ID: 1037102555

View in Genome Browser
Species Human (GRCh38)
Location 8:15065172-15065194
Sequence GTAGCAAGGCACAGCGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037102555 Original CRISPR GTAGCAAGGCACAGCGGAGT GGG (reversed) Intronic
902614585 1:17616802-17616824 GTCACCAGGCAGAGCGGAGTGGG + Intronic
904129761 1:28267056-28267078 ATAGCAAGCCACAGCAGGGTAGG - Intronic
905641103 1:39590558-39590580 GTAGCAAAGCAAAGTGGAGGCGG - Intergenic
907580862 1:55571492-55571514 GTAGCAATGCACTGGGGAGAGGG - Intergenic
907968267 1:59354986-59355008 TGAGCAAGGCACAGAGGCGTAGG + Intronic
912309896 1:108609681-108609703 GTAGCCAGGCACAGAGGAATAGG + Intronic
912740968 1:112197134-112197156 GTAGCAAGGGACAACTGAGTTGG + Intergenic
913283810 1:117209692-117209714 GTAGCCAGGCACAGGGGTGGGGG + Intronic
914975873 1:152361253-152361275 GTAGCAAAGTACAGCAGAATTGG - Intergenic
916260496 1:162837134-162837156 GTAGGAAGTCACAGCCCAGTGGG - Intronic
916989051 1:170222578-170222600 GTAGCATGGAACAGAGTAGTTGG - Intergenic
918131650 1:181634867-181634889 AGAGGAAGGCACAGCGAAGTGGG - Intronic
920678219 1:208053321-208053343 GGAGCAAGTCAGAGCGGAGAGGG - Intronic
922750840 1:228069398-228069420 GTAGCAGGGGACAGCGTAGAAGG + Intergenic
924769222 1:247064336-247064358 GTAGCAAGCCAGAGAGGAGCAGG - Intronic
1066093521 10:32050256-32050278 GTAGCAAGGGAAAGGGGAATTGG - Intronic
1067453626 10:46397821-46397843 GCAGCAAGGCATTCCGGAGTGGG - Intergenic
1067583604 10:47461925-47461947 GCAGCAAGGCATTCCGGAGTGGG + Intronic
1067633607 10:47987273-47987295 GCAGCAAGGCATTCCGGAGTGGG + Intergenic
1068084065 10:52352653-52352675 GTAGAAAGGCACAACAGAGTTGG + Intergenic
1068374612 10:56163057-56163079 GGAGCAAGACAAAGCTGAGTTGG + Intergenic
1073108254 10:101045576-101045598 GCACCAAGGCACAGTGGGGTGGG + Intergenic
1074058204 10:109941836-109941858 GTAGTAAGGAACAGCAGAGTGGG + Intronic
1075591438 10:123694264-123694286 GTGGCAAGGCACAGAGGAGATGG + Exonic
1077867572 11:6235297-6235319 GCAGCACAGCACAGCGGTGTTGG - Intronic
1083640242 11:64141513-64141535 TTGGCAAGGCACAGCCGAGCTGG - Intronic
1083909662 11:65698874-65698896 GTAGAAAGGAGCAGAGGAGTTGG + Intergenic
1089351834 11:117825700-117825722 GAAGGAGGTCACAGCGGAGTGGG - Intronic
1100323704 12:93521399-93521421 GTATCAAGGCACTGCGGTTTTGG - Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103599291 12:122043970-122043992 GTCGCTGGGCACAGCCGAGTTGG - Exonic
1116352852 14:43887504-43887526 GGTGAAAGGCAAAGCGGAGTAGG - Intergenic
1116871398 14:50071986-50072008 CTAACAAGGCACAGATGAGTAGG - Intergenic
1117479040 14:56125049-56125071 GTTGGAAGGCACAGTGGAGTTGG + Intronic
1121777401 14:96599597-96599619 GTACCAAGACACAGGGCAGTGGG - Intergenic
1122976771 14:105174068-105174090 GTAGCATGGCAGAGTGGGGTGGG + Intronic
1130347158 15:83058283-83058305 GTAGAAAGGGACAGAGAAGTTGG - Intronic
1134208046 16:12253639-12253661 GCAGCAAGGCAGAGAGGAGGCGG + Intronic
1137602530 16:49766302-49766324 GGAGCCAGGCACAGCGGATGAGG + Intronic
1138356236 16:56383281-56383303 GCAGCACAGCACAGAGGAGTTGG - Intronic
1139572959 16:67824848-67824870 GTAGAAAGGCAGAGCAGGGTAGG - Intronic
1139574071 16:67830409-67830431 GTCGCAAGACACAGAGCAGTGGG - Exonic
1139668431 16:68474417-68474439 GGAGCAAGGCACAGTGGCTTAGG - Intergenic
1141725991 16:85788672-85788694 GAAGCAAGGCAGAGCTGAGCAGG + Intronic
1142077851 16:88130870-88130892 GTGGGAAGGCCCCGCGGAGTGGG + Intergenic
1142237460 16:88928944-88928966 GCAGCAAGGCGGAGCAGAGTGGG + Intronic
1144071190 17:11672555-11672577 GCAGCAAGGCAGAGTGCAGTTGG - Intronic
1145078759 17:19876976-19876998 CTATCAAGGCACAGCGCTGTGGG - Intergenic
1146678898 17:34793037-34793059 CTAGGAAGGCACAGAGGAGGTGG - Intergenic
1149074748 17:52581851-52581873 TTAGCAAGGAACAGAGCAGTTGG - Intergenic
1149454583 17:56777545-56777567 GTAGCTAGGCAGAGAGGAGGTGG - Intergenic
1151133763 17:71925111-71925133 GTACCCAGGCTCAGGGGAGTAGG + Intergenic
1153941694 18:9984047-9984069 GTGCCAAAGCACAGAGGAGTTGG + Intergenic
1154057002 18:11022401-11022423 GTAGCAAAGCACTGCAGACTGGG + Intronic
1160458120 18:79017280-79017302 GTAGTAAGGCGGAGCGGAGAGGG - Intergenic
1162097942 19:8321887-8321909 GCGGAAAGGCACCGCGGAGTGGG - Intronic
1165860651 19:38907518-38907540 GGAGCATGGCACTGCCGAGTGGG - Exonic
925015387 2:520488-520510 GCAGCAAGGCCCAGGAGAGTGGG - Intergenic
925153397 2:1632822-1632844 GCAGCAAGGCCCAGCTGAGGTGG - Exonic
929133569 2:38602398-38602420 GCAGCCAGGCACAGCGGACAGGG + Intronic
929697662 2:44132991-44133013 GTAGTTAGGCAGAGAGGAGTAGG + Intergenic
936705912 2:115073420-115073442 GCAGCAGGGCACAGTGGAGGTGG + Intronic
945251228 2:207768071-207768093 GTAGCAGGGTACCGCGCAGTTGG + Exonic
948636711 2:239342917-239342939 GGAGCTAGGCACAGCTGATTTGG - Intronic
1170804561 20:19618248-19618270 ATAGCAAAGCACAGCAGAGTGGG + Intronic
1176898042 21:14406183-14406205 GGAGGAAGGCACAGAGGAGCAGG - Intergenic
1179799336 21:43803612-43803634 GCAGCCAGGCACAGCTGAGCGGG + Exonic
1183428201 22:37750835-37750857 GTGGCATGGCTCAGTGGAGTGGG - Intronic
950375477 3:12568439-12568461 GTAGCAAGGCCCAGGGAAGTTGG + Intronic
954265957 3:49470450-49470472 GCAGCCAGGCACAGCGGATAGGG - Intronic
954295403 3:49671902-49671924 GGAGCAAGGCAGAGAGGTGTAGG - Intergenic
954497886 3:50982768-50982790 GTGGTCAGGCACAGAGGAGTGGG + Intronic
956088009 3:65634145-65634167 GTAGCAAGCAACAGAGGAGACGG + Intronic
967870542 3:194225482-194225504 GTCGCAATGCACAGTGGTGTGGG - Intergenic
968962939 4:3754576-3754598 GCATCAAGGCACAGTGGAATTGG - Intergenic
969538300 4:7770141-7770163 GTCGCAAAGCACAGTGGACTGGG + Intronic
969871084 4:10105267-10105289 TAAGCAGGGCACAGCAGAGTTGG - Intronic
975164972 4:71168326-71168348 TTAGCCAGGCACAGTGGCGTGGG - Intergenic
983758706 4:171377353-171377375 GTTGCAAGGCACAGGGCAGCTGG + Intergenic
990378530 5:55197782-55197804 GTAACAAGGCCCAGTGAAGTGGG + Intergenic
992974915 5:82105680-82105702 GCAGCCAGGCACAAAGGAGTGGG - Intronic
996814829 5:127563371-127563393 GAAGCAAGGCACAGGGGACCAGG - Intergenic
997271410 5:132541296-132541318 GTTGCAAGGCACACCAGAGGTGG - Intergenic
997962794 5:138335362-138335384 CTAGGAAGGAACAGCCGAGTTGG - Intronic
1002549693 5:179978063-179978085 CCAGCAATGCACAGCGGACTTGG + Intronic
1010337095 6:74699048-74699070 GTAGCAATGTACAGTTGAGTAGG - Intergenic
1013260719 6:108438842-108438864 GTAGCTAGGGAAAGAGGAGTGGG + Intronic
1026156880 7:67834073-67834095 GAATCAATGCACAGAGGAGTTGG + Intergenic
1029619160 7:101679191-101679213 GGACCAGGGCACGGCGGAGTGGG + Intergenic
1030249587 7:107427688-107427710 CGAGCAAGGCACAGCCCAGTGGG - Intronic
1031206231 7:118761272-118761294 ATAGCATGGCACAGCGGGTTTGG - Intergenic
1034744609 7:153512890-153512912 TTAGCAAGGCAAAACGGAGAAGG - Intergenic
1036971661 8:13362126-13362148 TTTGCAAGGCAGAGAGGAGTTGG + Intronic
1037102555 8:15065172-15065194 GTAGCAAGGCACAGCGGAGTGGG - Intronic
1038328254 8:26588590-26588612 GTAGCACCGCACAGCAGAGATGG + Intronic
1039951327 8:42175008-42175030 GTACCAAGGTACAGTGGAGCCGG - Intergenic
1041904832 8:63020959-63020981 GTAGCAAGGTACATCGGATTGGG + Intronic
1045332758 8:101169937-101169959 GAAGCAAGGCAAAGAGGACTTGG + Intergenic
1051671648 9:19516415-19516437 GAAGCAGGGCAGAGGGGAGTGGG + Intronic
1052538781 9:29779971-29779993 GGAGCAAGGGACTACGGAGTTGG - Intergenic
1054374266 9:64437689-64437711 GCACCAAGGCACAGCAGAGAGGG - Intergenic
1061045746 9:128163919-128163941 GGAGAGAGGCACAGCGGTGTGGG - Exonic
1187947652 X:24442016-24442038 GGAGGAAGGCAAAGCGGAGCAGG - Intergenic
1191979497 X:66910469-66910491 TGAGCAAGGCACAGAGCAGTAGG + Intergenic
1192670727 X:73137939-73137961 ATAGCCAAGCACAGCAGAGTTGG - Intergenic
1200623698 Y:5484809-5484831 GTAGCAAGGCAAAGGGGTTTGGG + Intronic
1201608608 Y:15815594-15815616 GTAGCAAGGAATAGAGGTGTAGG - Intergenic
1201985129 Y:19957467-19957489 TTAGCATGGCACAGCTGGGTGGG - Intergenic