ID: 1037107656

View in Genome Browser
Species Human (GRCh38)
Location 8:15129064-15129086
Sequence GTGGTGAAAGGGATGATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037107656 Original CRISPR GTGGTGAAAGGGATGATTAT AGG (reversed) Intronic
900939040 1:5785964-5785986 GGGGTGAAAGGGATGATTTGGGG - Intergenic
901863038 1:12087001-12087023 GCGGTGAATGGGAGGATAATTGG - Intronic
901924504 1:12557487-12557509 GTGGTGGCAGGGATGGTTTTGGG - Intergenic
902149107 1:14428288-14428310 ATGGTGACCTGGATGATTATAGG + Intergenic
902812433 1:18896222-18896244 GTGGTGAATGGGATGGGTACGGG - Intronic
903220743 1:21868450-21868472 ATGGTGACAGGAATGATAATGGG + Intronic
903300962 1:22378551-22378573 GTGGTGAAAGGCATGCTGAGGGG - Intergenic
903476951 1:23626145-23626167 GTGGTGATGGTGATGATGATGGG + Intronic
904797280 1:33066152-33066174 GTGGTAAAAAGGCTGCTTATTGG + Intronic
906977431 1:50590679-50590701 ATGGTGAAAGGGGTCATTCTTGG + Intronic
907537486 1:55178268-55178290 TTGGTGAAAGATGTGATTATAGG - Intronic
910192029 1:84604550-84604572 GTGGAGAGAGGGATGTTCATTGG - Intergenic
911030287 1:93480143-93480165 GTGGGGAAAGGGATTGTTGTGGG - Intronic
911702255 1:100967285-100967307 GTGGTGGGAGGGATGGTTTTGGG + Intronic
913385892 1:118257944-118257966 GTGATGAAAGTGTTGATTGTAGG - Intergenic
916144872 1:161729429-161729451 GAGGTGACAGAGATGAATATGGG + Intergenic
917300714 1:173571083-173571105 GGGGTGAGAGGGATGATCAGTGG + Intronic
919081070 1:192866412-192866434 GTGGTGCCAGGGCTGATCATTGG - Intergenic
921689715 1:218134345-218134367 TTGGAGAAATGGATGATTCTAGG + Intergenic
923052083 1:230396135-230396157 GGAGTAAAAGGGATGAGTATGGG - Intronic
923411641 1:233716036-233716058 ATGGTGAAAGTGATAGTTATCGG - Intergenic
1063348654 10:5335187-5335209 GTGGGTAAAGGGAGGATTAGGGG + Intergenic
1068958505 10:62843629-62843651 ATGGTGGAAGGGAGGATTATGGG - Intronic
1072854188 10:98929273-98929295 GTGGAAAAATGGAAGATTATAGG - Intronic
1073234694 10:102003967-102003989 TTGGACAAAGGGATGATTACGGG - Intronic
1075323630 10:121512292-121512314 GTAGAGAAAGAGATGCTTATCGG - Intronic
1077200228 11:1303113-1303135 GCGGTGAAAGGGAAGAGTACAGG + Intronic
1077930589 11:6727947-6727969 GTGGTGAGGGGGATGATGAGGGG + Intergenic
1078804825 11:14687842-14687864 GAGGTGAAATGGATGCTAATTGG + Intronic
1079646781 11:22873053-22873075 GTGGCTAAAAGGATCATTATTGG + Intergenic
1080390386 11:31840504-31840526 GTTGCTAAGGGGATGATTATAGG + Intronic
1081496092 11:43612006-43612028 TTTTTGAAAGGGATGAGTATAGG + Intronic
1081827281 11:46068229-46068251 CTGGTGAAAGGCATGATACTAGG - Intronic
1083687020 11:64382555-64382577 GTGGAGAAAGGGATGGATGTTGG + Intergenic
1088707228 11:112474755-112474777 GGGGTGGAAGGGAGGATTAGGGG - Intergenic
1090477730 11:127038754-127038776 GTGGAGAAAAGGATAATTAATGG + Intergenic
1091130584 11:133143709-133143731 ATGAGGAAAGGGATGTTTATTGG + Intronic
1091765292 12:3116348-3116370 TTGGTAAAAGGGATGTTTTTGGG + Intronic
1092205860 12:6613901-6613923 GTGGTGGAAGGGAGTATTATGGG - Intergenic
1093292221 12:17341802-17341824 GTGGTGAAAGGGATGTAAAGGGG - Intergenic
1094414037 12:30199669-30199691 GGGGTGAAAGGGATGGCTTTGGG + Intergenic
1095264497 12:40138212-40138234 ATGGAGAGAAGGATGATTATTGG + Intergenic
1099555727 12:84106466-84106488 GTGGTGAAAAGGCCGCTTATTGG - Intergenic
1100129575 12:91474842-91474864 GTGGAGAAAGGGGAGGTTATTGG - Intergenic
1100129714 12:91476505-91476527 GTGGAGAAAGGGGAGTTTATTGG - Intergenic
1100294529 12:93248514-93248536 GTAGTGAAAGGAATGAGGATGGG + Intergenic
1100629981 12:96378474-96378496 GTGGAGAAATGGCTGATTCTAGG - Intronic
1101816193 12:108147934-108147956 GGGGTGAAAGTGATGGTGATGGG - Intronic
1105956825 13:25291242-25291264 TTGGGGAAATGGATGATTCTAGG - Intergenic
1106127045 13:26909210-26909232 GTGTTGAGAGGGAGGATTGTGGG - Intergenic
1106401411 13:29434821-29434843 GAGGTTAATGGGATGATTAGTGG + Intronic
1106897114 13:34315355-34315377 ATGGAGAAAGGGATGAAAATAGG - Intergenic
1107610754 13:42110511-42110533 GTGGGCAAAGGGATTATTCTTGG + Intronic
1108615869 13:52131474-52131496 TTGTTGAAATGGATGATTTTGGG + Intergenic
1109157536 13:58929178-58929200 GTGGTCAAAGGTATGATTCTAGG + Intergenic
1109471200 13:62806649-62806671 GTGGGAAAAGGGATGGTTGTTGG + Intergenic
1113011340 13:105770568-105770590 CTGGTGAAATAGATGATTCTGGG - Intergenic
1113054333 13:106251878-106251900 TTGGCGAAAGGCATGGTTATGGG - Intergenic
1114443608 14:22770886-22770908 GTGGGGAAATGCATGGTTATGGG - Exonic
1115054399 14:29105021-29105043 GTTGTGAAAGGCATAATTTTGGG + Intergenic
1117131601 14:52692920-52692942 GTAGTGGAAGGGATGAGGATCGG - Intronic
1118574579 14:67229092-67229114 GTGGTGAAAGTGAAGCTTAGAGG + Intergenic
1120333291 14:83121057-83121079 GAGGTAAAAGGGAAGATTACAGG + Intergenic
1124067794 15:26362341-26362363 GTGATGAAAGAGATTATTTTAGG + Intergenic
1124390779 15:29255140-29255162 CTGGAGAAATGGCTGATTATAGG - Intronic
1124718264 15:32087400-32087422 CTGGAGAAAGGGCTGATTCTAGG - Intronic
1127195476 15:56580615-56580637 GTGCTCAAATGAATGATTATAGG + Intergenic
1127278982 15:57472662-57472684 GTGGAGAAAGGGATGGGAATAGG + Intronic
1127375482 15:58380835-58380857 ATGGAGAAATGGCTGATTATAGG - Intronic
1128947252 15:71835242-71835264 GTGGTGATAGTGATCATTACTGG - Intronic
1129456619 15:75679431-75679453 CTTTTGAAAGGGAAGATTATGGG + Intronic
1130741281 15:86603186-86603208 GTGGAGAAATGGATGATGGTGGG - Intronic
1132153652 15:99480021-99480043 GTGGTGATAGAGATGATATTAGG + Intergenic
1133130772 16:3674968-3674990 GTGGGGAAAGGGCTGCTTTTTGG + Intronic
1138164133 16:54784440-54784462 GTGGTGAAATGGATGGTCAAGGG + Intergenic
1140460649 16:75137072-75137094 TTGGAGAAAGGGCTGATTTTAGG + Intergenic
1141873005 16:86802106-86802128 GTGGTGAAGGTGATGATTGATGG + Intergenic
1142715525 17:1745150-1745172 GTGGAGAAAGGGATGAGGATAGG - Intronic
1147043827 17:37738327-37738349 CTGGTGAAAGGAATGGTTTTAGG - Intronic
1148337965 17:46854002-46854024 GGGCTGAGAGGGATGAGTATCGG + Intronic
1148952349 17:51324552-51324574 GTGGTGTTAGGCATGATTATAGG + Intergenic
1151127940 17:71865477-71865499 GGGGTGGAAGGGATAATTTTGGG - Intergenic
1155912667 18:31522793-31522815 GTGAGGAAAGGGATGAAAATAGG + Intronic
1156850077 18:41715915-41715937 GTGGTGAGGGGGATGAAGATGGG + Intergenic
1157409870 18:47454595-47454617 GTGGTGGGAGGGATGGTTTTGGG + Intergenic
1161186252 19:2922997-2923019 GTGGTGAAAGTGATGATCTGTGG + Intergenic
1163828664 19:19537558-19537580 GTGGTGGGAGGGCTGTTTATTGG - Exonic
1164329986 19:24245026-24245048 GTGGTGAAAAGGCTGCTTATTGG + Intergenic
926132411 2:10312355-10312377 GTGGTGATGGTGATGATGATGGG - Intronic
926132447 2:10312703-10312725 GTGGTGATGGTGATGATGATGGG - Intronic
927117214 2:19916772-19916794 CTGGGGAAAGGGGTGGTTATGGG + Intronic
927548058 2:23972310-23972332 ATGCTCAAAGGGATGCTTATTGG + Intronic
928127211 2:28625175-28625197 GTGGTGAGAGGGACCCTTATGGG - Intronic
930444712 2:51455752-51455774 GAGGTGACAAGGATGATTCTTGG + Intergenic
930699228 2:54442571-54442593 GAGGTGCTTGGGATGATTATTGG - Intergenic
930934636 2:56933027-56933049 AGGGTGAAAGGTATGTTTATTGG - Intergenic
931035006 2:58230679-58230701 GAGGAGATAGGGATGGTTATGGG - Intronic
932010946 2:67976928-67976950 GTAGTGAAAGGGAAGCTTCTTGG - Intergenic
933013727 2:77095883-77095905 ATGGAGAAAGAGATGTTTATCGG + Intronic
933377859 2:81503070-81503092 GTGGTGAGAGGGTTGATGCTGGG - Intergenic
933573081 2:84036314-84036336 GTGGTGAAAGGAAAGACTAAAGG + Intergenic
934654852 2:96112182-96112204 GTGGTGAGAGTGAAGATTCTGGG + Intergenic
934939212 2:98488230-98488252 GTGGAGAAATGGGTGATTCTAGG - Intronic
935688931 2:105712944-105712966 GTGGTAAAAGAGATGAATATGGG + Intergenic
941922703 2:170867815-170867837 ATGGTTAAAGGGATGCTTGTAGG - Intergenic
943289936 2:186056438-186056460 GTTGTGGAAGGGATGATTATTGG - Intergenic
945043578 2:205763028-205763050 GAGCTGAAAGGGATGATTCAGGG - Intronic
945234159 2:207618985-207619007 GTGGTGAAAGGGAGGCTTCTTGG - Intronic
945936810 2:215910844-215910866 GTGGAGAAAGACATGGTTATGGG + Intergenic
947072332 2:226303956-226303978 GTGATGAAAGGCATGAAAATGGG - Intergenic
947735169 2:232450477-232450499 CTGGAGAAGGGGATGATTCTTGG + Intergenic
947759697 2:232594884-232594906 TTGGTGAAAGAGCTGATTATAGG + Intergenic
948732463 2:239975742-239975764 CTGGTGGAAGGAAGGATTATGGG - Intronic
1168880735 20:1204199-1204221 GTGGTGATAGGGAGGAACATAGG + Intronic
1172608806 20:36233980-36234002 GTGGTCCAAGGGATGAGTTTAGG - Intergenic
1175460370 20:59147906-59147928 GTGGTAAAAGGGGGGATTACAGG + Intergenic
1175891537 20:62318110-62318132 GTGGGGAAAGGGATGAGGATTGG + Intronic
1176662754 21:9655063-9655085 GTGGTGAAGGAGAAGATTGTTGG - Intergenic
1176662816 21:9655642-9655664 GTGGTGAAAGAGAAGACTGTTGG - Intergenic
1178258818 21:31079988-31080010 TAGGTGAAAGGGATGATTGTGGG - Intergenic
1182342068 22:29631274-29631296 GTGGTGAAGGGGCTGACAATAGG - Intronic
1183804750 22:40198964-40198986 TTGGAGAAATGGCTGATTATAGG + Intronic
1184243683 22:43224798-43224820 CTGATGAAAGTGATGATCATGGG + Intronic
1184289719 22:43492054-43492076 GTGGTGCTGGGGGTGATTATAGG + Intronic
949878048 3:8639623-8639645 GTGGAGAAAGGCATTATTAATGG + Intronic
950246845 3:11428292-11428314 GTGGTGAAAGGGCTGCTGTTTGG + Intronic
953469184 3:43152436-43152458 TTGGGGAAAGGGCTGAGTATAGG + Intergenic
953648664 3:44779276-44779298 TTGGTGAAATGGCTGATTCTAGG - Intronic
954853774 3:53625578-53625600 GTAGGGAAAGGGATGCTTGTAGG - Intronic
955203274 3:56872182-56872204 GTGGGGAAAGGGGTGTTCATAGG + Intronic
956946598 3:74230341-74230363 GTGGTGAAAGAGATTTTTAAAGG - Intergenic
957290284 3:78269807-78269829 TTGGTTAAAGGAATGGTTATTGG + Intergenic
959962880 3:112320480-112320502 GTGGTGTCAGGGAAAATTATTGG + Intergenic
960165529 3:114397055-114397077 GTGTTGAAATGGTTGATCATGGG - Intronic
960169881 3:114447759-114447781 GTAGTGAATGGGATAACTATAGG - Intronic
960360155 3:116700988-116701010 GAGGTGAAAGGGAGGAGTTTAGG + Intronic
960361964 3:116723732-116723754 GTGCTGACTGGCATGATTATGGG - Intronic
960423085 3:117473215-117473237 GTTGTGAGGTGGATGATTATGGG - Intergenic
961921028 3:130426728-130426750 GTTGTTAAAGGGATGATCATGGG + Intronic
962206984 3:133442821-133442843 GTGGGGAAAGGGAAGATTTGTGG + Intronic
962230064 3:133657051-133657073 GAGTTGAAAGGGATAAATATAGG - Intronic
963347842 3:144117078-144117100 GTGAGGAAAGGGATGCTTCTGGG - Intergenic
963727727 3:148940723-148940745 GTGGGAAAAGGGATGGTTCTGGG - Intergenic
964838391 3:160966700-160966722 GTGGGGAAGGGGATGATACTTGG + Intronic
966519621 3:180858899-180858921 GTGCTGAAAGGGAAGTTTATGGG + Intronic
970369660 4:15394215-15394237 GAGGTGCAAGGGATGATAAGAGG + Intronic
970714770 4:18908289-18908311 TTGGGGAAAGGGGTGGTTATGGG + Intergenic
975016870 4:69432558-69432580 GTGATGTTAGGGATGATGATAGG + Intergenic
976870293 4:89784378-89784400 GTGTTGGAAGGGATCATTATAGG - Intronic
977583361 4:98748341-98748363 GTGGTCAAGGGGATGAACATCGG - Intergenic
978105328 4:104895303-104895325 GTTGTGAAAGGAGTGATCATAGG - Intergenic
978558559 4:110007206-110007228 GTGTAGAAAGGGATGATGACTGG - Intronic
979606241 4:122641950-122641972 GTGGTGAAGAGGAGGATTTTTGG + Intergenic
980840896 4:138260132-138260154 GTGGGGAAAGTGATTATTAAAGG + Intergenic
980929546 4:139172414-139172436 GTGGATAAAGGGATGATTCATGG - Intronic
981078609 4:140616284-140616306 GTGGTGAAAGAGATGACCACAGG + Intergenic
982597789 4:157407141-157407163 GTGGTGATAGGGATGCTGTTTGG - Intergenic
982718982 4:158839850-158839872 GTGGAGAAATGGCTGATTCTAGG - Intronic
983103978 4:163662522-163662544 GGGCTGAAAGGGAAGATTCTGGG - Intronic
984875128 4:184360861-184360883 GTGGGGAAAGGGCTGATGAGTGG - Intergenic
985412582 4:189701115-189701137 GTGGTGAAGGAGAAGATTGTTGG + Intergenic
985684459 5:1274493-1274515 GTGGGGAAGGGGATGGTTTTGGG + Intronic
986436733 5:7741547-7741569 ATGGTGATAGGGATGGTGATGGG - Intronic
988209319 5:28183064-28183086 ATGGAGAAAAGGATGATTCTAGG + Intergenic
988775979 5:34478399-34478421 GTGGGCAAAGGGATGATTTCTGG + Intergenic
989403103 5:41030352-41030374 GTTGTAAAAGGGATTATTGTTGG - Intronic
989415669 5:41172565-41172587 GTGCTGAAAGGGGAGATGATGGG - Intronic
991393131 5:66171107-66171129 GTGGGGAAAGAGATGATACTGGG + Intronic
992733042 5:79691123-79691145 GAGGTGGAAGGGAGGACTATGGG + Intronic
993653705 5:90552874-90552896 GAGGTGAAAGGATTGAATATAGG - Intronic
994233735 5:97338110-97338132 TTGGTGGATGGGATAATTATTGG + Intergenic
995921381 5:117318277-117318299 GTTTTGAATGTGATGATTATTGG + Intergenic
999383530 5:151138617-151138639 GTGGTTAATGGGAAGATTCTGGG - Intronic
1001010068 5:168089367-168089389 GTGATGAAAGGGATGTTTTAAGG - Intronic
1001705230 5:173736777-173736799 ATGGACAAATGGATGATTATAGG + Intergenic
1003222879 6:4177424-4177446 CTGGTCACTGGGATGATTATAGG - Intergenic
1004005047 6:11630577-11630599 GTGGAGAAAGGGATAAATATGGG + Intergenic
1008036515 6:46751136-46751158 GTGGTGAATGGCATGATTCCAGG + Intronic
1008389063 6:50928326-50928348 GTAGTGAAAGGTGTGATTATAGG - Intergenic
1012863529 6:104590821-104590843 GTGGTGTAAGGCATGATCTTTGG - Intergenic
1013305397 6:108843117-108843139 GTGGTGAAAGTGGTGAATCTAGG - Intergenic
1014329211 6:120039205-120039227 GTGATGAAAGTGATGATTAAAGG - Intergenic
1015664346 6:135610748-135610770 GTGGTCAAAGGAATGATTTAAGG - Intergenic
1017599616 6:156066453-156066475 GAGCTGAAAGGGATTATTATTGG + Intergenic
1017729480 6:157302338-157302360 CTGGTGAAAGGAATCATTATAGG - Intronic
1022058663 7:26768909-26768931 TTGGTGAATCTGATGATTATGGG + Intronic
1022457153 7:30567368-30567390 GTGGAGATGGGGATGATTGTAGG - Intergenic
1025822221 7:64976927-64976949 GTGGAGTAAGGGTTGATGATAGG + Exonic
1025973033 7:66345946-66345968 GTGGGGGAGGGGATAATTATAGG - Intronic
1027139591 7:75647801-75647823 GCTGTGAAAGGGAAGATCATGGG + Intronic
1027977153 7:85173433-85173455 GTGTTTAAAGGGATAATTTTGGG - Intronic
1029535227 7:101154134-101154156 GAGGTGAATGGGACGATCATTGG - Intergenic
1030185639 7:106759066-106759088 GTGGTGTAAGGGGTGGTTACAGG - Intergenic
1030730652 7:112983853-112983875 GTGGAGAAAGGGAGGAGTACAGG - Intergenic
1030915835 7:115312056-115312078 ATGGAGAAAGGTATAATTATGGG - Intergenic
1031922170 7:127610132-127610154 GTGGAGAAAGGGAGGAATATGGG - Intergenic
1036025709 8:4906387-4906409 GTTGTCAAAGGGATGAATAGAGG + Intronic
1036792476 8:11730645-11730667 GTGGGAAAAGGGATGATATTTGG + Intronic
1037107656 8:15129064-15129086 GTGGTGAAAGGGATGATTATAGG - Intronic
1038114766 8:24541108-24541130 TTGGTAATAGGGATGATGATTGG - Intergenic
1040352698 8:46584633-46584655 GTGGTGAAAAAGCTGCTTATTGG + Intergenic
1041453281 8:58030838-58030860 GTCATGAAAGTGATGGTTATCGG - Intronic
1042924651 8:73954729-73954751 GTGGTTAAAAGGCTGACTATGGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043748740 8:83908929-83908951 TTGGTGAATCTGATGATTATGGG + Intergenic
1047338508 8:123958114-123958136 ATGGACAAAGGGATGATTGTGGG - Intronic
1048433380 8:134391458-134391480 ATGGAGGAAGGGCTGATTATTGG - Intergenic
1049479144 8:142811748-142811770 TTGGAGAAAGGGCTGATTCTAGG + Intergenic
1050996735 9:12230345-12230367 GAGGTGAGAATGATGATTATGGG + Intergenic
1053143736 9:35698057-35698079 GTGGTGAAAGAGAAGATGGTTGG - Exonic
1055793255 9:79946485-79946507 TTGGGGAAAGGGATAATTCTAGG - Intergenic
1055862834 9:80774161-80774183 ATGGGAAAAGTGATGATTATTGG - Intergenic
1056073193 9:83010459-83010481 GTGGGGAAATGGAAGATTAGAGG + Intronic
1203670009 Un_KI270755v1:1867-1889 GTGGTGAAGGAGAAGATTGTTGG - Intergenic
1187221351 X:17329133-17329155 GTGGAGACAGGCATGATTAAAGG + Intergenic
1191053306 X:56217274-56217296 ATGGTAAAAGGGCTCATTATTGG + Intergenic
1195269230 X:103214598-103214620 GTGGAGAAAAGGATGAGCATTGG + Intergenic
1196896417 X:120341249-120341271 GTGGTGAAAGGCAGGAGAATGGG - Intergenic
1197895776 X:131312930-131312952 TTGGAGAAATGGATGATTTTAGG + Intronic
1198155959 X:133961112-133961134 GTGGGGAAAGTGATGATTGCTGG + Intronic
1200471694 Y:3593833-3593855 TTGGTGAATCTGATGATTATGGG + Intergenic
1201688628 Y:16736556-16736578 TTGGTGAATCTGATGATTATGGG + Intergenic