ID: 1037103038

View in Genome Browser
Species Human (GRCh38)
Location 8:15071736-15071758
Sequence TGGGAGTAGCATAATCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037103031_1037103038 19 Left 1037103031 8:15071694-15071716 CCAACCTCAAAGTTAAAATAAAG 0: 1
1: 0
2: 3
3: 61
4: 642
Right 1037103038 8:15071736-15071758 TGGGAGTAGCATAATCAGATGGG No data
1037103032_1037103038 15 Left 1037103032 8:15071698-15071720 CCTCAAAGTTAAAATAAAGACCA 0: 1
1: 0
2: 0
3: 49
4: 469
Right 1037103038 8:15071736-15071758 TGGGAGTAGCATAATCAGATGGG No data
1037103035_1037103038 -5 Left 1037103035 8:15071718-15071740 CCAGCTTTTGTAACCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 158
Right 1037103038 8:15071736-15071758 TGGGAGTAGCATAATCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037103038 Original CRISPR TGGGAGTAGCATAATCAGAT GGG Intronic
No off target data available for this crispr