ID: 1037100736

View in Genome Browser
Species Human (GRCh38)
Location 8:15042292-15042314
Sequence TGTGCTGATGCCTCTCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037100729_1037100736 28 Left 1037100729 8:15042241-15042263 CCACCAATGGATCAGAAGAAAGC 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG No data
1037100732_1037100736 0 Left 1037100732 8:15042269-15042291 CCTAGCTGACGGCAGTTCCCTTT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG No data
1037100730_1037100736 25 Left 1037100730 8:15042244-15042266 CCAATGGATCAGAAGAAAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 211
Right 1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG No data
1037100728_1037100736 29 Left 1037100728 8:15042240-15042262 CCCACCAATGGATCAGAAGAAAG 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037100736 Original CRISPR TGTGCTGATGCCTCTCTTCT GGG Intronic
No off target data available for this crispr