ID: 1037096169

View in Genome Browser
Species Human (GRCh38)
Location 8:14990397-14990419
Sequence CTGAAAGTACAGATGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037096169_1037096170 -6 Left 1037096169 8:14990397-14990419 CCAAGCTGCATCTGTACTTTCAG 0: 1
1: 0
2: 1
3: 39
4: 250
Right 1037096170 8:14990414-14990436 TTTCAGCCGCTCCCCATCGCTGG No data
1037096169_1037096171 -5 Left 1037096169 8:14990397-14990419 CCAAGCTGCATCTGTACTTTCAG 0: 1
1: 0
2: 1
3: 39
4: 250
Right 1037096171 8:14990415-14990437 TTCAGCCGCTCCCCATCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037096169 Original CRISPR CTGAAAGTACAGATGCAGCT TGG (reversed) Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
901502254 1:9660074-9660096 CTGAAAGTACAAAACTAGCTGGG - Intronic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
904549477 1:31303631-31303653 TTTAAAGTACACATGCAACTGGG - Intronic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
908635830 1:66163928-66163950 CTGAGAGTACAAATGCACATAGG - Intronic
908998975 1:70195756-70195778 CTGTAAGTCCAGCTGCTGCTCGG - Intronic
909775706 1:79482036-79482058 CTGAAAGTACAAAATTAGCTGGG + Intergenic
915177785 1:154031041-154031063 CAGAAAGGATAAATGCAGCTGGG - Intronic
915496147 1:156284159-156284181 CTGAAAGTTGGGATGCAGCTGGG - Intronic
916145881 1:161739034-161739056 CTGAAGGTATAGAAGCAGGTGGG + Intergenic
917110129 1:171539160-171539182 CTAAAAATACAGAATCAGCTGGG - Intronic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
922650262 1:227331841-227331863 CTGAAAGAATAGATGTGGCTGGG - Intergenic
923122040 1:231001113-231001135 CTGAAAGTACATAGACACCTGGG + Intergenic
924184572 1:241474844-241474866 CAGAAAGTACATAGGCAACTCGG - Intergenic
924664373 1:246055519-246055541 CTGAAAGCACAGATTCAAATAGG + Intronic
1063599122 10:7464054-7464076 TTGAAAGGAGAGATGTAGCTGGG - Intergenic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1066010468 10:31189685-31189707 CAGAAATCAGAGATGCAGCTAGG + Intergenic
1067730569 10:48807937-48807959 CTCAGAGGACAGATGAAGCTGGG - Exonic
1067853860 10:49774073-49774095 CTGACATTATAGATTCAGCTAGG - Intergenic
1069384068 10:67868597-67868619 CTGAAAGTACAAAATTAGCTGGG - Intergenic
1071085584 10:81865219-81865241 CAGAAGGTACAGGTGCAGTTCGG + Intergenic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1073795640 10:106985024-106985046 CTGAAATTACAAAATCAGCTGGG + Intronic
1074398083 10:113116538-113116560 ATGAAAGTACAGATTAAGCCTGG + Intronic
1074695871 10:116049876-116049898 GTGAAAGTAGAGAGGTAGCTTGG + Intergenic
1078412347 11:11136295-11136317 GTGAAAGTGCAGATTCAACTTGG + Intergenic
1081976925 11:47241354-47241376 CTGAAAATACAAAATCAGCTGGG + Intronic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084676801 11:70640028-70640050 CAGAACGTGCAGGTGCAGCTGGG + Intronic
1085516711 11:77115977-77115999 CTGAAAGTAAAGCTGCAGACTGG - Intronic
1086146985 11:83562873-83562895 CTTAAAGACCAGATGCAGATTGG - Intronic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086436223 11:86783540-86783562 GGGAAAATACAGATGCAGCTTGG - Intergenic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1090998732 11:131890299-131890321 CTGAATCTACAAATGCTGCTAGG + Intronic
1091009153 11:131982485-131982507 CTGAAAGTTCAGGAGCAGCTGGG + Intronic
1092883904 12:12909166-12909188 CTCAAGGTACAGATGCAGCCTGG + Exonic
1095928540 12:47603653-47603675 CACCAAGTACAGATGCAGCAAGG + Intergenic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1096469541 12:51867605-51867627 GTGAAAGTCCAGCTGCAGCCTGG - Intergenic
1097208186 12:57342169-57342191 GTGTAAGTACAGATCCATCTGGG - Intronic
1097278697 12:57830907-57830929 CTGAAAGTACAAAATTAGCTGGG - Intronic
1098147129 12:67509241-67509263 CTGAAAGAACACATGAAGCAGGG + Intergenic
1099459419 12:82904224-82904246 CTGAGATTACAGATGGAGTTAGG + Intronic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1103294645 12:119876073-119876095 CTGGAAGAACAGATTCAGCCTGG + Exonic
1103498382 12:121380896-121380918 CTGAAAATACAAATTCAGCCAGG - Intronic
1105582114 13:21707999-21708021 CTAAAAGGACTGATGGAGCTTGG + Intergenic
1105841124 13:24254446-24254468 ATGAAGTTACAGAGGCAGCTGGG - Intronic
1106309106 13:28537696-28537718 CTGATAGAAAAGATGCATCTTGG + Intergenic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112660885 13:101506454-101506476 CTGAAAGACCACATGCAGCAAGG + Intronic
1113980696 13:114272541-114272563 CTAAATGTAGAGATGCAGTTTGG - Intronic
1115055137 14:29116018-29116040 CTGAAAGAACACATACATCTTGG + Intergenic
1116692845 14:48132745-48132767 ATGAATGTACAGATCCAGTTTGG - Intergenic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1119285911 14:73454169-73454191 CTGAGAGTACATATGCAGGTTGG - Intronic
1119455601 14:74752768-74752790 CTGAAAATACACATTTAGCTAGG - Intergenic
1122025484 14:98872889-98872911 CAGAAGGTTCAGGTGCAGCTCGG - Intergenic
1126771888 15:52065783-52065805 CTGACATTATAGATGCAGCTAGG - Exonic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127462103 15:59208742-59208764 CAGAAACTTCAGATGCAGATTGG - Exonic
1128879800 15:71232559-71232581 CTGGAAGTACAGAAGTAGGTAGG + Intronic
1130742938 15:86620666-86620688 CAGAAAGTAGAAATGCAGCAGGG - Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132610294 16:812621-812643 CTAAAAGTACAAAATCAGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133653072 16:7831288-7831310 AGGAAACTACAGATGCATCTTGG - Intergenic
1134269166 16:12718665-12718687 CTGAAAATGCACATTCAGCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135184048 16:20299484-20299506 CTGACAGGATAGATGCAGCTAGG + Intergenic
1135907397 16:26525494-26525516 CCAAAATTACAGATGCAGCTGGG + Intergenic
1137984085 16:53093072-53093094 ATTAAAGTGCAGATGCAGCAGGG - Intronic
1138594561 16:58022904-58022926 CTGACAGTGCAGAAGCAGCCGGG + Intergenic
1139397303 16:66650441-66650463 CTGAGACTACAGATGCAGCCTGG + Intronic
1140641671 16:76980900-76980922 CTGAATGTAGAGTTGCTGCTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1143085699 17:4414318-4414340 CTGAGATTACAGGTGTAGCTGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146626464 17:34438983-34439005 TTGAAACTTCAGATGCAGCAAGG - Intergenic
1147559587 17:41500609-41500631 CAAAAAGTACAGATGCCTCTGGG - Intergenic
1148322068 17:46763206-46763228 CAGAAAGAAGAGATGCAGCAGGG - Exonic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1152289815 17:79433519-79433541 CCGAATGTACTTATGCAGCTGGG + Intronic
1154138880 18:11805375-11805397 GGTAAAGTACAGGTGCAGCTTGG + Intronic
1154506914 18:15050118-15050140 CACAAAGTACAGATGGAGCATGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1160090887 18:75825677-75825699 CTGGAAGGTCAGATGCACCTAGG - Intergenic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1161950845 19:7467096-7467118 CTGAAGGTTCAGGAGCAGCTGGG - Exonic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1166079999 19:40437990-40438012 CTGAAAATACAAAATCAGCTGGG + Intergenic
1168610747 19:57797666-57797688 CTGAAAATACAAAATCAGCTGGG + Intronic
926374804 2:12215902-12215924 CTAAAAATACAGAATCAGCTGGG - Intergenic
926489771 2:13510788-13510810 CTGAGAGTACAGTTGAAGCAAGG + Intergenic
927808926 2:26171487-26171509 CTGGAATTACATATGTAGCTGGG - Intergenic
930129408 2:47833961-47833983 TTGAAAATAAAGATGCAGCCAGG - Intronic
931787448 2:65632871-65632893 AAGAAATTACAAATGCAGCTAGG - Intergenic
932423428 2:71614357-71614379 GTGAAACTACAGATGCAGCAAGG - Intronic
934158022 2:89221340-89221362 CTGACAGTGCAGAGGCAGGTGGG - Intergenic
934209243 2:89961084-89961106 CTGACAGTGCAGAGGCAGGTGGG + Intergenic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
937473247 2:122191446-122191468 CTGAAAGGCCAGATTCAGATGGG - Intergenic
937578620 2:123455815-123455837 CTGAAAGTACATCTACGGCTGGG - Intergenic
939872720 2:147542909-147542931 GTGAAAATACAAATGCAGTTTGG - Intergenic
940662169 2:156560094-156560116 CTTAAAGTTCAAATGCAGCGAGG + Intronic
941903657 2:170700946-170700968 ATGAAATTACAGATACACCTTGG - Intergenic
942245425 2:174003686-174003708 CTGAAAGTGCAGAGGTAGATCGG + Intergenic
944778080 2:202989447-202989469 TTGAAAGTGCAGGTGGAGCTGGG - Intronic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
948708602 2:239811187-239811209 ATGAAAGCACAGTTCCAGCTTGG + Intergenic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1171201528 20:23245952-23245974 CTGGGAGTACACATGCACCTTGG + Intergenic
1173143475 20:40505067-40505089 CTAAATTTACAGATGCAGATAGG - Intergenic
1174770238 20:53292695-53292717 CTGTTAGTACACATGCAGCATGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175553730 20:59833079-59833101 CTGTAAGTAGAGAGGCAGGTTGG + Intronic
1176790957 21:13318983-13319005 CACAAAGTACAGATGGAGCGTGG - Intergenic
1177257097 21:18678482-18678504 ATGACGGTACAGATACAGCTTGG - Intergenic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178044268 21:28676528-28676550 CTGAAAATACAGAGACAGCCAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183468003 22:37989790-37989812 CTGCAAGTGCAGCTGCAGGTTGG + Intronic
1183770153 22:39917473-39917495 CTTAAAATACTGATACAGCTAGG - Intronic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184070642 22:42144308-42144330 CTGGAAGTCCACATGCAGCAAGG + Intergenic
1184128619 22:42504077-42504099 CTGAAAGTACAAAATTAGCTGGG + Intergenic
1184137413 22:42557392-42557414 CTGAAAGTACAAAATTAGCTGGG + Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1185330044 22:50248411-50248433 ATGACAGTACAGACGCTGCTGGG - Exonic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
951934951 3:28012294-28012316 ATGAAATTACAGATGGAGCCAGG + Intergenic
953730345 3:45441918-45441940 CAGAATGTAGAAATGCAGCTTGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954639551 3:52089841-52089863 CTGAGAGTAGTGAGGCAGCTTGG + Intronic
955609477 3:60741809-60741831 ATCAAAGTACAGATTCAGTTTGG - Intronic
957528181 3:81404690-81404712 TTGAACTTACAGATGCAACTTGG - Intergenic
957552180 3:81720445-81720467 CTGAAAGCACAGGTACAGTTTGG + Intronic
958436936 3:94108519-94108541 CTAAAAGTACAAAAACAGCTGGG - Intronic
959314800 3:104789524-104789546 CTGGAGGTACAGATGCTGATGGG + Intergenic
960914288 3:122680957-122680979 CTGGAAGTACATCTGCAACTTGG - Exonic
961207637 3:125098896-125098918 CTGAAAGTGCAGACCCAGCTAGG + Intronic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
962850101 3:139301862-139301884 CTGTTAGTGCTGATGCAGCTGGG - Intronic
965731322 3:171774979-171775001 CTGAAGGAGCAGCTGCAGCTGGG + Intronic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
966949343 3:184802241-184802263 CTGAAAGTGCAGGTGCAGTGTGG + Intergenic
967678881 3:192335716-192335738 CTGAAATCTCAGATCCAGCTGGG - Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
970949813 4:21741534-21741556 CTTAAAGTATAGATGATGCTGGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972165428 4:36277856-36277878 CTGAAAGTAAAGATGAACTTAGG - Intergenic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974773735 4:66451627-66451649 CTGAAGGTACAAAAGCAGCTTGG + Intergenic
975782126 4:77850304-77850326 CTGAAAATACAAAAACAGCTGGG + Intergenic
975932861 4:79547125-79547147 CTGAAAGTATAGAATCATCTTGG + Intergenic
976148192 4:82064811-82064833 CCTCAAGTACAAATGCAGCTAGG + Intergenic
976525176 4:86078826-86078848 CTAAAAATACAAAAGCAGCTGGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979534819 4:121807645-121807667 CCAAAATTACAAATGCAGCTAGG + Intronic
980292197 4:130857845-130857867 CTGAACTTCCAGATGCACCTGGG + Intergenic
981048075 4:140283972-140283994 CTTCAAGTACAGATGCACCGAGG - Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983537618 4:168874997-168875019 CTCAAAGTACATTTGCAACTAGG + Intronic
984003060 4:174274147-174274169 CTGAAAGAGCAGCTGCAGCTGGG - Intronic
984029706 4:174587444-174587466 CTGAAACTACACATTCAGCCTGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985318443 4:188682584-188682606 CTGAGAATAAAGGTGCAGCTTGG - Intergenic
986108796 5:4689496-4689518 CTGAAAATACAAAATCAGCTGGG + Intergenic
986176596 5:5357751-5357773 CTGAAACTACAGATGCTGTTTGG + Intergenic
988427052 5:31075857-31075879 GTGAAATTACATATGCAACTTGG - Intergenic
988442574 5:31249640-31249662 AGGGAAGTACAGATGCTGCTAGG - Intronic
989022348 5:37023462-37023484 CAGAAAGTACAGATGAAGTATGG - Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989788436 5:45361197-45361219 CTGAAAGTACACAATTAGCTGGG - Intronic
989788454 5:45361334-45361356 CTGAAAGTACACAATTAGCTGGG - Intronic
992067740 5:73123024-73123046 CTGAAAGAACAAAAGTAGCTGGG - Intronic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
993524885 5:88953145-88953167 CTGAAAGTGGAGATTCAGCAAGG + Intergenic
993614653 5:90096739-90096761 AGCAAAGTACAGATTCAGCTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995857103 5:116605044-116605066 GTGAAAGTACAGATGCACAGGGG - Intergenic
995960404 5:117831657-117831679 CTAAAAGTACAGAATTAGCTGGG + Intergenic
997100758 5:130966339-130966361 GAGAAATTAAAGATGCAGCTGGG + Intergenic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998690706 5:144584461-144584483 CTGAAGTGACAGATGCTGCTGGG - Intergenic
999128208 5:149262457-149262479 ATGAAAATACAGATGCTGATTGG - Intergenic
1000427283 5:161106643-161106665 CTGAAAGTAAAGATTTAGATTGG + Intergenic
1000442710 5:161282278-161282300 CTGAAAGTCCATAGGCAGCCTGG - Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1003492683 6:6637393-6637415 GTCAAAGTACAGTTGCAGCATGG - Intronic
1003619933 6:7690941-7690963 CTGAAACTTCAGCTGCAGTTGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005565009 6:27082585-27082607 CTGAAATTACAGATTCAGTTCGG + Intergenic
1006482091 6:34304090-34304112 CTAAAAGTACAAAATCAGCTGGG + Intronic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1006828731 6:36955983-36956005 CTGAGAGAACAGATGCACCTTGG + Intronic
1006918595 6:37613044-37613066 CTAAAAATACAGAATCAGCTGGG + Intergenic
1007825006 6:44593886-44593908 CAGGAAGAACAGATGCAGCCAGG + Intergenic
1009909925 6:69913466-69913488 CTGAGAGAACAGATGAAGCCAGG + Intronic
1010046904 6:71455553-71455575 CAGAAACTACAGAAGCATCTAGG - Intergenic
1010996566 6:82540403-82540425 CTGAAAATACAAAACCAGCTGGG - Intergenic
1012537228 6:100313512-100313534 CTGAAATTACAGGTGCAGCCTGG + Intergenic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015294404 6:131574333-131574355 CTGACAGTCCAAATGCAGTTTGG - Intronic
1020668382 7:11074910-11074932 CTGAAAATATGGAAGCAGCTTGG - Intronic
1021553995 7:21901165-21901187 CTGAAGGTCCAGATGTAGCTGGG - Exonic
1022718585 7:32921893-32921915 CTGAAAGTAAAGTTGCAGTAGGG - Intergenic
1024466098 7:49712510-49712532 CTGGAGGGACAGATGCACCTGGG - Intergenic
1026216113 7:68350593-68350615 CTGAAAATACAAAATCAGCTGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026795767 7:73365091-73365113 CTGAAAGTGCAGCTGAGGCTGGG + Intergenic
1028129299 7:87151874-87151896 TTAAAAGTACAGATGCTCCTTGG - Intergenic
1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG + Intergenic
1032022094 7:128413107-128413129 CTGAAAGTACAAAACTAGCTGGG - Intergenic
1034846473 7:154451010-154451032 ATGAAAGTTCACATGCACCTTGG - Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1035627685 8:1084567-1084589 CTGAAAGCACAGAAGCAGTGAGG - Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1040119966 8:43672992-43673014 ATGAAGGTCCAGATGTAGCTGGG - Intergenic
1040605909 8:48930936-48930958 CTGGTTGTACAGATGCAGTTTGG + Intergenic
1041196420 8:55406255-55406277 CTGGAAGAAAAGATGCAACTAGG - Intronic
1041546220 8:59046393-59046415 CTGAAAGTGTTAATGCAGCTTGG - Intronic
1044017540 8:87062574-87062596 CTGAAAATACAAAATCAGCTGGG + Intronic
1044856375 8:96480254-96480276 CTGGAATACCAGATGCAGCTGGG - Intergenic
1045525694 8:102939843-102939865 CTCAAAGTTCAGTTGCTGCTAGG + Intronic
1046088730 8:109471898-109471920 CTGACATTATAGATTCAGCTAGG - Intronic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046931868 8:119849243-119849265 CTGAAAGTACAAAATTAGCTGGG + Intronic
1047341329 8:123983222-123983244 ATGAAGGTACGGCTGCAGCTGGG - Intronic
1047689739 8:127339633-127339655 AGGAATGTACAGATGGAGCTAGG + Intergenic
1050061706 9:1716317-1716339 CTGAAAGAACAGAAGCAATTAGG + Intergenic
1050064250 9:1742198-1742220 CTGAAGCTAAAGATGCAGCTGGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1052907015 9:33844363-33844385 CTGAAAATACAAAATCAGCTGGG - Intronic
1053545376 9:39017955-39017977 CAGAAAGAGGAGATGCAGCTGGG - Intergenic
1056191252 9:84186379-84186401 CAGAAAGTACATGTGCAGGTTGG - Intergenic
1058495548 9:105554968-105554990 TGGGAAGTACAGATGAAGCTTGG + Intergenic
1059422961 9:114204403-114204425 CTGAAAGCACACAGTCAGCTTGG + Intronic
1059595569 9:115716576-115716598 CTGTAAGTACACTTGCTGCTTGG - Intergenic
1060552537 9:124492410-124492432 TAGAAAGTCCAGATGCAGCAGGG - Intronic
1185702728 X:2243291-2243313 CCGCAGGTACAGATGCTGCTGGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186269093 X:7865615-7865637 CTGAAAGATCAGATGTAGGTTGG + Intergenic
1187853873 X:23617965-23617987 CAGAAAGAACATATGCACCTGGG + Intergenic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1188870878 X:35369905-35369927 CTGAAAGAAGATATGCAGTTTGG - Intergenic
1189016309 X:37288150-37288172 CTCAAAGTACAAATTCAACTAGG - Intergenic
1190664170 X:52681872-52681894 CTAAAAGTACAGATTTAGCTGGG + Intronic
1190675252 X:52776550-52776572 CTAAAAGTACAGATTTAGCTGGG - Intronic
1190865592 X:54382029-54382051 CTAAAAGTACAAAAGCAGCCGGG + Intergenic
1193862611 X:86688854-86688876 CTCAAAGTCCACATGCAGCTAGG - Intronic
1194742688 X:97594156-97594178 CTCAAACTACATATGCAGTTTGG - Intronic
1199290401 X:146099009-146099031 CTGAGATTACAGGCGCAGCTGGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic