ID: 1037108448

View in Genome Browser
Species Human (GRCh38)
Location 8:15137985-15138007
Sequence CCATGAAAGCAGTCCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037108441_1037108448 -2 Left 1037108441 8:15137964-15137986 CCACAGACGCTCAAAGCCAGCCC 0: 2
1: 14
2: 330
3: 878
4: 1267
Right 1037108448 8:15137985-15138007 CCATGAAAGCAGTCCCGGAGGGG No data
1037108440_1037108448 8 Left 1037108440 8:15137954-15137976 CCTGGAAATGCCACAGACGCTCA 0: 1
1: 22
2: 902
3: 1265
4: 1822
Right 1037108448 8:15137985-15138007 CCATGAAAGCAGTCCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037108448 Original CRISPR CCATGAAAGCAGTCCCGGAG GGG Intronic
No off target data available for this crispr