
958473968 3:94556989-94557011 GTATGCTCCTTGACTTATGATGG + Intergenic
958728777 3:97937687-97937709 GGACAGTCCTTGACTTCACAGGG - Intronic
959166892 3:102791602-102791624 GTACACCCCTTGATTTATGATGG - Intergenic
959866825 3:111280533-111280555 GTACAGTCCATGAGCTAAAATGG - Intergenic
961379842 3:126489856-126489878 GTACTCTCCTCGACATACAATGG - Intronic
963205722 3:142632205-142632227 GTACACTCCTCCACTTATGATGG + Intronic
963849615 3:150197588-150197610 GTATGCTCCTTGACTTACAATGG - Intergenic
965442899 3:168738349-168738371 GCACACTCCTTGACTTATGATGG - Intergenic
965743874 3:171904954-171904976 GTACACATGTTGACTTAATAAGG + Intronic
965877727 3:173348312-173348334 TTACACTTTTGGACTTAAAATGG + Intergenic
966345607 3:178976278-178976300 AAATACTCCTTGACTTACAATGG + Intergenic
966547085 3:181161545-181161567 GTTCTCTCCTTAACTTATAATGG + Intergenic
967868790 3:194212652-194212674 GTCCTCACCTTGACTTCAAATGG + Intergenic
970919966 4:21382581-21382603 TTACAATTCTTCACTTAAAATGG + Intronic
971803991 4:31330672-31330694 AGATACTCCTTGACTTACAATGG - Intergenic
971851046 4:31986771-31986793 GTTCCCTCCTTGTCTTAAATAGG + Intergenic
971925213 4:33000659-33000681 ATATGCTCCTTGACTTACAATGG + Intergenic
972439000 4:39066552-39066574 GTACATTCCTCAACTTACAATGG + Intronic
973644511 4:52936500-52936522 AGACACTCATTGACTTAGAAAGG - Intronic
973667161 4:53173295-53173317 GTACACTTCTTGGCTTATGATGG - Intronic
975180999 4:71344940-71344962 GTGCTTTCCATGACTTAAAAGGG - Intronic
976229743 4:82829287-82829309 GCACACTCTTTTACTTTAAATGG - Intronic
977080965 4:92526840-92526862 GTACTCTCCTTGACTTACTATGG + Intronic
979050736 4:115928445-115928467 GGCCAATCCTTGACTTACAATGG - Intergenic
979279513 4:118849637-118849659 AGGCACTCCTTGACTTAAGATGG + Intergenic
979653629 4:123165749-123165771 GTAGAATACTTGACTTAAAAAGG - Intronic
981991219 4:150923128-150923150 GTATACTCCTTCACTTAGGATGG - Intronic
982168186 4:152634879-152634901 CTACACTCCTTGACTTATGATGG + Intronic
982766104 4:159350837-159350859 TTACACTCATTTAGTTAAAAGGG - Intronic
982885361 4:160773256-160773278 CCACACTCCATGACTTTAAATGG - Intergenic
990853292 5:60232349-60232371 GTTTATTCCTTGACTCAAAAAGG - Intronic
992247298 5:74839091-74839113 GTACACTTTTAGACTTAATAAGG + Intronic
992981501 5:82178884-82178906 AGATACTCCTTGACTTACAATGG + Intronic
993385831 5:87262107-87262129 GTATGCTCCTTGATTTACAATGG + Intergenic
997020308 5:129992849-129992871 GTACACAACTTGACATAACATGG - Intronic
997161340 5:131612504-131612526 AGACATTCCTTGACTTACAATGG - Intronic
1002910240 6:1485350-1485372 AGACAGTCCTTGACTTACAATGG + Intergenic
1002980494 6:2131520-2131542 GTACACTCCTCAACTTACAATGG + Intronic
1003020999 6:2509474-2509496 GTACATTCCTTGAAATAAAATGG + Intergenic
1003798455 6:9632914-9632936 GGATGCTCCTTGACTTACAATGG - Intronic
1004033141 6:11892747-11892769 GTACATTTCTTAACTTACAATGG + Intergenic
1010322841 6:74533133-74533155 ATACAGTCCCTGACTTACAAAGG - Intergenic
1011972040 6:93237210-93237232 ATACGCTCCTTGACTTATGAAGG - Intergenic
1014254380 6:119146851-119146873 CAACTCTCCTTGAATTAAAAAGG + Intronic
1015101982 6:129492216-129492238 GCACACTAATGGACTTAAAAAGG + Intronic
1015217493 6:130767187-130767209 GTACACTCCTTGATTTATGATGG - Intergenic
1019069241 6:169328449-169328471 GTAGAGGCCTTGAATTAAAAAGG + Intergenic
1020420106 7:7993753-7993775 CAATACTCCTTGACTTACAATGG + Intronic
1022148060 7:27567908-27567930 GTACACTCCTTGATTTTCCATGG + Intronic
1023771844 7:43563948-43563970 GTATACTCCTTGATTGACAACGG - Exonic
1024882330 7:54102148-54102170 ATAAAATCCTTGACTTAAAATGG + Intergenic
1025733985 7:64131029-64131051 AGACACTCTTTGACTTACAAAGG - Intronic
1027659219 7:80968947-80968969 GTAAAATCCTTTACATAAAAAGG - Intergenic
1028020355 7:85764051-85764073 GTACATTCCTTGACATACAAGGG + Intergenic
1028458467 7:91064103-91064125 TTATTCTCCTAGACTTAAAAAGG + Intronic
1028517119 7:91690259-91690281 GCACCCTCTTTGACTTCAAAAGG - Intergenic
1031719036 7:125146003-125146025 ATATACTCCTTGACTTATGATGG + Intergenic
1033489771 7:141831469-141831491 ATACAGTCCCTGACTTAAGATGG - Intergenic
1034505305 7:151484459-151484481 GTAAGCTCCTTGACTTATGATGG + Intronic
1035067556 7:156119057-156119079 GTACCCTACTTGAAATAAAAGGG + Intergenic
1037092874 8:14944789-14944811 GTACACTCCTTGACTTAAAATGG - Intronic
1039152278 8:34519404-34519426 ATAAGCTCCTTGACTTACAAGGG + Intergenic
1042714729 8:71760348-71760370 AGAAACTCCTTGACTTAAGATGG + Intergenic
1043657128 8:82682191-82682213 TTTTATTCCTTGACTTAAAAAGG - Intergenic
1044236770 8:89840154-89840176 GTACATTCCTCAACTTAAAATGG + Intergenic
1050891416 9:10829344-10829366 GTACACTGCTTAACATGAAAAGG + Intergenic
1051461072 9:17316624-17316646 AGACAGCCCTTGACTTAAAATGG - Intronic
1051561310 9:18443665-18443687 GTACACACCTAGGCTGAAAAAGG - Intergenic
1054866905 9:70012228-70012250 GAACACTATTTGACCTAAAAGGG + Intergenic
1055355488 9:75433122-75433144 ATAGACTTGTTGACTTAAAAAGG + Intergenic
1056847993 9:90056994-90057016 ATGCACTGCTTGACTTACAATGG + Intergenic
1057872122 9:98726168-98726190 GTACACTCCATGAAACAAAATGG - Intergenic
1058762814 9:108151715-108151737 GTGCGCTCCTTAACTTACAATGG + Intergenic
1059845819 9:118275394-118275416 ATGCATTCCTTGACTTCAAAAGG - Intergenic
1203625397 Un_KI270750v1:13704-13726 TTACACTAACTGACTTAAAATGG + Intergenic
1185653272 X:1664632-1664654 AGATACTCCTTGACCTAAAATGG - Intergenic
1186682380 X:11889356-11889378 GTATGCTCCTGGACTTACAATGG - Intergenic
1187860525 X:23678296-23678318 AGATACTCCTTGACTTAAGATGG - Intronic
1187986342 X:24816507-24816529 GTACACTTCATCACTTAAAGTGG - Intronic
1188022383 X:25172956-25172978 GTACACTCCTTGACTCATGATGG + Intergenic
1188943950 X:36274365-36274387 GGACACTCCTTGACTTATGATGG + Intronic
1192232139 X:69272750-69272772 GTCCAGTCCTAGACTTAAGAGGG - Intergenic
1192588077 X:72336354-72336376 GTACACTCCTCAACTTGAGATGG + Intronic
1192811876 X:74554264-74554286 GTTCACCTGTTGACTTAAAAAGG + Intergenic
1193799909 X:85922637-85922659 GTACACTCCTCAACTTATGATGG - Intronic
1194462330 X:94187046-94187068 AGACAGTCCTTGACTTACAATGG + Intergenic
1194825645 X:98559915-98559937 GTACTCACATTTACTTAAAATGG + Intergenic
1194829902 X:98609898-98609920 GCATGCTCCTTGACTTATAATGG - Intergenic
1195565755 X:106337205-106337227 GTAAATTCCTTAGCTTAAAAGGG - Intergenic
1196365924 X:114924082-114924104 ATACAAAACTTGACTTAAAATGG + Intergenic
1198512499 X:137366964-137366986 GTAATCACCTTGTCTTAAAAAGG - Intergenic