ID: 1037106943

View in Genome Browser
Species Human (GRCh38)
Location 8:15120356-15120378
Sequence GGGGAAAATACTACCTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037106943_1037106949 6 Left 1037106943 8:15120356-15120378 CCTATACAGGTAGTATTTTCCCC 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1037106949 8:15120385-15120407 TTAGAAATATAGCTCAGCTTGGG No data
1037106943_1037106950 7 Left 1037106943 8:15120356-15120378 CCTATACAGGTAGTATTTTCCCC 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1037106950 8:15120386-15120408 TAGAAATATAGCTCAGCTTGGGG No data
1037106943_1037106948 5 Left 1037106943 8:15120356-15120378 CCTATACAGGTAGTATTTTCCCC 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1037106948 8:15120384-15120406 CTTAGAAATATAGCTCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037106943 Original CRISPR GGGGAAAATACTACCTGTAT AGG (reversed) Intronic
903301370 1:22380730-22380752 GGGGAAGAGACCACCTGTAGGGG - Intergenic
905792629 1:40798370-40798392 GTCCAAAATACTACCTGTACTGG + Intronic
906677792 1:47705774-47705796 GGGGAAAAAATTGCCTGTGTTGG - Intergenic
910463727 1:87474737-87474759 GGTGAAAATAGTACAGGTATGGG - Intergenic
910655797 1:89616643-89616665 GGGGAAAAGACAACCTTTCTTGG + Intergenic
911190898 1:94947526-94947548 GAGGAAAATACTAACAGTTTTGG + Intergenic
914358452 1:146909201-146909223 GGTGAAAATAGTACAGGTATGGG - Intergenic
914494973 1:148187806-148187828 GGTGAAAATAGTACAGGTATGGG + Intergenic
918128445 1:181604506-181604528 GAGGAAAATACTGCCTGCAAGGG - Intronic
918203603 1:182289788-182289810 TGGGAAAATACTACCTTTCTAGG + Intergenic
918609981 1:186478275-186478297 GGAGAAAATAGTACCTGAACTGG + Intergenic
920161678 1:204003319-204003341 GGGGAAAATACCACCATTATCGG - Intergenic
923359735 1:233199140-233199162 GGGGTAAATAATACATCTATGGG + Intronic
1063448975 10:6138720-6138742 GGGGAAAATGGTAACTTTATAGG - Intergenic
1069140093 10:64811579-64811601 GGGGATGATACTAACAGTATGGG - Intergenic
1079291615 11:19193267-19193289 AGGGAAAAGAATAACTGTATAGG - Intronic
1079565257 11:21875066-21875088 AGGGAAAATATTGCCTGAATTGG - Intergenic
1081260682 11:40956537-40956559 GGGGATAATATTACCTTTCTAGG + Intronic
1081491461 11:43572608-43572630 GGGAAAAATAATAACTGTTTTGG + Intronic
1085941620 11:81212442-81212464 TGGGAAAATAATACCTGAATGGG + Intergenic
1086591239 11:88516529-88516551 TGGGAAAATAATTCCTGTTTAGG + Intronic
1090052597 11:123393180-123393202 GGGGAAATTACTTAATGTATAGG - Intergenic
1091947062 12:4556105-4556127 GGGGATAGTAATATCTGTATTGG + Intronic
1099980695 12:89598616-89598638 GAGGAAAACACTACATGTGTAGG + Intronic
1100501420 12:95177683-95177705 GGGAAAAAAACTACCATTATGGG + Intronic
1103412510 12:120722558-120722580 GGCAAAAAAACTACCTGCATAGG + Exonic
1109276531 13:60310049-60310071 GGGGGCAATATTACCTGCATTGG + Intergenic
1115651553 14:35405479-35405501 GGGGCAAACGCTCCCTGTATGGG + Intergenic
1115882117 14:37931238-37931260 GGGGATAATACTTCCTACATAGG + Intronic
1117110345 14:52446829-52446851 AGGGAAACTGCTACCTCTATGGG + Intronic
1120293996 14:82615616-82615638 AGGGAAAATAATACATTTATAGG - Intergenic
1120465361 14:84849607-84849629 GGGGAAAATATTACATGCAGAGG - Intergenic
1125061075 15:35425075-35425097 ATAGAAAATACTACTTGTATTGG - Intronic
1128430925 15:67592348-67592370 GGGGAAAATACCAATTTTATAGG - Intronic
1128434328 15:67630906-67630928 TGGGAAAATATTAGCTGTAAAGG + Exonic
1131045326 15:89310450-89310472 GGGGAAAATAATAGCAGTCTAGG - Intronic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1141827659 16:86492505-86492527 GGGGATAATACCACCTGCCTTGG + Intergenic
1146581827 17:34045224-34045246 GGGAATATTACTACCTGTGTTGG - Intronic
1149725049 17:58884751-58884773 GGGGATAATACTTCCTTTGTAGG + Intronic
1164262858 19:23583354-23583376 GGAGAAAATACAACCTGTAAGGG - Intronic
930418944 2:51125289-51125311 GTGTAAATTAATACCTGTATGGG + Intergenic
931462612 2:62461822-62461844 GGTGAAGATACTGCCTGTAATGG + Intergenic
932254295 2:70270586-70270608 GGGGAAAATATTTCCGGTAGAGG - Intronic
936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG + Intronic
942430825 2:175909567-175909589 AGAGGAAATACTACCTGTCTTGG + Intergenic
944752633 2:202726732-202726754 GGGAATAATAATACCTGTCTCGG + Intronic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
1172805087 20:37606193-37606215 GTGTAAAATATTAACTGTATTGG - Intergenic
1176327899 21:5518251-5518273 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1176399858 21:6302700-6302722 GAGGAAAATAATAGCTGTTTTGG + Intergenic
1176437299 21:6686404-6686426 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1176461561 21:7013474-7013496 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1176485122 21:7395252-7395274 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1181879794 22:25969076-25969098 GGGGAAATTACTACCTCTGTGGG + Intronic
1184223183 22:43113706-43113728 GGGGAAAATACCACCAGCAGTGG - Intronic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
953588328 3:44226111-44226133 GGGGAAAAAAAAACCTGAATAGG + Intergenic
956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG + Intronic
958332594 3:92509207-92509229 GTGGAAAATTCTAGCAGTATGGG + Intergenic
958352491 3:92835354-92835376 GTGGAAAATTCTAGCAGTATGGG + Intergenic
958972736 3:100630713-100630735 TGTGAAAATAGTACCTATATGGG + Exonic
959457078 3:106575860-106575882 GGGGAAAATATTACTTACATGGG + Intergenic
959792553 3:110380721-110380743 GGGGAAAATATTAACAATATAGG + Intergenic
960524951 3:118699031-118699053 TGGAAAAATACCACCTGTATGGG - Intergenic
963709856 3:148734812-148734834 GAGGCAAATACAACCTGTAAAGG + Intronic
964113868 3:153114955-153114977 AGGGAATATACTAGCTGTTTTGG + Intergenic
964396200 3:156248766-156248788 GGGGAAAATACTATCTTGCTGGG - Intronic
964925086 3:161946181-161946203 GATGAAAATACTCCTTGTATTGG + Intergenic
966655720 3:182356132-182356154 GTGGAATATGCTACCTTTATAGG + Intergenic
967977386 3:195043104-195043126 GGCAAAAATTCTACCTGGATGGG - Intergenic
976371358 4:84292293-84292315 GTGGAAAATACTACATGCATTGG + Intergenic
978512074 4:109531154-109531176 AGGGAAAATAATACCTCTTTAGG - Intronic
980989383 4:139725910-139725932 GGGGAAAACACTACCTTCCTCGG - Intronic
981273873 4:142875183-142875205 GGGGGAAATCCTACTTGTCTGGG - Intergenic
981418400 4:144520172-144520194 GGGAACACCACTACCTGTATTGG - Intergenic
982263706 4:153519062-153519084 GGGGAAAATTCCACATGTAAAGG + Intronic
988175053 5:27712571-27712593 GGGGAAAATACAAGCTGTTCTGG + Intergenic
990645013 5:57834284-57834306 AGGGACAACACTACCTGTATTGG + Intergenic
991436286 5:66599133-66599155 GGGGAAAAAACTACATGGTTTGG - Intronic
991512230 5:67392186-67392208 GGGGAGAATACAACCTGTTAAGG + Intergenic
993994668 5:94708701-94708723 GGGGAAAAAACTGGGTGTATTGG - Intronic
994740273 5:103609723-103609745 GAGGAAAATACAACTTGTAAAGG + Intergenic
995752726 5:115470787-115470809 AGGGAAAATACTGCCTCTCTGGG - Intergenic
1001063452 5:168515135-168515157 GGGGAAAATACTAACTTTACAGG - Intronic
1003182521 6:3804401-3804423 GGGGAAATTTATACCTGTAATGG - Intergenic
1004033181 6:11893665-11893687 GGGAAAAGTACAACCTGTACAGG - Intergenic
1004545201 6:16591620-16591642 AGGGAAAATACAATATGTATGGG - Intronic
1004853379 6:19724300-19724322 GGGGACAATTCTACCTCTAGGGG + Intergenic
1005480662 6:26252135-26252157 TAGGAAAATTTTACCTGTATTGG - Intergenic
1016895471 6:149047408-149047430 GTGGAAAATCCTACTTCTATTGG - Intronic
1017130811 6:151106946-151106968 GGGGAAAATACTTCACGAATTGG + Intergenic
1022974204 7:35542764-35542786 GAGGAAAATACTCTCTGTATTGG + Intergenic
1023285341 7:38613340-38613362 GGTGAAAGTTCTACCTGTATTGG - Intronic
1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG + Intergenic
1029239128 7:99146086-99146108 GGGGGAAATACTAACGGGATTGG - Intergenic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1040735153 8:50497268-50497290 GGGAAAAATATGACATGTATTGG - Intronic
1041816179 8:61974175-61974197 GGGGAAAATATGACGTGTTTAGG + Intergenic
1042094054 8:65192258-65192280 GGGCAAATCACTACCTCTATAGG + Intergenic
1043933884 8:86121108-86121130 GGAGATAATGCTATCTGTATAGG - Intronic
1044155234 8:88838384-88838406 GGGGAAAATAGAATCTTTATAGG - Intergenic
1045254025 8:100504159-100504181 AGGGAAAATAGTAACTTTATAGG + Intergenic
1046405217 8:113764067-113764089 GGGGAAAATAATGCCTGCAAAGG - Intergenic
1047893462 8:129338883-129338905 TGGAAAAATACTACATTTATTGG + Intergenic
1052199360 9:25759063-25759085 GAGAAAAATGCTACCTATATAGG + Intergenic
1053697753 9:40652585-40652607 GTAGTAAATACTAGCTGTATAGG - Intergenic
1053907639 9:42859862-42859884 GAGGAAACTGCCACCTGTATTGG + Intergenic
1054309044 9:63451993-63452015 GTAGTAAATACTAGCTGTATAGG - Intergenic
1054440985 9:65259941-65259963 GTAGTAAATACTAGCTGTATAGG - Intergenic
1054489292 9:65761545-65761567 GTAGTAAATACTAGCTGTATAGG + Intergenic
1056076323 9:83044587-83044609 GGGGAATATAATATATGTATAGG + Intronic
1059150473 9:111945090-111945112 GGGAAAATGACAACCTGTATTGG + Intergenic
1060810134 9:126607143-126607165 GGAGAAAAGACTACCTATAGGGG + Intergenic
1202780132 9_KI270717v1_random:25985-26007 GTAGTAAATACTAGCTGTATAGG - Intergenic
1189005200 X:36986900-36986922 TGGGAAAAAAGTTCCTGTATGGG - Intergenic
1189043829 X:37571042-37571064 TGGGAAAAAAGTTCCTGTATGGG + Intronic
1196614819 X:117756032-117756054 GGGGCAAATACTATTGGTATAGG - Intergenic
1196800938 X:119542695-119542717 GGGGGAAACACTACCTCTTTGGG + Intronic
1197042982 X:121962382-121962404 GGGGAATAGACTGCCTTTATGGG - Intergenic
1197131944 X:123015344-123015366 GGGGAAAATAATAGCATTATAGG + Intergenic
1199581852 X:149368432-149368454 GGACAAGATACTACCTGGATTGG - Intergenic
1201194886 Y:11482496-11482518 GTAGTAAATACTAGCTGTATAGG - Intergenic