ID: 1037104711

View in Genome Browser
Species Human (GRCh38)
Location 8:15092865-15092887
Sequence ATTAGCAAATAGTTTTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037104711_1037104714 5 Left 1037104711 8:15092865-15092887 CCCACTTAAAACTATTTGCTAAT 0: 1
1: 0
2: 3
3: 22
4: 340
Right 1037104714 8:15092893-15092915 TAACAGGAAAACAGATGTGTAGG No data
1037104711_1037104715 23 Left 1037104711 8:15092865-15092887 CCCACTTAAAACTATTTGCTAAT 0: 1
1: 0
2: 3
3: 22
4: 340
Right 1037104715 8:15092911-15092933 GTAGGCATCCAAATAACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037104711 Original CRISPR ATTAGCAAATAGTTTTAAGT GGG (reversed) Intronic
902473156 1:16663943-16663965 ATTAGCTAATTTTTTAAAGTTGG - Intergenic
902485647 1:16743499-16743521 ATTAGCTAATTTTTTAAAGTTGG + Intronic
902499384 1:16898955-16898977 ATTAGCTAATTTTTTAAAGTTGG + Intronic
905384005 1:37586700-37586722 ATTAGGAAATATAGTTAAGTTGG - Intronic
907060695 1:51420898-51420920 TTTTCCTAATAGTTTTAAGTAGG - Intronic
907101281 1:51838916-51838938 AGTATTAAATAGTTTTAACTTGG - Intronic
907164871 1:52401512-52401534 ATTAGGAAATAACTTAAAGTGGG + Intronic
911579379 1:99617621-99617643 ATAAGTATATATTTTTAAGTAGG + Intergenic
912844217 1:113064585-113064607 ATTATAAAATATTTTTAAGATGG - Intergenic
913022166 1:114799048-114799070 ATTACCAAATATTTTGTAGTGGG + Intergenic
914097627 1:144557458-144557480 ATTAGCTAATTTTTTAAAGTTGG - Intergenic
914301366 1:146380159-146380181 ATTAGCTAATTTTTTAAAGTTGG + Intergenic
916189599 1:162166274-162166296 ATCACCACATGGTTTTAAGTAGG - Intronic
916330349 1:163609393-163609415 AATAGCAAATATTATTAAATAGG + Intergenic
917460686 1:175226499-175226521 ATTGGCAAATAGTTTTCAACAGG - Intergenic
917613933 1:176717447-176717469 ATTAGCATATAATTAAAAGTGGG + Intronic
919470843 1:197977441-197977463 ATTAGAGAGTAGTTTTAACTAGG + Intergenic
920063419 1:203245846-203245868 ATTTGCATATAATTATAAGTGGG - Intronic
921095880 1:211887000-211887022 ATTAGCAAGTAGTTGGAGGTGGG - Intergenic
922137845 1:222849881-222849903 ATTAGCAAATTGTCTTCAGAAGG + Intergenic
922337052 1:224626410-224626432 ACTCGCAAATATTTTTAATTTGG + Intronic
922508186 1:226139525-226139547 ATTAGAAAATATTTTAAACTGGG + Intergenic
923379574 1:233402254-233402276 ATGAGCATAGAGTTTTAATTTGG + Intergenic
923851359 1:237799457-237799479 ATGAAGAAATAGTTTTAAATTGG + Intronic
924605700 1:245532919-245532941 ATGCCCAAATACTTTTAAGTAGG + Intronic
1063931312 10:11031068-11031090 ATATGCAAAAATTTTTAAGTTGG - Intronic
1067299972 10:44999233-44999255 ATTATTAAATTGTTATAAGTTGG - Exonic
1068267351 10:54669746-54669768 ATTAGCACATATTTTAAATTTGG - Intronic
1068601756 10:58964208-58964230 CTTAGCAAAGAGTTGAAAGTTGG - Intergenic
1068752595 10:60612396-60612418 AATAGAAGATACTTTTAAGTTGG + Intronic
1069322677 10:67192212-67192234 AAAAGCAAAAAGATTTAAGTGGG + Intronic
1069356506 10:67592664-67592686 CTGAGTAAATAATTTTAAGTTGG - Intronic
1069400247 10:68036637-68036659 ATTGGCATGTAGTTTTATGTGGG - Intronic
1070050657 10:72886407-72886429 ATTATTAAACAGTTATAAGTTGG - Exonic
1070151765 10:73809698-73809720 ATCAGAAAACAGTTTTAAGGAGG + Intronic
1070740027 10:78896878-78896900 ATAAACAAATAATTTTAATTTGG - Intergenic
1070904222 10:80057463-80057485 ATAAGCAAATTGTTTTCACTGGG - Intergenic
1071655227 10:87440460-87440482 ATAAACAAATTGTATTAAGTGGG + Intergenic
1072135417 10:92540932-92540954 ATTTGCAAATAGTTCTTACTGGG - Intronic
1073958768 10:108902236-108902258 ATAGGCAAATATTTTTAAATAGG + Intergenic
1076292578 10:129358841-129358863 ATTGGCAAATGTTTTTAAATGGG + Intergenic
1078439093 11:11349462-11349484 ATTGGCAAAAATTTTAAAGTTGG - Intronic
1079856027 11:25606322-25606344 ATTATAATATAGTTTGAAGTCGG + Intergenic
1080159548 11:29156706-29156728 TTTTGCATATTGTTTTAAGTAGG + Intergenic
1081010480 11:37805302-37805324 TTTAGCAAATAGTTTTTTTTTGG - Intergenic
1082977694 11:59089762-59089784 ATTAGAAAATAATTCTAAATTGG - Intergenic
1083543487 11:63531438-63531460 ATTAGCATATAATTAAAAGTGGG - Intergenic
1083959322 11:66005543-66005565 ACTGGCAAACACTTTTAAGTTGG + Intergenic
1083989569 11:66238669-66238691 ATTTGCAAAGATTTTAAAGTCGG + Intronic
1086145057 11:83542606-83542628 CTTAGCAAATGCTTTTTAGTGGG - Intronic
1086810005 11:91298100-91298122 ATCAGCAAATAATTTTACCTTGG + Intergenic
1087215406 11:95488030-95488052 TTAAGTAAATAGTTTAAAGTAGG + Intergenic
1087804006 11:102536020-102536042 ATTTGCTTATAGTTTTAATTGGG + Intergenic
1088152761 11:106765756-106765778 ATATGCAAATAGTTCTTAGTGGG - Intronic
1092095183 12:5836309-5836331 ATTTTTAAAAAGTTTTAAGTAGG - Intronic
1095400267 12:41806513-41806535 CTTATCAAATAGTTTGAAGTTGG + Intergenic
1096396224 12:51268997-51269019 TTTATCAAATAATTTTATGTCGG - Intronic
1096582322 12:52593885-52593907 ATGAGGAATTAGTGTTAAGTGGG + Intronic
1097916473 12:65025679-65025701 AATATGAAATGGTTTTAAGTTGG - Intergenic
1099706681 12:86162728-86162750 ATTAGCAAATGTTGTTAACTAGG + Intronic
1099768242 12:87018769-87018791 ATAAGCAAAAAGTTATCAGTAGG + Intergenic
1100041013 12:90317210-90317232 ATTAGCAAATATTTTTAAGGTGG - Intergenic
1100791790 12:98138309-98138331 ATTTGCAACTATTTTAAAGTAGG - Intergenic
1102363379 12:112309183-112309205 ATTAGCAAGTGATTTTCAGTTGG - Intronic
1102986921 12:117285716-117285738 TTTAGGAAATAGTTTAAAGTTGG - Intronic
1103773317 12:123346312-123346334 AATAGCAAATAGTGTTGAGGAGG - Intronic
1104415975 12:128596823-128596845 ATTAACAAACAGTCTTCAGTGGG - Intronic
1105576393 13:21657095-21657117 ATTATAAATTAGGTTTAAGTTGG + Intergenic
1105827521 13:24135747-24135769 ATTAGCAAAAAGCTTATAGTTGG - Intronic
1106174261 13:27315915-27315937 ATTAGCAACTAGTGGTAAATGGG + Intergenic
1107121575 13:36801867-36801889 ATGATCAAGTAGTTTTTAGTTGG - Intergenic
1107258375 13:38459258-38459280 ATCAGGAAATAGTTTTAACCAGG - Intergenic
1107514286 13:41114002-41114024 ATTAGGAGATACTTTTAAGGAGG - Intergenic
1108151704 13:47542711-47542733 ATCATTAAATAATTTTAAGTGGG - Intergenic
1108939192 13:55929608-55929630 GTTAGCAAATAGATATAAATGGG + Intergenic
1109087142 13:57988231-57988253 TTTAACTAATAATTTTAAGTAGG + Intergenic
1109379128 13:61535469-61535491 ATTAGCACATAATTAAAAGTGGG + Intergenic
1109937253 13:69304301-69304323 AAGAGCAAAAAGTTTTAAATAGG + Intergenic
1110062940 13:71065046-71065068 AAAAGCAAAAATTTTTAAGTGGG + Intergenic
1110085775 13:71377393-71377415 TGTAGCAAATATATTTAAGTAGG - Intergenic
1110809443 13:79795382-79795404 ATTTGAAAATAGTTTGAATTGGG + Intergenic
1110830161 13:80021568-80021590 ATTTGCAAATCATTTTTAGTTGG - Intergenic
1110930975 13:81216393-81216415 AATAGAAAATATTTTTAAGAAGG - Intergenic
1112064051 13:95772696-95772718 AACAGCAAATATTTTTAAGTGGG - Intronic
1112801994 13:103122573-103122595 ATTAACAACTAGTTTGATGTAGG + Intergenic
1114887740 14:26875174-26875196 ATATGCCAATAGTTTAAAGTAGG - Intergenic
1115340151 14:32285115-32285137 ACTAGCCTCTAGTTTTAAGTTGG + Intergenic
1116486633 14:45457388-45457410 ATTAGAAAATATTTATAATTTGG - Intergenic
1116588492 14:46740564-46740586 ATTAGCTCATATTATTAAGTAGG + Intergenic
1117127713 14:52648242-52648264 ATTACCGGTTAGTTTTAAGTAGG - Intronic
1117138027 14:52757229-52757251 ATTAGGAAATTGTTTTCAATAGG + Intronic
1117889305 14:60400530-60400552 ATAAGCAAATAGTTTAAATGTGG - Intronic
1117986525 14:61391465-61391487 TTTAGCAAATATATTTAATTTGG - Intronic
1121355975 14:93215352-93215374 TTTAGCAACTATTTTTAACTGGG + Intronic
1125218934 15:37310890-37310912 GTTGGCAAAGAGTTTTAAATTGG + Intergenic
1125438561 15:39675144-39675166 ATTGGCAAAAATTTTTAAGTCGG + Intronic
1126350170 15:47737746-47737768 CTTAGCAAATAGTCTAAAGTAGG - Intronic
1129104144 15:73294211-73294233 ATTATCAAACAGTTTTAAGGAGG + Intronic
1130790233 15:87146712-87146734 ATTAGCAAATATCTTGAGGTGGG - Intergenic
1132422627 15:101686131-101686153 ATGAGCAAATATTTTCAAATTGG + Intronic
1133446693 16:5867361-5867383 TTTAGAAGATAGTTTGAAGTGGG + Intergenic
1133555239 16:6900437-6900459 ATCAATAAACAGTTTTAAGTGGG - Intronic
1133654279 16:7844785-7844807 AGTAGGAAATAGATTTAAGTGGG + Intergenic
1134103252 16:11467751-11467773 ATTTGCAAATATTTTTAGTTTGG - Intronic
1134237780 16:12481120-12481142 ATTTGCAAATAGGGTTATGTTGG - Intronic
1138831781 16:60383278-60383300 GTTAGAAAATAGTTTTGAGCCGG + Intergenic
1139142910 16:64289710-64289732 ATTAAAAAAAATTTTTAAGTTGG - Intergenic
1141936196 16:87239919-87239941 ATTATAAAACAGTTTGAAGTGGG + Intronic
1145105664 17:20113895-20113917 AATACCAAATAGTTTTACATAGG + Intronic
1148251493 17:46084890-46084912 TTTTGCAAATAGTTTTTATTTGG - Intronic
1149090937 17:52778186-52778208 ATTATAAAATATTTATAAGTTGG - Intergenic
1150254512 17:63733148-63733170 CTTAGGAAATGGTTTTTAGTTGG - Intronic
1150537565 17:66058899-66058921 CTTATAACATAGTTTTAAGTTGG - Intronic
1151982028 17:77518570-77518592 TTTAGCAAAGATTTTAAAGTAGG - Intergenic
1155286503 18:24294000-24294022 TTGAGGAAACAGTTTTAAGTAGG + Intronic
1155748178 18:29387517-29387539 ACTTGGAAATAATTTTAAGTTGG + Intergenic
1156904754 18:42339418-42339440 ATTAGGTAACAGTTGTAAGTTGG + Intergenic
1158343712 18:56493391-56493413 CTTAGGAAATTGTTTTAATTTGG + Intergenic
1159285223 18:66340411-66340433 ATTTACAAATAGTTTTATGAAGG + Intergenic
1159762520 18:72445840-72445862 ATTAGCAAATTCTTAAAAGTTGG + Intergenic
1163901430 19:20104074-20104096 ATTAGAAAATATTTTTGTGTTGG + Intronic
1166349039 19:42185657-42185679 ATTAACATATGATTTTAAGTTGG - Intronic
1167056411 19:47113647-47113669 AAGAGCCAATAGTTTTAGGTGGG + Intronic
1202705342 1_KI270713v1_random:19002-19024 ATTAGCTAATTTTTTAAAGTTGG - Intergenic
925757244 2:7145416-7145438 ATTGGCCAATAGTCTTAATTAGG + Intergenic
925959362 2:9001608-9001630 ATTAGCTAAAGGTCTTAAGTTGG - Intronic
928008488 2:27584573-27584595 ATAAGTAAGTATTTTTAAGTAGG + Intronic
929766986 2:44853012-44853034 ATTGGTAAACATTTTTAAGTGGG + Intergenic
930173536 2:48276752-48276774 ATTAGCAAATAGTTACTTGTAGG - Intergenic
930647976 2:53932111-53932133 AGAAGCAAAAAGTTCTAAGTAGG + Intronic
931316478 2:61137323-61137345 TTTAGTAAATATTTTTAAGTTGG + Intronic
931390714 2:61841193-61841215 ATTATCAAAAAGTTTCAAGCAGG - Intronic
931596185 2:63946813-63946835 ATTGGCAAATCTTTTTAAATAGG + Intronic
932499190 2:72167221-72167243 ATTGGCACATAGTATTAACTAGG - Intergenic
936611620 2:114007428-114007450 ATTTGCAAGTAGTTTCAGGTGGG + Intergenic
937254318 2:120544410-120544432 ATTATCAAAGAGTTTCAAGATGG + Intergenic
938746496 2:134283354-134283376 TTTGGCAAATGGTTTTAAGAGGG + Intronic
939292370 2:140212881-140212903 TTTAGCAAATGGTTTTAGATAGG + Intergenic
941245888 2:163096400-163096422 ATGAGAAGATAGTTTCAAGTAGG + Intergenic
942139049 2:172958888-172958910 ATTAACAATAAGTTTCAAGTGGG - Intronic
942174916 2:173324024-173324046 GTTAGCAAAGATTTTTAAGATGG - Intergenic
943576160 2:189633477-189633499 ATAAGCAAGTGGTTTTAATTGGG + Intergenic
943844040 2:192618989-192619011 ATTAGCAAGTATTTTTAACGAGG - Intergenic
943847124 2:192665145-192665167 AATAACAATTATTTTTAAGTTGG + Intergenic
944066689 2:195626140-195626162 ATCAGCACCTAGTTTTAAATCGG - Intronic
944149214 2:196539330-196539352 ATAAACAAATACTTTTACGTAGG + Intronic
944616911 2:201470150-201470172 ATTAGCATCTAGTTTTATGCTGG - Intronic
944726880 2:202480423-202480445 ATTAGAAAATGGTTTCAGGTTGG - Intronic
944817486 2:203393023-203393045 ATTATCAAATAATTTTTACTTGG + Intronic
945543236 2:211115543-211115565 TTTATCAAATATTTTTAAGGTGG + Intergenic
945721545 2:213423353-213423375 ATTAAGAAATATTTTTAAATAGG + Intronic
945910927 2:215648121-215648143 ATAAGCATAGATTTTTAAGTTGG + Intergenic
946120545 2:217509452-217509474 ATTTGAAAATATTTTTAATTGGG + Intronic
947011214 2:225569083-225569105 GATAGCAAATAATTTTTAGTGGG + Intronic
1169019980 20:2322815-2322837 ATTAGAAAATATATGTAAGTTGG - Intronic
1174231320 20:49047413-49047435 ATGTGCAAATAATTTTAAATCGG - Intronic
1175623799 20:60473679-60473701 ATAAGCAAATATATTTAATTTGG + Intergenic
1176990152 21:15485989-15486011 ATTTTCAATTAATTTTAAGTGGG - Intergenic
1177345193 21:19858239-19858261 ATTACAAAATAGATTTTAGTAGG - Intergenic
1177607424 21:23399509-23399531 ATTAATAAATAATTTAAAGTAGG + Intergenic
1177814617 21:25962619-25962641 TTTAGAAAGTAGTTTTAACTGGG + Intronic
1178000397 21:28155809-28155831 ATTTTCAAATATTTTGAAGTTGG + Intergenic
1179417732 21:41211855-41211877 ATTAGCAAATGGCTTTCTGTAGG + Intronic
1181874906 22:25932704-25932726 ATTAGAAAATATTTTTAGGCAGG - Intronic
1183174746 22:36214662-36214684 CTTAGGAAAGAGTTTTAAGAAGG + Intergenic
1184105933 22:42367644-42367666 ATCAGCAAATAGTTACAAATAGG - Intergenic
1184632472 22:45793990-45794012 ATTCGCATATAGTTAAAAGTGGG - Intronic
1184816152 22:46872691-46872713 ATTAGGAAAGAGTTTTGAGGAGG + Intronic
1185131894 22:49044020-49044042 ATTAGCATGTAGTTAAAAGTGGG - Intergenic
1185300065 22:50074886-50074908 ATTAGCATATACTTAAAAGTGGG + Intronic
949176574 3:1070353-1070375 ATTAGCAGATATTTTTAAGATGG - Intergenic
949690079 3:6626575-6626597 TTTAGAATATAGCTTTAAGTAGG - Intergenic
950982973 3:17328934-17328956 ATGAGGAAATAGTTTTAAAAAGG + Intronic
952305504 3:32142628-32142650 ATTGGCAAATAGGATTGAGTTGG - Intronic
952536162 3:34311219-34311241 ATAAGCAACTATTTCTAAGTGGG - Intergenic
952713799 3:36457877-36457899 AATAGCAAATAGAGTTAGGTTGG - Intronic
953147269 3:40290370-40290392 TTTATTAAAAAGTTTTAAGTAGG - Intergenic
953151275 3:40327434-40327456 ATTAGAAAATGGTTGTATGTAGG - Intergenic
954173937 3:48828165-48828187 GTTAGAAAAAAGTTTAAAGTTGG - Intronic
954358333 3:50102124-50102146 ACTATCAAACAGATTTAAGTAGG - Intronic
955129921 3:56156230-56156252 ATGAGTGAATAGTTTTAAGAAGG + Intronic
957323430 3:78661666-78661688 ATTTCCAAGTAGTATTAAGTAGG - Intronic
957339405 3:78874386-78874408 ATTTAAAATTAGTTTTAAGTTGG - Intronic
957526202 3:81381082-81381104 TTTTGCAAATATTTTTAATTGGG - Intergenic
958460920 3:94394281-94394303 ATGCTAAAATAGTTTTAAGTGGG - Intergenic
958662053 3:97081893-97081915 AGTTGAAAATAATTTTAAGTTGG - Intronic
958933056 3:100228061-100228083 ATTAGCAATTATTGTTAATTTGG + Intergenic
959098752 3:101986484-101986506 ATTAAAAAATATTTTTGAGTGGG + Intergenic
960020794 3:112950068-112950090 ATTTCCAAATACTTTTAATTTGG - Intronic
960733495 3:120752011-120752033 ATTAAAAAAAATTTTTAAGTGGG + Intronic
961026560 3:123563450-123563472 ACCAGCAAAAGGTTTTAAGTAGG + Intronic
963668273 3:148218103-148218125 ATTGCCATATAATTTTAAGTGGG - Intergenic
964021027 3:152011066-152011088 ATTAGGAAATAGATTTCATTAGG - Intergenic
964993682 3:162846958-162846980 ATGAGCATATAATTTTAAATAGG - Intergenic
965986914 3:174765223-174765245 AGTAGCTAATATCTTTAAGTGGG - Intronic
966072567 3:175896453-175896475 ATTTGCATATAATTTAAAGTGGG + Intergenic
966776390 3:183546317-183546339 CCTAGCAAATAGTTTTGAATTGG + Intronic
966813179 3:183866784-183866806 ATTACAAAATAGATTTAAGAGGG + Intronic
966861262 3:184231991-184232013 ATAAGCAAATGCTTATAAGTAGG + Intronic
967750337 3:193107368-193107390 TTTAGCAAACAATTTTAATTTGG - Intergenic
968055443 3:195688015-195688037 ATTAGAAAATAATATTAGGTTGG + Intergenic
968100352 3:195960583-195960605 ATTAGAAAATAATATTAGGTTGG - Intergenic
969167297 4:5327862-5327884 AATAGCAAATAGCTTTATATTGG - Intronic
969191521 4:5524918-5524940 ATTAGCATATAATTAAAAGTGGG - Intronic
970589749 4:17549103-17549125 ATTAGCTAATAGTTTTACCATGG + Intergenic
971619234 4:28832881-28832903 GGTAGCAAATAGTTTTACGAAGG + Intergenic
972668748 4:41193792-41193814 ACTAGCAAGTAGTTGTAAGAGGG + Intronic
972908861 4:43788157-43788179 ATTAGTAAATATAATTAAGTGGG + Intergenic
974690030 4:65286753-65286775 ATTAGAAAATAGTATAAAATAGG - Intergenic
974813652 4:66978346-66978368 AATGGAAAATAATTTTAAGTAGG - Intergenic
975532499 4:75415222-75415244 ATTGGGAAATATTTTTAAATTGG - Intergenic
976013293 4:80518569-80518591 TTTAGCACATCGTTTTAAGAGGG + Intronic
976385687 4:84455324-84455346 AGTCACAAAAAGTTTTAAGTGGG - Intergenic
976962475 4:90995744-90995766 AAAAGCATATAGTTTTAATTTGG - Intronic
977175856 4:93818480-93818502 GATGGCAAATAGTTTTGAGTGGG + Intergenic
977375167 4:96193719-96193741 ATTAACATTTAGTATTAAGTTGG - Intergenic
979033427 4:115680484-115680506 ATTTGTATATAGTTTTATGTAGG + Intergenic
980460029 4:133097469-133097491 ATTAGAAAATAGGCTTAAGTAGG + Intergenic
980569455 4:134595066-134595088 ATAAGCTAACAGTTTTAAATGGG - Intergenic
980738885 4:136925881-136925903 ATTGGCAAATCTTTTTAAATAGG - Intergenic
981230564 4:142349475-142349497 CTTAGCAAATAGTTTGAAACTGG + Intronic
982386146 4:154804621-154804643 ATTAGCAAATAATTTTAAGCAGG + Intronic
982428242 4:155292605-155292627 ACTAGTAATTAATTTTAAGTGGG - Intergenic
982439985 4:155424043-155424065 ATTTGCAAACATTTTTCAGTAGG + Intergenic
982601560 4:157457662-157457684 ATTATGAAATATTTTTATGTAGG - Intergenic
983009899 4:162534976-162534998 ATTAGCAATTCTTTTTAAGCAGG - Intergenic
983720399 4:170844267-170844289 CTTACAAAATATTTTTAAGTAGG + Intergenic
984605239 4:181778269-181778291 ATAAGAAAATATTTTTAAGTAGG - Intergenic
985734337 5:1569504-1569526 ATTAGAAAATAATATTAGGTTGG - Intergenic
986552784 5:8977565-8977587 ATTAGCGAACAGTGTTAAGTAGG - Intergenic
988453626 5:31367903-31367925 TTTAGATAATAGTTTTGAGTTGG - Intergenic
989660386 5:43791531-43791553 ATTTGCAAATTGATTTTAGTGGG - Intergenic
990284914 5:54291796-54291818 ACTATTAAATAGTTTTAAGCAGG - Intronic
990778648 5:59332990-59333012 AATAGGAATTACTTTTAAGTAGG - Intronic
991268620 5:64752075-64752097 ATTAGAATTTATTTTTAAGTTGG - Intronic
991957525 5:72010466-72010488 ATAAGTAAATAATTTTAAGTTGG - Intergenic
992153476 5:73929762-73929784 GTTAGCAAATATCTTAAAGTTGG + Intronic
993462850 5:88206330-88206352 ATTAGTAAAGAGTTTTAAGTTGG - Intronic
993711784 5:91232010-91232032 ATAAATAAATAATTTTAAGTTGG - Intergenic
993762512 5:91813594-91813616 ATTAGAACATATTTTTAACTGGG - Intergenic
994060273 5:95468653-95468675 AGTAGCAATTAGTTTGAAGCAGG + Intronic
994240480 5:97414382-97414404 ATTACAGAATAGTATTAAGTAGG + Intergenic
994586856 5:101719729-101719751 ATTAGCAAATTGTTTTCTTTTGG - Intergenic
995199840 5:109413602-109413624 ATTAGCATATAATTAAAAGTGGG - Intergenic
995963383 5:117873089-117873111 ATTAGCATATAATTTAGAGTAGG - Intergenic
996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG + Intergenic
997559391 5:134832725-134832747 ATTAGCATATTGTTTAAAATAGG + Intronic
998312211 5:141144849-141144871 ATTAGCAAATATTTTAAGGTAGG - Intronic
998453598 5:142253434-142253456 ATTAGCAACTAATTTAAATTTGG + Intergenic
998794217 5:145800402-145800424 ATGAGCAAATCATTTTAAATAGG - Intronic
999095356 5:148973191-148973213 TTGAGCAAATAGTTTTCACTAGG + Intronic
999927055 5:156390425-156390447 TTTATCAAAAAGTTTAAAGTGGG + Intronic
1000448002 5:161348170-161348192 ATTACAAAATAATTTTATGTGGG + Intronic
1001177893 5:169489184-169489206 AATAACAAAAAGTTTAAAGTGGG + Intergenic
1002848868 6:973170-973192 ATTAGTTAATAATTTAAAGTTGG + Intergenic
1003295644 6:4824640-4824662 ATTTGCAAATATTTTTATGTTGG + Intronic
1005147946 6:22713465-22713487 ATTCACAAATAGATTTAATTGGG + Intergenic
1005157797 6:22827164-22827186 ATAAGCAAATAGTTATAATTCGG - Intergenic
1005526677 6:26658374-26658396 AGTAGAAAATAGCCTTAAGTTGG + Intronic
1007947790 6:45841422-45841444 TTTGGGAAATAGTTTTAAATAGG - Intergenic
1008756716 6:54804474-54804496 ATAAGAAAACAATTTTAAGTAGG + Intergenic
1008860229 6:56140255-56140277 CTCAGCAAATAGTCTTCAGTTGG - Intronic
1009603945 6:65841568-65841590 ATTTACAAATATTTTTTAGTGGG - Intergenic
1009890912 6:69680766-69680788 ATTAGCAAAAATTTTTATATGGG - Intronic
1010946289 6:81976841-81976863 ATAAGAAAAAAGATTTAAGTGGG - Intergenic
1010994581 6:82518453-82518475 ATTAGAAAACATTTTTAACTGGG - Intergenic
1011443740 6:87414925-87414947 ATTTGCAAAAAGTTCTCAGTTGG + Intronic
1013021137 6:106220584-106220606 ATTTGCTAATAATTTTAAGTAGG - Intronic
1013546605 6:111164162-111164184 ATTAAATAATTGTTTTAAGTTGG - Intronic
1013930452 6:115524606-115524628 TTTAAAAAATAATTTTAAGTAGG + Intergenic
1014258931 6:119194268-119194290 ATTAGCAAATCTTTTTTAGAAGG + Intronic
1014649184 6:124014641-124014663 ATAAGTAAATATTTTTAATTAGG - Intronic
1015043104 6:128745247-128745269 ATTAGCAAATTATTTGAAATGGG + Intergenic
1015822203 6:137275707-137275729 AATAGAAAATATTTTTATGTTGG + Intergenic
1016090651 6:139975055-139975077 ATTATCTAATAGTTTTCATTGGG + Intergenic
1016244100 6:141962716-141962738 ATCAGGAAATGGATTTAAGTTGG + Intergenic
1016860603 6:148715056-148715078 ATCACCAAAAAGTTATAAGTGGG - Intergenic
1017638875 6:156471271-156471293 GTCAGCAAATAATTTTAAGTTGG + Intergenic
1022163209 7:27732518-27732540 ATAAGGAAAAAGTTTTAAGCAGG + Intergenic
1022875450 7:34523396-34523418 TTTAGAAAATTGTTTTCAGTGGG - Intergenic
1024771230 7:52725507-52725529 ATCAGGAAATATTTTTCAGTAGG - Intergenic
1025875156 7:65474702-65474724 ATCAGCATATAGGCTTAAGTTGG + Intergenic
1026173931 7:67979170-67979192 CTTAGGAAATATTTTTGAGTTGG + Intergenic
1026420286 7:70229563-70229585 ATTATCAAATAATTCTAAGTAGG - Intronic
1027529835 7:79316414-79316436 AATAGCATATATTTTTCAGTGGG - Intronic
1027595512 7:80168776-80168798 ATTGGTAAAGAGTTTTAATTTGG - Intronic
1028517333 7:91692310-91692332 ATTATAAAATAATTTTGAGTTGG + Intronic
1028956495 7:96699194-96699216 ATTAGCAACTAGTTTGATATGGG - Intronic
1029956586 7:104646560-104646582 ATAAGAAAATTGTTTTAACTGGG + Intronic
1030938394 7:115615101-115615123 ATCAGCAATTAATATTAAGTTGG - Intergenic
1031106593 7:117551011-117551033 ATTACCAAATTGTATTGAGTGGG - Intronic
1031180648 7:118410439-118410461 ATTAGCCAATATTTTGAAATAGG - Intergenic
1031278082 7:119757552-119757574 ATAAAGAAATACTTTTAAGTAGG + Intergenic
1031522517 7:122783841-122783863 TTTAGTAAATAGCTTAAAGTTGG - Intronic
1031818931 7:126474177-126474199 CTTTGCAAATACTTTTTAGTTGG - Intronic
1032282939 7:130519768-130519790 ATTAGAAAGCAGTTTTGAGTAGG + Intronic
1033957092 7:146863266-146863288 ATAAGAAAATAGTTTTAAAAAGG + Intronic
1034383994 7:150722759-150722781 ATTTGCATATAGTTGAAAGTGGG - Exonic
1035933631 8:3811993-3812015 ATTAGTAAATGGTTTGAATTAGG - Intronic
1036404956 8:8446564-8446586 ATTAAAAAATATTTTTAAGGAGG + Intergenic
1037104711 8:15092865-15092887 ATTAGCAAATAGTTTTAAGTGGG - Intronic
1037291806 8:17358799-17358821 CTTATAAAATAATTTTAAGTTGG + Intronic
1038058124 8:23881343-23881365 TTTAGCAAGTTGTTTAAAGTCGG - Intergenic
1038284038 8:26190888-26190910 ATTAACAAATCGTTTGAAGAAGG + Intergenic
1038906536 8:31910399-31910421 ACTATCAAAGAGTTTTAAGCAGG + Intronic
1039109577 8:34027053-34027075 ATTATCAAAAAGTATTAAGGTGG - Intergenic
1040946349 8:52889061-52889083 ATGATCAAATAGTTGTAGGTGGG - Intergenic
1041892975 8:62891936-62891958 ATTCTCAAATAGTTTTCAGCAGG - Intronic
1042015576 8:64306054-64306076 ATTAGCTATTACTTTTAATTAGG - Intergenic
1042099511 8:65259582-65259604 CTTAGCAAATCGTTTTATTTGGG + Intergenic
1043705894 8:83350096-83350118 ATCAGCTAATAGTTTTATTTTGG + Intergenic
1044541553 8:93413876-93413898 ATTATCAAAAGGTTTTAAGCAGG - Intergenic
1044890090 8:96825508-96825530 AGTACCAAATAGTTTTAAGGAGG - Intronic
1045051245 8:98327819-98327841 CCTAGCATTTAGTTTTAAGTTGG - Intergenic
1045668306 8:104515658-104515680 AAAAGCAAATACCTTTAAGTGGG + Intronic
1046327414 8:112667988-112668010 AATAGCAAATATTTATAAATTGG + Intronic
1047482427 8:125297420-125297442 ATTTTCAAATAGTTCTAAATGGG + Intronic
1048905901 8:139088501-139088523 ATAAGAATATATTTTTAAGTTGG + Intergenic
1050251280 9:3747557-3747579 GTAAGCAATTATTTTTAAGTTGG + Intergenic
1050666884 9:7948327-7948349 ATTAGACAATATTTTTAAGATGG + Intergenic
1050670460 9:7990951-7990973 AGTAGCAAATAGGTTCAAGGAGG - Intergenic
1050688154 9:8195332-8195354 ATTAGAGTATAGTTTGAAGTCGG - Intergenic
1051302137 9:15663307-15663329 TTTAGAAAATAGTTTAAAGACGG - Intronic
1051706009 9:19880635-19880657 ATTAGCAAATAATGTTAGCTTGG - Intergenic
1051776103 9:20635863-20635885 ATTAACAAATATTTTAAAGTAGG + Intergenic
1052131647 9:24855620-24855642 ATTTGCACATAATTTAAAGTGGG + Intergenic
1052437591 9:28448503-28448525 TTTAGCAAATAGCTTTATATAGG - Intronic
1052552107 9:29965159-29965181 ATTAACAAATAATTATAGGTTGG + Intergenic
1053256614 9:36622068-36622090 ATTAGTAAATACTATTAATTAGG - Intronic
1053309904 9:37011295-37011317 AGTTGCTAATATTTTTAAGTTGG + Intronic
1053554337 9:39119637-39119659 AGTAGCAAAAAGATGTAAGTGGG + Intronic
1055374325 9:75632709-75632731 TTTAAAAAATAGTTTTAAGTTGG + Intergenic
1055857617 9:80709796-80709818 ATTTGCACATATTTATAAGTAGG + Intergenic
1059053085 9:110949581-110949603 AATAGCAAGTAATTTTAGGTAGG - Intronic
1059412895 9:114144364-114144386 ATTAGCAAATGCTATTAATTAGG - Intergenic
1059700457 9:116770868-116770890 ATTAGCACATTGGTTTAGGTAGG - Intronic
1062608283 9:137358669-137358691 ATTTTAAAAAAGTTTTAAGTAGG - Intronic
1187313815 X:18173048-18173070 ATTGGAAAATATTTTTAAGAGGG - Intronic
1187331946 X:18349222-18349244 AGGAGCAAATTGTTTTAAGAGGG - Intronic
1191159746 X:57316460-57316482 TTTATAATATAGTTTTAAGTGGG - Intronic
1191936634 X:66434175-66434197 ATTAGGTAAAAGTTTTAAGCAGG + Intergenic
1192328718 X:70156589-70156611 ATTAGAAAATACTTCTAACTGGG + Intronic
1192709505 X:73564998-73565020 ATTAACAAATATTTTGAAATTGG + Intronic
1192868813 X:75165634-75165656 ATTAACAAAAAGTATTAATTAGG + Intergenic
1193419246 X:81263884-81263906 GTTACCTAATAGTTTTGAGTGGG - Intronic
1194048917 X:89043355-89043377 ATTTTCAAAATGTTTTAAGTAGG + Intergenic
1194092399 X:89594075-89594097 ATAAAAAAATAGTTATAAGTTGG + Intergenic
1194161625 X:90459532-90459554 ATTAGCAAATATATTTATATCGG - Intergenic
1194288707 X:92041307-92041329 ATAAGAAAATAATTTTAATTAGG - Intronic
1194400974 X:93437455-93437477 ATTAGTAATTATTTTTAAGATGG - Intergenic
1194429847 X:93788537-93788559 ATTAGAAAATTTTTTTAAATTGG - Intergenic
1194855992 X:98929832-98929854 TTTATCAAATATTTTCAAGTAGG + Intergenic
1195095986 X:101501637-101501659 ATTAGCATATAATTATGAGTGGG - Intronic
1195101371 X:101557305-101557327 ATCAGCATATAATCTTAAGTGGG + Intergenic
1195628091 X:107024448-107024470 AATAACAAATATTTTTAAATGGG - Intergenic
1196137222 X:112223045-112223067 TTTTGCAAATAGTTTGAACTGGG + Intergenic
1196967555 X:121074906-121074928 ATTAGCAAATTGAATTAAGCAGG - Intergenic
1198157367 X:133974671-133974693 ATCAGCATATAGGCTTAAGTTGG - Intronic
1198676785 X:139139709-139139731 CTTAGCATGTAGTTCTAAGTAGG - Intronic
1198729551 X:139714405-139714427 ATGAGTAACTAGTTTTAAGAAGG - Intergenic
1199021222 X:142880859-142880881 TAAAGCAAATAGTTTTGAGTGGG + Intergenic
1199281166 X:146001494-146001516 ACTAACAGATAGTTTAAAGTGGG + Intergenic
1199312883 X:146342219-146342241 ATATGCAATTAGTTTTTAGTAGG + Intergenic
1200386848 X:155901086-155901108 AGTTGCAAATACTCTTAAGTAGG + Intronic
1200507911 Y:4037265-4037287 ATTAGCAAATATATTTATATCGG - Intergenic
1200606226 Y:5265872-5265894 ATAAGAAAATAATTTTAATTAGG - Intronic